ID: 985511537

View in Genome Browser
Species Human (GRCh38)
Location 5:316779-316801
Sequence CAGAGGGTGAGGAGGGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 927}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985511529_985511537 -3 Left 985511529 5:316759-316781 CCAGAGCAGAAGTTCTTCAGCAG 0: 1
1: 0
2: 3
3: 44
4: 493
Right 985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG 0: 1
1: 0
2: 5
3: 74
4: 927
985511528_985511537 9 Left 985511528 5:316747-316769 CCGCTGAAAATTCCAGAGCAGAA 0: 1
1: 0
2: 7
3: 43
4: 356
Right 985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG 0: 1
1: 0
2: 5
3: 74
4: 927

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985511537 Original CRISPR CAGAGGGTGAGGAGGGCGGT GGG Intronic
900291153 1:1924161-1924183 CAGTTGGTGAGGTGGGGGGTGGG - Intronic
900384624 1:2404580-2404602 CAGAGACGGAGGAGGGCGGGGGG - Exonic
900467265 1:2831882-2831904 CAGAGGATGAGGCGGGGGGGAGG - Intergenic
900482274 1:2905079-2905101 CAGTGGGTGAGCAGCACGGTGGG - Intergenic
900577370 1:3389951-3389973 CAGAGGGTGGGGGGGGGGGGGGG - Intronic
900622221 1:3592705-3592727 CAGCAAGTGAGGGGGGCGGTGGG - Intronic
901470899 1:9455889-9455911 CAGAGGCTCAGGAGAGGGGTCGG - Intergenic
901564975 1:10106521-10106543 CACTGGGTGAGGCGGGTGGTAGG - Exonic
901650822 1:10742231-10742253 CAGAGGGGCAGGAAGGCGGGAGG + Intronic
901694664 1:10997882-10997904 CCCAGGCTGAGGAGGGTGGTGGG + Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901739602 1:11333727-11333749 TAGAAGGTGAGGAGGGGGGCAGG + Intergenic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
901844703 1:11974600-11974622 CAGACGGGCAGGGGGGCGGTGGG + Intronic
901847287 1:11991489-11991511 CAGAGAGTGGGGAGGGGGTTTGG + Intronic
902119678 1:14152333-14152355 CAGAGGCTGAGAAGGGTAGTTGG - Intergenic
902515229 1:16986417-16986439 CAGCGGGAGAGAAGGGAGGTGGG - Intronic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903103219 1:21052532-21052554 GAGAGGGAGAGGAGGGAGCTAGG - Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
903979593 1:27176321-27176343 CAAAGTGTGAGGAGGGAGGTGGG + Intergenic
904330711 1:29756186-29756208 CAGAGGGAGGGGAGGCCGGAGGG + Intergenic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906660425 1:47577938-47577960 CAGAAGCTGGGGAGGGCAGTGGG - Intergenic
906816253 1:48882770-48882792 CAGAGGCTGGGGATGGGGGTTGG - Intronic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
906972440 1:50530484-50530506 CAGAGGTTGGGAAGGGTGGTGGG + Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907319695 1:53594659-53594681 CACAGGGTGAGGAGGAGGCTGGG + Exonic
907977324 1:59444596-59444618 CACAGCATGAGGTGGGCGGTGGG + Intronic
908642834 1:66244540-66244562 CAGGGAGTGAGGAGGGGTGTGGG - Intronic
908643361 1:66249661-66249683 CAGGGGGTGGGGCGGGTGGTGGG - Intronic
909607624 1:77522598-77522620 GAGAGGGTGGGCAGGGAGGTGGG - Intronic
909855348 1:80522609-80522631 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
910836556 1:91518723-91518745 CAGAGGCTGAGAAGGGTGGTGGG + Intronic
910916954 1:92299285-92299307 CAGGAGGTGCGGACGGCGGTGGG - Intronic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
915100693 1:153497197-153497219 AGGAAGGTGAGGAGGGAGGTTGG - Intergenic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915179627 1:154047090-154047112 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
915238594 1:154502947-154502969 CAGAGGGGGCGGAGCGCGGAGGG + Intronic
915312983 1:155013698-155013720 CTGAGGGGGAGGTGGGGGGTGGG + Intronic
915468686 1:156113340-156113362 CAGAGGATGAGGTGGATGGTGGG + Intronic
915517504 1:156421734-156421756 CAGAGGCAGAGGAGGGAGCTAGG - Intronic
915950468 1:160186856-160186878 CAGAGGATGAGGTGGGCTGAAGG + Exonic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917434178 1:175001983-175002005 CAGAGGCCGAGGCGGGCGGGCGG - Intronic
917740502 1:177957811-177957833 CAGAGGCTGGGAAGGGCAGTAGG - Intronic
918466605 1:184827305-184827327 CGGAGGATGAGGATGGTGGTTGG - Intronic
918704143 1:187640053-187640075 AAGAGGGTGTGGTGGGCGGGAGG + Intergenic
918789430 1:188807466-188807488 CAGAGGCTGAGAAGGGTAGTAGG + Intergenic
919456103 1:197820803-197820825 CAGAGGCTGAGAAGGGTAGTAGG + Intergenic
919736129 1:200952314-200952336 CAGAGAGTGAGGGGCGGGGTGGG - Intergenic
919870304 1:201815566-201815588 CAGAGGCTGGGCAGGGGGGTAGG + Intronic
920309283 1:205039129-205039151 CAGAGGATGAGGAGAGAGGGAGG - Intergenic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
920739736 1:208569150-208569172 CAGAGGCTGGTGAGGGAGGTGGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921293870 1:213683841-213683863 CCCAGGGTGAGGAGGGAGGGAGG - Intergenic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921796510 1:219350930-219350952 AAGAGGGTGAGGAGCCCAGTGGG + Intergenic
