ID: 985509258

View in Genome Browser
Species Human (GRCh38)
Location 5:302966-302988
Sequence CTTCCCAAGGGGAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985509249_985509258 4 Left 985509249 5:302939-302961 CCCTGCATAACTGCTGGAGGGCG 0: 10
1: 5
2: 2
3: 5
4: 74
Right 985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG 0: 2
1: 0
2: 2
3: 17
4: 172
985509245_985509258 27 Left 985509245 5:302916-302938 CCTTTGTGGGAAGAGCACAGCTT 0: 7
1: 9
2: 2
3: 28
4: 302
Right 985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG 0: 2
1: 0
2: 2
3: 17
4: 172
985509250_985509258 3 Left 985509250 5:302940-302962 CCTGCATAACTGCTGGAGGGCGG 0: 10
1: 6
2: 1
3: 10
4: 71
Right 985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG 0: 2
1: 0
2: 2
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985509258 Original CRISPR CTTCCCAAGGGGAAGTTGGG AGG Intronic
903054596 1:20626789-20626811 ATGCCCAAGGGGAAGCTGAGAGG - Intergenic
907946022 1:59137399-59137421 CTTCCCACAGAGAAGTGGGGGGG - Intergenic
908339063 1:63157842-63157864 GTGCCCAGTGGGAAGTTGGGAGG + Intergenic
909940848 1:81610054-81610076 CTCCCCAAGAGGCAGGTGGGAGG - Intronic
913587026 1:120285651-120285673 CTTCGCAAGGCCAAGGTGGGAGG + Intergenic
913621159 1:120612719-120612741 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
913743004 1:121870119-121870141 CATTCCAAGGGGAATTTTGGAGG - Intergenic
914569040 1:148897536-148897558 CTTCGCAAGGCCAAGGTGGGAGG + Intronic
914603787 1:149232720-149232742 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
920374572 1:205500954-205500976 CCTCCCAGGGGAAAGTGGGGCGG + Intergenic
921779341 1:219143113-219143135 CTTCCTATGAGGCAGTTGGGAGG - Intergenic
921856268 1:219988617-219988639 CTTCTCAAGGGGAAGTAGTTCGG - Exonic
922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG + Intergenic
1066424163 10:35290716-35290738 CTTTCCAAGGCCAAGGTGGGAGG + Intronic
1069571760 10:69498468-69498490 CTTCCCAACTTGAAGATGGGTGG + Intronic
1070383817 10:75905809-75905831 CTTCCCAAGAGCAAGTTTGAAGG - Intronic
1072942971 10:99783996-99784018 CTTGTGAAGTGGAAGTTGGGGGG - Intronic
1073928702 10:108547936-108547958 CTTCCAAGGGGGAACTTGAGAGG + Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1075974346 10:126682708-126682730 CTTCCCCTCGGAAAGTTGGGAGG - Intergenic
1076298121 10:129403231-129403253 CCTCTCATGGGGTAGTTGGGAGG - Intergenic
1077351990 11:2097295-2097317 CTTCCCGAGGGGAGATCGGGGGG - Intergenic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077958170 11:7043967-7043989 CTTACCAAGTGTTAGTTGGGAGG - Exonic
1081155078 11:39680242-39680264 TTTCCCTACCGGAAGTTGGGTGG + Intergenic
1083839687 11:65297156-65297178 CTTACCAAAGGGCAGGTGGGAGG + Exonic
1084938115 11:72597973-72597995 CTTCCCAAGGAGAACTAGGGTGG + Intronic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1088725287 11:112629219-112629241 CTTCTCAAGGGGCTGTTTGGGGG - Intergenic
1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG + Intergenic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089633541 11:119797879-119797901 CTTCCCAAAGGGAAGATGGCTGG - Intergenic
1091375540 12:22622-22644 CTTCCCAGGGGGAAGGTGCTGGG + Intergenic
1093908760 12:24722320-24722342 TCTTCCAAGGGGAGGTTGGGTGG + Intergenic
1094059261 12:26296177-26296199 TTTCCCAAGTGGAAGATGTGTGG - Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1100618231 12:96248032-96248054 ATTTCCAAGGGAAAGTTGAGCGG + Intronic