922209881 1:223478922-223478944 GAGAGGGTGAGGAGGTGGGGGGG + Intergenic
922209897 1:223478970-223478992 GAGAGGGTGAGGAGGTGGGGGGG + Intergenic
922209933 1:223479064-223479086 GAGAGGGTGAGGAGGTGGGGGGG + Intergenic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922596585 1:226818461-226818483 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
922702797 1:227771661-227771683 CAGAGGGTGGGGGTGGGGGTGGG - Intronic
922718235 1:227887702-227887724 CAGGTGGTGATGAGGGCGGGCGG + Intergenic
923048352 1:230371937-230371959 CAGAGGATGAGGAGGCTAGTTGG + Intronic
923211135 1:231805474-231805496 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924043890 1:240009241-240009263 CTGAGGGTGAGGAGGCCTGGAGG + Intergenic
924384310 1:243487947-243487969 CGGAGGCTGAGCAGGGCGATGGG + Intronic
924539890 1:244970737-244970759 AAGAGGGTGAAGAGGGCGGGAGG - Exonic
924624751 1:245688828-245688850 ACGCGGGTGAGGAGGGCGGCAGG + Intronic
1062764915 10:54187-54209 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1062886928 10:1023656-1023678 CAGAGGCTGCGAAGGGCAGTGGG + Intronic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1064060160 10:12130022-12130044 TAGAGGGCGAGGATGGCGCTGGG + Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064541975 10:16414559-16414581 ATGAGGGTGAGGAGGTGGGTGGG + Intergenic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1065716447 10:28573858-28573880 CTGAGGGTGAGGGGGGTGTTGGG - Intronic
1065764851 10:29019010-29019032 CAGAGGCTGGGGAGGGTAGTGGG + Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066025984 10:31361552-31361574 CAGATGGTGAGGGGGCCGGGTGG + Intronic
1066105059 10:32149006-32149028 CAGGGGGTGGGGAGGTGGGTGGG - Intergenic
1066220658 10:33334714-33334736 GGGAGGGGGAGGAGGGAGGTAGG + Exonic
1066703803 10:38156815-38156837 CAGAGGGTGAGGAGGAGGTCGGG + Intergenic
1069145297 10:64885485-64885507 CAGAGGCTGAGAAGGGTAGTAGG - Intergenic
1069531186 10:69220739-69220761 AAGCGGGTGAGGAGGGTGTTTGG + Intronic
1069543237 10:69311339-69311361 CAGATGATGAGGAGGATGGTGGG + Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1070129382 10:73646552-73646574 TAGAGAGTGAGGAGGAAGGTGGG + Exonic
1070806994 10:79276506-79276528 CAGAGGGTGGCCAGGGTGGTGGG - Intronic
1071038143 10:81272778-81272800 CAGAGGATGGGGAGTGTGGTGGG + Intergenic
1071571152 10:86698087-86698109 CAGAGGTTAAGGAGGTGGGTGGG - Intronic
1072172418 10:92878467-92878489 CAAAGGGTAAGGAGGGCACTGGG - Intronic
1072612542 10:97028276-97028298 CAGAGGGTGAGTGGGGTGGGAGG - Intronic
1072710607 10:97713676-97713698 CAGAAGGCGAGGAGGGCCGAGGG + Intronic
1072732027 10:97852692-97852714 GAGAGGGAGAGGAAGGGGGTGGG + Intronic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073775183 10:106777256-106777278 TAGAAGGTGATGAGGGTGGTGGG - Intronic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075451673 10:122556327-122556349 CAGATGGTGAGGAGTGCCGTGGG + Intergenic
1075802213 10:125160590-125160612 GGGAGGGTGGGGAGGGCGGGAGG - Intronic
1076466642 10:130687365-130687387 CAAAGGCTGAGGAGGCAGGTAGG + Intergenic
1076653435 10:132005556-132005578 CAGAGGCTGAGGATGGCAGTGGG + Intergenic
1076773341 10:132679140-132679162 CACAGGGAGATGAGGGAGGTGGG + Intronic
1077117036 11:889877-889899 CAGAGGGGGAGGGGAGCTGTGGG - Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077420800 11:2449003-2449025 CAGGGGATCAGGAGGGTGGTAGG + Intronic
1077530300 11:3091860-3091882 CAGAGGGTGCAGAGCGCGGCCGG - Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1078124219 11:8543588-8543610 CAGAGGGTGGGAAGGGTTGTTGG + Intronic
1078527321 11:12110749-12110771 CTCAGGGTGGGGAGGGCGGGCGG + Intronic
1079088349 11:17463208-17463230 CAGAGGGAGAGGGGGGTGATGGG - Intronic
1081011623 11:37820318-37820340 CAGAGGCTGAGAAGGGTGGGGGG + Intergenic
1081096695 11:38944900-38944922 CAGAGGCTGAGAAGGGTAGTCGG - Intergenic
1081105369 11:39060892-39060914 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1081659553 11:44879645-44879667 AACAGGGTGAGGAGGGTGGTCGG + Intronic
1082739007 11:56889853-56889875 CAGAGGGTGGGAAGGGTAGTGGG - Intergenic
1083293252 11:61701378-61701400 CAGAGGGAGAGGCGGGCAGCAGG - Intronic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1083993575 11:66261154-66261176 CAGAGGCTGGGGAGAGGGGTGGG + Intronic
1084122710 11:67078508-67078530 CTCAGGGTGAGGAGGAGGGTGGG + Intergenic
1084162406 11:67356914-67356936 AAGAAGGTGTGGAGGGTGGTAGG - Intronic
1084335191 11:68453381-68453403 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1084399814 11:68936995-68937017 CAGAGGGTCAGGAGCGCGCAGGG + Exonic
1084572743 11:69969285-69969307 CAGAGGCTGAGAAGGGTGGTAGG + Intergenic
1084596972 11:70122785-70122807 CAGAGAGTGAGGAGGAGGGAAGG - Intronic
1085106957 11:73853087-73853109 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085325965 11:75606801-75606823 CAGAGCTAGAGGAGGGAGGTTGG - Intronic
1085498921 11:76999620-76999642 CAGGGAGTGAGGAGTGAGGTGGG - Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1085674776 11:78506218-78506240 CAGTGGATGAGGATGCCGGTTGG - Intronic
1086090972 11:83004471-83004493 CAGAAGCTGTGGAGGGCGATGGG + Intronic
1086835530 11:91616976-91616998 CAGGGGCTGGGAAGGGCGGTGGG - Intergenic
1086847075 11:91764258-91764280 CAGAGGCTGAGAAGGGTAGTTGG - Intergenic
1087152394 11:94870452-94870474 CAGAAGGTGAGGATGACAGTGGG - Intronic
1087192102 11:95265817-95265839 CAGAAGCTGAGGAGGGTGGATGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087884392 11:103460476-103460498 CAGTGGGTGGGGTGGGGGGTGGG + Intronic
1088167620 11:106957073-106957095 CAGAGGGTGTGTTGGGCTGTGGG + Intronic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088444423 11:109909410-109909432 GAGAGGGTGAGGTGGGAGGATGG - Intergenic
1088472720 11:110203354-110203376 CAGAGGGTAAGAAGGGTAGTGGG + Intronic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088953464 11:114594015-114594037 CAGAGGCTGGGAAGGGTGGTGGG + Intronic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089913696 11:122129943-122129965 CAGAGGCTGAGAAGGACAGTGGG + Intergenic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090691457 11:129187358-129187380 CAGAGGCTGGGAAGGGTGGTGGG + Intronic
1090799854 11:130163611-130163633 CAGTGGGTGAGGAAGAGGGTTGG + Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091248517 11:134121159-134121181 CAGGGCGTGAGGAGGTGGGTTGG + Intronic
1091268290 11:134287803-134287825 CAGAGGGTGAGGCGGGAAGGAGG + Intronic
1091285781 11:134408154-134408176 AAGCGGGTGAGGAGGGAGGTGGG + Intronic
1091770169 12:3146228-3146250 CAAAGGGGCAGGAGGGCGCTGGG + Intronic
1092361017 12:7836588-7836610 GGGAGGCTGAGGAGGGCGGATGG + Intronic
1092664845 12:10784440-10784462 CAGTGGGTGAGGTGCGGGGTGGG - Intergenic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094380033 12:29832522-29832544 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1094435625 12:30417968-30417990 CTGAGGGTGAGGAGTCAGGTGGG + Intergenic
1094442477 12:30493914-30493936 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1094815123 12:34175662-34175684 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1095329347 12:40939011-40939033 CAGAGGCTGAGGTGGGCAGATGG - Intronic
1095938379 12:47709498-47709520 CAGATAGTGAGGCGGCCGGTGGG - Intergenic
1095961067 12:47834744-47834766 GAGTGGATGGGGAGGGCGGTGGG - Intergenic
1096051133 12:48609099-48609121 CAGGGGGTGAGGTGGGGGGTGGG - Intergenic
1096109422 12:49020280-49020302 CAGGGGGTGGGGAGTGGGGTGGG + Exonic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096675018 12:53221614-53221636 AAGGGGGTGAGGTGGGCGGGGGG + Intronic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098565404 12:71929641-71929663 CAGAGGGTGGGAAGGGTGGTGGG + Intergenic
1098929740 12:76397335-76397357 CAGGGGGTGGGGAGGGGGGGTGG + Intronic
1099972282 12:89512649-89512671 CAGAGGCTGAGGGAGGCGGGCGG + Intronic
1100361909 12:93886938-93886960 CAGAGAGTGAGGTGGGAGGCTGG + Intronic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1101676588 12:106922440-106922462 CAGAGGGTGGGAAGGGCAGTGGG - Intergenic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102256414 12:111418160-111418182 AAGAGGGCGAGGAGGGCTGCAGG - Exonic
1102851209 12:116246836-116246858 GGGAGGGAGAGGAGGGAGGTGGG + Intronic
1103521134 12:121537550-121537572 CAGCCGGGGAGGAGGGCGGCAGG + Intronic
1104509634 12:129365688-129365710 CAGAGGGCGAGGAGGCAGGCAGG + Intronic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104928708 12:132327276-132327298 CAGTGGGGGCGGTGGGCGGTGGG + Intronic
1105346976 13:19582346-19582368 CAGAGGCTGAGAAGGGTGGTGGG - Intergenic
1105356934 13:19667286-19667308 CAGTCGGGGAGGATGGCGGTGGG - Intronic
1105405127 13:20127371-20127393 GTGAGGGTGAGGAGGGTGGGGGG - Intergenic
1105487724 13:20853401-20853423 GAGAGGCTGAGGTGGGAGGTGGG + Intronic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106792521 13:33169993-33170015 CAGAGGCTGAGGAGGGTAGTGGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1108037373 13:46305659-46305681 CAGAGGCTGGGAAGGGCGGTGGG + Intergenic
1108664397 13:52615518-52615540 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1108699637 13:52932974-52932996 CAGAGGGTGGGGAGGGGCCTGGG - Intergenic
1108956300 13:56162494-56162516 CAGAGGCTGAGGAGGTTGGGTGG + Intergenic
1109162406 13:58991978-58992000 CACAGGGTGAGACGGGAGGTTGG - Intergenic
1110368740 13:74717684-74717706 TAGAGGCTGAGGATGGTGGTAGG + Intergenic