1101235623 12:102786720-102786742 GGTCCTAAGGGGAATTTGGGTGG - Intergenic
1101292668 12:103387528-103387550 CTTGCCAAGGGGAAGAGGAGTGG + Intronic
1103471961 12:121189419-121189441 CTTCCCAAGAGGAAGAGGAGGGG - Intergenic
1103716528 12:122948558-122948580 CCTCCTAAGGGGATGTTTGGGGG + Intronic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1108161322 13:47642998-47643020 ACTGCCAAGGGGAAGTAGGGTGG - Intergenic
1108186873 13:47896662-47896684 CTTCCCAAGGTGCTGTTGTGAGG - Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1111567007 13:90029267-90029289 CTTCCCTAGGAGAAGCTAGGAGG + Intergenic
1113505982 13:110816233-110816255 CTTTCCAAGGGGTTGTTGGAAGG - Intergenic
1114893584 14:26957459-26957481 TTTACCAAGGGGAAGGTGGTGGG + Intergenic
1119899129 14:78244870-78244892 CTTCCCAGGGAGAAGCAGGGAGG + Intronic
1126018281 15:44374403-44374425 CTTTCCAAGGTCAAGGTGGGAGG + Intronic
1127902914 15:63354470-63354492 CTCCCCAAGGGGAGATTTGGGGG - Intronic
1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG + Intergenic
1131367226 15:91852000-91852022 CTTCTCAGGAGGAAGTGGGGAGG + Intergenic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1132601734 16:775855-775877 CTTCCCAAGTGGACTCTGGGTGG + Intronic
1133654431 16:7846609-7846631 ATCCCCAAGGGGAAGATGGGAGG - Intergenic
1135381225 16:21997742-21997764 TTTCCCAAGAGGAAGTTGCTAGG + Intronic
1140649546 16:77072041-77072063 CCTCAAAAGGGAAAGTTGGGAGG + Intergenic
1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG + Intergenic
1143556957 17:7667992-7668014 GTTCCCAAGGGGAACAGGGGTGG - Intronic
1147331755 17:39703392-39703414 CTTCCCAGGGGGAGGATGGGTGG - Intronic
1148152923 17:45406858-45406880 CTTTCCAAGGTGAAGTTTGCAGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152002268 17:77654282-77654304 CATCCCAAGGGCAGGATGGGGGG + Intergenic
1152575066 17:81136385-81136407 GTTCCGAAGGGGAGGTTGAGGGG - Intronic
1155044011 18:22088107-22088129 TTTCCCAAGGGGAACTTCAGGGG + Intronic
1157688874 18:49664699-49664721 CTTCCCCAGAGGAAGGGGGGTGG - Intergenic
1158941486 18:62409330-62409352 CTTCCCAAGCCCAAGTGGGGTGG - Intergenic
1159123593 18:64197704-64197726 CTTCCCAAGGCCAAAGTGGGAGG + Intergenic
1160242415 18:77132946-77132968 CTGCCCACGCGGAACTTGGGGGG + Intronic
1161221225 19:3119133-3119155 CAGCCCAAGGGGCAGCTGGGGGG - Intronic
1161742622 19:6032613-6032635 CCTGCCAAGTGGGAGTTGGGAGG - Intronic
1163375142 19:16925477-16925499 AGTCCCAAAGGGCAGTTGGGTGG - Intronic
1163655914 19:18544643-18544665 CTTGCCTTGGGGAGGTTGGGAGG - Intergenic
1164820953 19:31250988-31251010 CTTCCCAGTGGAAAGGTGGGTGG - Intergenic
1166319181 19:42005960-42005982 GATCACAAGGGGAAGATGGGAGG + Intronic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1167825012 19:51964522-51964544 CTTCATAAGGGGCAGTTGGTGGG - Exonic
924977663 2:192783-192805 CTACCCAGGGGAAAGTTGGGTGG + Intergenic
926691019 2:15733427-15733449 CATCCCTAGGGGAAGTTTTGGGG + Intronic
928359626 2:30652834-30652856 CTTCTCAATGGGAAGTTTGTGGG - Intergenic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
929581886 2:43086559-43086581 CTCCCCAAGAGGAAGTGGGTGGG - Intergenic
929856652 2:45643488-45643510 CTTCCCAAGGCCAAGGTTGGAGG - Intergenic
929979066 2:46662135-46662157 TTTCCCAAAGGGAATTTAGGTGG + Intergenic
930612864 2:53562749-53562771 CTTCCCAGAGGGAGGTGGGGAGG + Intronic