1110378124 13:74817065-74817087 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1110472102 13:75871871-75871893 CAGAGGCTGGGAAGGGCTGTGGG - Intronic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111864663 13:93753733-93753755 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1113039176 13:106085675-106085697 CAGAGGGTGGGAAGGGTAGTGGG + Intergenic
1113261049 13:108563487-108563509 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1113853155 13:113429325-113429347 CAGGGCCTGGGGAGGGCGGTGGG - Intronic
1113909772 13:113836457-113836479 CGGAGGGGGAGGAGGACGGAGGG + Intronic
1114057246 14:18982153-18982175 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1114062682 14:19034213-19034235 CAGAGGCTGAGCAGGTCGGGTGG - Intergenic
1114099578 14:19365784-19365806 CAGAGGCTGAGCAGGTCGGGTGG + Intergenic
1114105300 14:19419593-19419615 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1114535115 14:23417705-23417727 CAGAGGGTGGGGAGGATGGAGGG + Intronic
1114539308 14:23443056-23443078 CAGAGGCTGAGGTGGGCTGACGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117721766 14:58635675-58635697 CATTTGGTGAGGAGGGGGGTTGG + Intronic
1118078016 14:62323631-62323653 CAGAGGTTGGGAAGGGTGGTGGG - Intergenic
1118362609 14:65069109-65069131 CAGAGAGTGAGGAGAGGGGCTGG - Intronic
1118747420 14:68784437-68784459 CAGAGGGGGAGGAGGTGGGGAGG - Intergenic
1118916341 14:70110338-70110360 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1119038535 14:71251415-71251437 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119680804 14:76591034-76591056 CAGAGGCAGAGGAGGGGGTTGGG + Intergenic
1120238337 14:81918652-81918674 CAGAGGCTGGGAAGGGTGGTTGG + Intergenic
1120700196 14:87690972-87690994 AAGATGGGGAGGAGGGAGGTTGG - Intergenic
1121026048 14:90616803-90616825 CGAAGGGTGAGGCGGGCAGTGGG - Intronic
1121345303 14:93131320-93131342 CAGAAGCTGAGGTGGGAGGTGGG - Intergenic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121787150 14:96670657-96670679 CTGGGTGTGAGGGGGGCGGTGGG - Intergenic
1122079599 14:99257585-99257607 CGGAGCGTGAGGAGGGTGGCGGG + Exonic
1122133831 14:99621201-99621223 GAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1122431891 14:101656303-101656325 GGGAGGCTGAGGAGGGCGGATGG + Intergenic
1122497185 14:102166108-102166130 CTGGGGGTGAGAAGGGGGGTGGG - Intronic
1122747994 14:103911004-103911026 CCGGGGGTGAGGTGGGGGGTGGG + Intergenic
1122827349 14:104376739-104376761 CTAGGGGTGAGAAGGGCGGTGGG - Intergenic
1122874333 14:104656602-104656624 CTGAGGACGTGGAGGGCGGTGGG + Intergenic
1122965407 14:105121838-105121860 CAGGGAGTCTGGAGGGCGGTTGG + Intergenic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123494109 15:20807262-20807284 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1123498187 15:20851931-20851953 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123501529 15:20887876-20887898 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123555418 15:21425559-21425581 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123558782 15:21461575-21461597 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123591661 15:21862890-21862912 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1123595011 15:21898856-21898878 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123627880 15:22239855-22239877 GAGAGGGTGAGGAAGGGGGAGGG - Intergenic
1123683028 15:22776023-22776045 CATGGGGTGGGGAGGGAGGTGGG + Intronic
1123763059 15:23447146-23447168 CATGGGGTGGGGAGGGAGGTGGG + Exonic
1123889580 15:24763387-24763409 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1124334779 15:28848547-28848569 CATGGGGTGGGGAGGGTGGTGGG + Intergenic
1124946312 15:34270335-34270357 AGGAGGCTGAGGAGGGAGGTAGG - Intronic
1125733181 15:41905772-41905794 GAGAGGGTGAGGTGGGAGGATGG - Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1128186377 15:65646478-65646500 CAGGGGCTGGGGAGGGGGGTGGG - Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128848325 15:70922517-70922539 CAGAGGCTGAGAAGGGTAGTGGG + Intronic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129036709 15:72654751-72654773 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129078983 15:73023115-73023137 CAGAGGGTAAGAAGGCAGGTGGG - Intergenic
1129189550 15:73929362-73929384 CAGAGGCTGAGGAGGAGGCTGGG - Intronic
1129213178 15:74082474-74082496 CATGGGGTGGGGAGGGAGGTAGG + Exonic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129397221 15:75258612-75258634 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129400833 15:75282889-75282911 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129658806 15:77541819-77541841 CAGATGCTGAGGAGGGCGGCAGG - Intergenic
1129672989 15:77617315-77617337 AATAGGGTGAGTAGGGGGGTTGG + Intronic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129959004 15:79666266-79666288 ATGAGGGTGAGGTGGGAGGTTGG + Intergenic