932379498 2:71269478-71269500 CTTCCCAAGGAGATGTAGGGAGG - Intergenic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
936933602 2:117815541-117815563 CTCCCCGAGGGAAAGTTTGGAGG + Intronic
937042413 2:118832905-118832927 TTTCACAAGGGGCAGTTGGAAGG - Intergenic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
939956647 2:148532942-148532964 CTTCCCAAGTGGAAGTCCTGTGG - Intergenic
941385013 2:164841654-164841676 TTTCCCGAAGAGAAGTTGGGAGG + Intronic
943402450 2:187431500-187431522 CTTTTCAATGGAAAGTTGGGAGG + Intronic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
948231196 2:236350834-236350856 CTTCCCCTGGGGAAGCTGAGGGG + Intronic
948839913 2:240643757-240643779 CTTCCCCAGGGTAAGCAGGGCGG - Intergenic
1169236574 20:3934426-3934448 CTTCACACGTGGAAGATGGGAGG - Intronic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1172692831 20:36802447-36802469 GTTCCCATGGGAAAATTGGGAGG - Intronic
1173158305 20:40633543-40633565 GTTCCTTATGGGAAGTTGGGAGG - Intergenic
1174328477 20:49798619-49798641 CTTCCCATTAGGAATTTGGGTGG + Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1177586477 21:23102403-23102425 CTTGCCAAGGGGCACCTGGGAGG - Intergenic
1179066159 21:38026660-38026682 CTGCCCAATGGGATGTTAGGAGG - Intronic
1182077452 22:27504703-27504725 TTTACCAATGGCAAGTTGGGAGG + Intergenic
1182317982 22:29460340-29460362 CTTCCCTAGGAGGATTTGGGTGG + Intergenic
1183036130 22:35142277-35142299 AGTACCAAGGGGAAGTTGGTTGG - Intergenic
1183315523 22:37135043-37135065 CAACCCGAGGGGAAGGTGGGAGG - Intronic
952717202 3:36492085-36492107 CTTCACAAGAGGAATTTAGGGGG - Intronic
954583508 3:51716270-51716292 GATCCCAAGGGGAAGGTGGGAGG + Intronic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
961098098 3:124174988-124175010 CTTCCAAAGGGGCAGCTGGCAGG + Intronic
968232243 3:197010909-197010931 CTTCCCCTGGGGAATGTGGGTGG + Intronic
969553615 4:7890825-7890847 CTTCCCACCGGGAAAGTGGGAGG - Intronic
969611461 4:8229693-8229715 CTGCCCAAGGAGGAGTGGGGGGG + Intronic
969916040 4:10492586-10492608 CTTCCCTCGGGGCTGTTGGGAGG + Intronic
970785520 4:19791969-19791991 TTTCCCAAGGGAAAGTTAGGAGG + Intergenic
973890363 4:55362062-55362084 GTTCCCCATGGGAAGTTTGGGGG + Intronic
978123072 4:105104760-105104782 TTTCACAAGGTGAAGTTGTGTGG - Intergenic
980340963 4:131546996-131547018 CTTCCGGAGGGCAAGGTGGGAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985683335 5:1268485-1268507 CTTCCCCAGGGGGGCTTGGGTGG - Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG + Intergenic
986236668 5:5916868-5916890 CTTCCCCACTGGAAGTTGTGAGG + Intergenic
986990023 5:13541248-13541270 CTTTCCAATGGAAAGTTAGGTGG + Intergenic
987295725 5:16549358-16549380 CTTCCCTAGTGGAAATAGGGGGG - Intronic
994825664 5:104710198-104710220 GTTCCCAGAGAGAAGTTGGGTGG - Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
997912493 5:137889641-137889663 CTTCCCCAGGGGAGGCTGTGAGG - Intronic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1001514424 5:172345418-172345440 CCTCCCAAGGTGAGGTGGGGAGG + Intronic
1001763590 5:174227081-174227103 CCTCACAGAGGGAAGTTGGGAGG - Intronic
1003946450 6:11080461-11080483 CTTCCCCAGAGGATGTGGGGTGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006415911 6:33903855-33903877 CTGCCCAAGCGGATGTTAGGCGG - Intergenic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1007234925 6:40383796-40383818 CTTCCCAAGGGGTGGTGGGATGG - Intergenic