1130231303 15:82099376-82099398 AAGAGGGTGAGGAGGGAGAGAGG - Intergenic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1130299901 15:82672452-82672474 CAGAGGCTGAGAAGGGTAGTGGG + Intronic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131315889 15:91337096-91337118 GAGAGGGTGAGGAAGGAGGCTGG + Intergenic
1131867928 15:96731573-96731595 CAGATGGTGATGAGTGCTGTGGG - Intergenic
1131947492 15:97642301-97642323 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1132055302 15:98647658-98647680 CAGAGGGCGCGGCGGGCGCTGGG - Intergenic
1202963762 15_KI270727v1_random:152769-152791 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1202967130 15_KI270727v1_random:188734-188756 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1132594745 16:743598-743620 GTGAGAGTGAGGAGGGCTGTTGG + Intronic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132981355 16:2740060-2740082 CAGGGGGTGAGGGGGCCAGTGGG - Intergenic
1133002000 16:2856488-2856510 CAGAGAGTGAGGATGGAGGGAGG - Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133299320 16:4772603-4772625 CAGAGGCTGAGGCGGGCAGATGG + Intergenic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133755753 16:8761300-8761322 GAGGGGGTGAGAAGGGAGGTGGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1133833554 16:9346556-9346578 CAGAGGATGAGAAGGGTCGTGGG - Intergenic
1134028206 16:10970849-10970871 GAGAGGCTGAGGTGGGAGGTTGG - Intronic
1135183475 16:20294843-20294865 CAGATGGAGAGGAGGGTGTTTGG + Intergenic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135473215 16:22750950-22750972 AAGAGTGTGAGTAGGGTGGTGGG + Intergenic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1136174166 16:28506146-28506168 CAGAGGGTAAGGAGGGGGTCTGG - Intronic
1136551058 16:30982831-30982853 GAGAGGGTGAGGGGGACGGGAGG + Intronic
1137289300 16:47040987-47041009 AAGAGGCTGAGGTGGGAGGTTGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137617493 16:49856214-49856236 AGGAGGGTGAGGGTGGCGGTAGG - Intronic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138328094 16:56191833-56191855 CAGAGGGTGGGGTGGGGGGCAGG - Intronic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1139162975 16:64534015-64534037 CAGAGGGTGGGTAGGTCGGTGGG + Intergenic
1139613645 16:68076038-68076060 GAGAGGGGGAGCAGGGTGGTGGG + Intronic
1140083931 16:71777306-71777328 CAGAGGGTGGGGGGAGCGGGAGG + Intronic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1140855172 16:78971715-78971737 CAGAGGGTGGGGATCGGGGTGGG - Intronic
1141606861 16:85158812-85158834 CAGAGGGTAAGGAGGTGGGCAGG - Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141882337 16:86868269-86868291 GTGAGGGTGAGGTGGGCGGAGGG + Intergenic
1141924310 16:87157331-87157353 CAGAGGCTGGGGAGGGGAGTGGG + Intronic
1141927537 16:87179065-87179087 CAGAGGGTTCCGAGGGCGGAAGG + Intronic
1142059494 16:88020318-88020340 CAGAGGGTGGAGGGGGTGGTGGG - Intronic
1142158891 16:88547092-88547114 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158900 16:88547116-88547138 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158909 16:88547140-88547162 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158918 16:88547164-88547186 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158927 16:88547188-88547210 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158936 16:88547212-88547234 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158945 16:88547236-88547258 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158954 16:88547260-88547282 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158963 16:88547284-88547306 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158988 16:88547352-88547374 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158997 16:88547376-88547398 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159063 16:88547568-88547590 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159080 16:88547616-88547638 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159089 16:88547640-88547662 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159098 16:88547664-88547686 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159107 16:88547688-88547710 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159116 16:88547712-88547734 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159125 16:88547736-88547758 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159134 16:88547760-88547782 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159142 16:88547784-88547806 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1142159150 16:88547808-88547830 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1142237947 16:88931509-88931531 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237961 16:88931550-88931572 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237975 16:88931591-88931613 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237989 16:88931632-88931654 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142269543 16:89082021-89082043 CAGAGGCTGGGAAGGGCGGTGGG + Intergenic
1142373983 16:89697500-89697522 CAGAGGGTGGGCAGGGCGCCAGG + Exonic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142671068 17:1487570-1487592 CAGAGGCGGGGGAGGGCGGGAGG + Intronic
1142728796 17:1836534-1836556 CCTAGGGTGAGGATGGAGGTGGG - Intronic
1142858897 17:2749394-2749416 CCGAAGGTGAGGAGGCCGGTCGG - Intergenic
1142967590 17:3590947-3590969 ACAAGGGTGAGGAGGGCGGCGGG - Exonic
1144568733 17:16381354-16381376 CTGAGGGGGGCGAGGGCGGTTGG + Intronic
1144998084 17:19284534-19284556 GACAGGGTGAGGATGGAGGTGGG + Intronic
1145116919 17:20218803-20218825 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1145117841 17:20227954-20227976 CAGTGGGTGACGAGGGGGGGTGG + Intronic
1145901765 17:28494523-28494545 CACAGGCTGAGGAGGGGGCTGGG - Intronic
1146178063 17:30679474-30679496 CAGAGGGGGAGGATGGGGGGAGG + Intergenic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146732914 17:35210909-35210931 CAGAGCGTAAGGATAGCGGTGGG + Intergenic
1147160141 17:38564741-38564763 CAGAGGGTGGGGGTGGGGGTGGG + Intronic
1147419326 17:40314362-40314384 GAGAGGGTGAGAGGGGCTGTGGG + Intronic
1147585920 17:41654049-41654071 CAGAGTGTGAGGAGGGGGTGAGG + Intergenic
1147898614 17:43769109-43769131 CACAGGGTGTGGAAGGCTGTGGG + Exonic
1147953660 17:44120834-44120856 CAGAGGCTGAGGAAAGTGGTAGG - Intronic
1148070703 17:44907031-44907053 GAGAAGGGGAGGAGGGCGGGGGG - Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148152621 17:45405404-45405426 CAGAGGGTGAGGGGTGGGGCAGG - Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148346693 17:46908186-46908208 CACAGAGTGAGGGGGGCGGTGGG - Intergenic
1148505158 17:48121428-48121450 CAGTCTGTGAGGAGGGCTGTGGG + Exonic
1148713319 17:49697744-49697766 AAGAGGCTGAGGTGGGAGGTTGG + Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148857412 17:50586339-50586361 CAGAGGGTGAGAGGGGCTGGTGG - Intronic
1148861742 17:50608138-50608160 AAGGAGGTGAGGAGGGGGGTGGG - Intronic
1149130425 17:53294595-53294617 CAGAGGCTGAGAAGGGTTGTGGG - Intergenic
1149184235 17:53978494-53978516 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149451347 17:56752256-56752278 CAGAGGGCGAGAAGAGAGGTTGG - Intergenic
1149515819 17:57280152-57280174 CAGAGAGTGAGGAGGACAGGGGG + Intronic
1150221834 17:63500030-63500052 TAGAGGGTGGGGAGGGCTGTGGG - Intronic
1150871436 17:68916113-68916135 CAGAGGCTGAGAAGGGTAGTGGG + Intronic
1150933547 17:69611211-69611233 TAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151251788 17:72841540-72841562 CAGAGGCTGGGAAGGGCAGTCGG + Intronic
1151307782 17:73274529-73274551 CAGAGGATGAGGAGTCCGGGAGG - Intergenic
1151362036 17:73594981-73595003 CAGAGGGTGACAAGGGCTGGGGG - Intronic
1151385614 17:73753537-73753559 CAGAGGGGGAGGAAGGCTGGGGG + Intergenic
1151767355 17:76139294-76139316 CAGAGGTTGAGGTGGGGGGCTGG + Intronic
1151969395 17:77450111-77450133 GTGAGGGTGGGGAGGGCCGTGGG + Intronic
1152192483 17:78897107-78897129 GAGGGGGTGAGGAGGCCGGCGGG - Intronic
1152276735 17:79362440-79362462 CAGGGGGTGGGGGTGGCGGTGGG + Intronic
1152518873 17:80843739-80843761 CAGATGGTGAGAAAGGCGGCAGG + Intronic
1152957828 18:54532-54554 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153523974 18:5977817-5977839 CAGAGGGTGATGAGGCCTGAGGG - Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153993898 18:10423191-10423213 CAGAGTCTGTGGAGGGCGGCTGG - Intergenic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1154451639 18:14481720-14481742 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1154456189 18:14528356-14528378 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1155282864 18:24258464-24258486 CAGAGGTTGAGAAGGGTAGTGGG + Intronic
1155767929 18:29659126-29659148 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1156126452 18:33911135-33911157 CAGAGGGTGGGGTGGGGGGGAGG - Intronic
1156156365 18:34307424-34307446 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156502248 18:37567048-37567070 CGGAGGGGGAGGAAGGCGCTGGG + Intergenic
1157300318 18:46474372-46474394 CAGGGGGTGGGGAGGCCTGTGGG + Intergenic
1157516943 18:48317969-48317991 CAGGGGGTGAGGAAGGAGGCAGG - Intronic
1157786858 18:50491435-50491457 ATGAGGGTTAGGAGGGTGGTTGG + Intergenic
1159281074 18:66286835-66286857 GAGAGGCTGAGAAGGGAGGTTGG - Intergenic
1159556225 18:69947891-69947913 CAGAGGCTGAAGTGGGCGGAGGG + Intronic