1007472340 6:42099074-42099096 ATTCTCAAGGGGAAGGAGGGAGG + Intergenic
1007633774 6:43286220-43286242 TTTCCCAGTGGGAAGTTGGAGGG + Exonic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1015858136 6:137647492-137647514 CCTCACAAGGGGCAGTTGTGAGG + Intergenic
1016060655 6:139626549-139626571 CTTGCCAAAGGGATGTTGGCAGG - Intergenic
1016916714 6:149250690-149250712 ATTCCAAAGGGGAAGTTTAGGGG + Intronic
1019179060 6:170175865-170175887 CCTCCCAAGGAGAACTTCGGGGG + Intergenic
1022842465 7:34177849-34177871 ATTCTCAAAGGGAAGTTGAGTGG - Intergenic
1023131474 7:37007393-37007415 CATGCCCAGGGGAAGCTGGGAGG - Intronic
1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG + Intronic
1024673913 7:51621185-51621207 CTTCCCAGGGGGAAGCCGGGAGG - Intergenic
1024924612 7:54599823-54599845 CTTCTCATGGGGAAGTTAAGGGG - Intergenic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1028990517 7:97044418-97044440 TTTCCCATGTGGAAGGTGGGGGG - Intergenic
1030388228 7:108892196-108892218 CCTCCCAAGGGGAAGGTTAGGGG - Intergenic
1031682605 7:124692803-124692825 CTTACCAAGAGGAATTTGGATGG + Intergenic
1035398228 7:158548931-158548953 CTTGCCAAGGAGGAGATGGGTGG - Intronic
1035620099 8:1029971-1029993 CATCCCGAGAGGAAGCTGGGAGG + Intergenic
1038066320 8:23967310-23967332 CCTCCCAAGGGGCTGTTGGAGGG - Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1040409921 8:47143787-47143809 CTTCCCAGGGTGAGGTGGGGAGG - Intergenic
1040937236 8:52794520-52794542 CTTCGCAAGAGAAAGCTGGGTGG - Intergenic
1040937340 8:52795392-52795414 CTTCGCAAGAGAAAGCTGGGTGG + Intergenic
1048020572 8:130535271-130535293 TTGCCCAAAGGGAAGCTGGGTGG - Intergenic
1053158493 9:35796773-35796795 CTTCCCCATTGGAAGGTGGGGGG - Intronic
1053296205 9:36914688-36914710 TATCCCAAGGGGATGCTGGGTGG + Intronic
1055196724 9:73603256-73603278 CTTGCCAATGGGAATGTGGGAGG + Intergenic
1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG + Intronic
1059263251 9:112999882-112999904 CTTCCCAGAGGTTAGTTGGGTGG + Intergenic
1059345503 9:113625367-113625389 CTCCCCAAAGGGCTGTTGGGTGG - Intergenic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1062114074 9:134798182-134798204 CGTCCCATGGGGCAGTTGTGAGG + Intronic
1062187166 9:135224255-135224277 CTTCCCAAGGGGGAGCACGGTGG + Intergenic
1062187186 9:135224317-135224339 CTTCCCAAGGGGGAGCACGGTGG + Intergenic
1062187207 9:135224379-135224401 CTTCCCAAGGGGGAGCACGGTGG + Intergenic
1062187226 9:135224440-135224462 CTTCCCAAGGGGGAGCACGGTGG + Intergenic
1062187247 9:135224502-135224524 CTTCCCAAGGGGGAGGACGGTGG + Intergenic
1062193513 9:135259681-135259703 CTTCCCCAGGAGAGGCTGGGTGG + Intergenic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1187408316 X:19024400-19024422 TTTCCTAAGGGGGAGTTGTGAGG - Intronic
1187969688 X:24647239-24647261 CTTCCCTAGGGGAAGTAAAGAGG + Intronic
1188147353 X:26630238-26630260 TATTCCAATGGGAAGTTGGGGGG + Intergenic
1189231537 X:39455934-39455956 CTTCCCTTGGAGCAGTTGGGGGG - Intergenic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1193205885 X:78746937-78746959 CTTGCCATGGGGGAGGTGGGCGG + Intergenic
1194455458 X:94097850-94097872 CTTCCTCAGGGGAATTTGGAAGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1197821699 X:130547746-130547768 TTTCCCAGGGAGAAGTTGGGTGG + Intergenic
1198808782 X:140514028-140514050 GTTCCCAAGGTGAAGTTTAGTGG + Intergenic
1199619461 X:149686339-149686361 CTTCCTTGAGGGAAGTTGGGTGG + Intergenic