1159602986 18:70446289-70446311 AAGAGGGTGAGAAGGGCTGAGGG - Intergenic
1160271112 18:77384438-77384460 CAGAGGCTGAGGTGGGAGGGTGG - Intergenic
1160703498 19:518722-518744 TAGAGGGTGAGGAGGAGGGGAGG + Intronic
1160717608 19:583478-583500 GAGAGGGTGAGGGTGGAGGTGGG - Exonic
1160809773 19:1008310-1008332 CAGAGGGTGGGGGTGGGGGTGGG + Intronic
1161458277 19:4381022-4381044 GAGAGGGAGAGGAGGCCGGTGGG - Intronic
1161629343 19:5344463-5344485 CAGAGGGCGGGGAAGGGGGTAGG - Intergenic
1161650460 19:5481041-5481063 CAGGGGCTGGGGAGGGGGGTGGG - Intergenic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1161959047 19:7513129-7513151 AAGAGGTTGAGGTGGGAGGTTGG + Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162533690 19:11250890-11250912 TAGAGGGTGAGCAGGGCCGGGGG + Exonic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163107304 19:15132364-15132386 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163556039 19:17993359-17993381 CAGAGGATGAGGTGGGAGTTGGG - Intronic
1163719948 19:18894229-18894251 CAGGGGTTGGGGAGTGCGGTGGG + Intronic
1164547394 19:29179980-29180002 CAGAAGGTGGGAAGGGTGGTGGG + Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164654356 19:29910051-29910073 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654381 19:29910131-29910153 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654427 19:29910271-29910293 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165885705 19:39076710-39076732 CAGGGGGTGAGGAGGGGGACAGG + Intergenic
1165941397 19:39416409-39416431 CAGAGGGTGAGTGGAGGGGTGGG + Exonic
1165996646 19:39848564-39848586 CAGAGGGGTAGGAGGGCAATGGG + Intergenic
1166050432 19:40255881-40255903 TAGAGGGTGAGGCTGGAGGTTGG + Intronic
1166721939 19:45001847-45001869 CAGAGGGTGATGAGGGGGTACGG + Intronic
1166955793 19:46464068-46464090 CAGAGGGTGAGGTGGCAGCTGGG - Intergenic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167449136 19:49556802-49556824 CTGTGCGTGAGGAGGACGGTGGG + Intronic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168307418 19:55442981-55443003 GAGAGGCTGGGGAGGGCGGGCGG + Intergenic
1168383093 19:55940812-55940834 CAGAGGCTGGGGAGGGTTGTGGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925146295 2:1585378-1585400 CAGAGGGTGAGGAGGCCAAGAGG - Intergenic
925228628 2:2209397-2209419 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926227613 2:10979345-10979367 AAGAGGGTGAAGATGGAGGTGGG + Intergenic
926385503 2:12332080-12332102 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
926675841 2:15619168-15619190 CAGAGGGGGAGCAGTGAGGTTGG - Intronic
926724310 2:15985145-15985167 GAGAGGGTGAGGAGCGGGATAGG - Intergenic
927868647 2:26609285-26609307 TAGAGGCTGAGGAGGGCAGGGGG + Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
929174707 2:38964706-38964728 CAGAAGGTGAGCAGTGGGGTGGG - Intronic
929230641 2:39556496-39556518 AAGAGGGTGAGGTGGGAGGATGG - Intergenic
931045323 2:58345157-58345179 GAGAGGCTGAGGTGGGAGGTTGG + Intergenic
931228169 2:60351792-60351814 AAGCAGGTGAGGAGGGCAGTCGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
932257834 2:70302177-70302199 CCAAGCGGGAGGAGGGCGGTGGG - Intergenic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
932930308 2:76028760-76028782 CAGAGGCTGGGGATGGTGGTGGG - Intergenic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
934604862 2:95687007-95687029 TAGAGGATGAGGAGGGGAGTGGG - Intergenic
934762794 2:96865610-96865632 AGAAGGGTGAGGAGGGCGGGGGG + Intronic
934846848 2:97666736-97666758 CAGAGGCTGAGGTGGGAGGTTGG + Intergenic
934992291 2:98930317-98930339 CAGAGGGTGGGGATGGGGATGGG - Intronic
934992306 2:98930355-98930377 CAGAGGGTGGGGACGGGGATGGG - Intronic
934992321 2:98930393-98930415 CAGAGGGTGGGGACGGGGATGGG - Intronic
934992336 2:98930431-98930453 CAGAGGGTGGGGACGGGGATGGG - Intronic
934992351 2:98930469-98930491 CAGAGGGTGGGGACGGGGATGGG - Intronic
935032511 2:99336397-99336419 CAGAGGAAGGGGCGGGCGGTCGG + Exonic
935272268 2:101445179-101445201 CAGTGGGTGAGCAGGAGGGTGGG - Intronic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
936528620 2:113259389-113259411 CAGGGGCTGGGGAGGTCGGTGGG - Intronic
937065118 2:119011792-119011814 GAGAGGGCGAGGAGGGAGTTTGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937628209 2:124068054-124068076 AAGAGGGTGGGGAGGGTGGGAGG - Intronic
938109270 2:128553203-128553225 CAGAATCTGAGGAGGGCAGTGGG - Intergenic
938181640 2:129189902-129189924 CAGAGGGTGCAGGGGGTGGTGGG + Intergenic
938283902 2:130091313-130091335 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938285053 2:130105878-130105900 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938334547 2:130479877-130479899 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938335696 2:130494427-130494449 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938354125 2:130626237-130626259 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938355279 2:130640793-130640815 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938430552 2:131233014-131233036 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938431705 2:131247580-131247602 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938469092 2:131543640-131543662 CAGAGCGGTAGGAGGGCGGCGGG + Intergenic
938475377 2:131606184-131606206 CTGAGGCTGAGGAGGGGGATTGG + Intergenic
938692311 2:133802842-133802864 CAGAGGGAGAAGAGCGCGATCGG + Intergenic
938902763 2:135811972-135811994 AAGAGGCTGAGGTGGGAGGTTGG + Intronic
938939741 2:136159414-136159436 CAGAGGCTGAGAAGGGCAGTAGG + Intergenic
939501263 2:142987949-142987971 CAGAGGGTGAAGGGGGAGGCAGG - Intronic
940396412 2:153196703-153196725 CAGTGGGGGAGCAGTGCGGTTGG - Intergenic
940399990 2:153237474-153237496 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
940520393 2:154738266-154738288 CAGAGGCTGGGAAGGGAGGTGGG + Intronic
942116579 2:172735222-172735244 CAGGGAGGGAGGAGGCCGGTGGG - Intergenic
942352705 2:175069561-175069583 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
943622815 2:190168417-190168439 AACAGAGTGGGGAGGGCGGTGGG - Intronic
943756377 2:191561233-191561255 CGGAGGGTGAGGTGGGAGGATGG + Intergenic
944289809 2:197992501-197992523 GGGAGGCTGAGGAGGGGGGTTGG - Intronic
944546600 2:200805115-200805137 CAGATGGGGAAGAGGGAGGTAGG - Intergenic
944547449 2:200812047-200812069 CAGAGGGAGAGGGAGGCGGCGGG + Intronic
945198219 2:207257051-207257073 CCGAGGGTGGGAAGGGCGGGAGG + Intergenic
945838842 2:214864807-214864829 CAGAGGCTGAGAAGGGTAGTTGG + Intergenic
946154676 2:217799646-217799668 CAGATGGTGGGGAGGCCGCTGGG + Intergenic
946453945 2:219806104-219806126 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
947220670 2:227788819-227788841 TTGAGGGTGAGGAGGGAGTTGGG + Intergenic
947549772 2:231037812-231037834 CAGAGGGCGGCGAGGGCGGCTGG + Exonic
947810614 2:233001574-233001596 CAGAGGGTGATGAGGTCGTGCGG + Intronic
948047329 2:234953890-234953912 CAGAGGTGGAGGAGGGGGATTGG - Intronic
948379363 2:237542041-237542063 GAGAGTGTGAGGAGGGTGGACGG + Intronic
948428060 2:237901159-237901181 CAGAAGGTGAGCAGGGGTGTGGG - Intronic
948476941 2:238226492-238226514 CCGAGAGTGGGGAGGGCGGTGGG + Intronic
948530420 2:238600299-238600321 CAGATGCTGGGGAGGGCGCTGGG + Intergenic
948541753 2:238696262-238696284 CAGAGGCTGTGGGGGGCTGTGGG - Intergenic
948712511 2:239833769-239833791 AAGAGGGGGAGGAGGTGGGTTGG + Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1168968016 20:1911764-1911786 CTCAGGGAGAGGAGGGCGGCTGG - Intronic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1169740259 20:8885757-8885779 CAGAGGCTGGGGAGGGTAGTTGG - Intronic
1169902981 20:10571589-10571611 CAGAGGGTGAGCAGGGAGAGAGG - Intronic
1170086745 20:12542538-12542560 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1170438346 20:16352732-16352754 GAGCGGGTGAGGAGGGCGAGGGG + Intronic
1170513334 20:17102072-17102094 GGGAGGGTGAGGCGGGCAGTTGG + Intergenic
1171074163 20:22105058-22105080 CAGAAGGTGAGGTGGAGGGTGGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171481390 20:25458238-25458260 CAGATGGTAAGGAAGGCTGTAGG - Intronic
1171938433 20:31299677-31299699 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1171973355 20:31578565-31578587 CAAGGGCTGAGGAGTGCGGTCGG - Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173152508 20:40579649-40579671 GAGAGGGTGAGGCTGGAGGTGGG - Intergenic
1173324171 20:42017494-42017516 CAGAGGGAGAGGAGGCTGGTGGG - Intergenic
1173578957 20:44132799-44132821 CAGATGTAGAGGGGGGCGGTGGG - Intronic
1173994477 20:47327242-47327264 GGGAGGCTGAGGTGGGCGGTCGG - Intronic
1174232288 20:49055610-49055632 AAGAGGCTGAGGTGGGAGGTTGG + Intronic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174682532 20:52422649-52422671 CAGAGGCTGGGAAGGGAGGTAGG - Intergenic
1174882056 20:54290791-54290813 CACAGGGTGAGGTAGGAGGTTGG + Intergenic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1174939476 20:54909081-54909103 CAGAGGCTGAGAAGGGGAGTTGG + Intergenic
1175402976 20:58711103-58711125 GAGAGGGGGAGGAGGGGGGGAGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176444506 21:6808503-6808525 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1176817975 21:13624980-13625002 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1176822671 21:13673541-13673563 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1176939307 21:14904523-14904545 CAGAGGCTGGGAAGGGTGGTAGG - Intergenic
1177231246 21:18322712-18322734 CAGAGGCTGAGAAGGGTAGTGGG + Intronic
1177740137 21:25144442-25144464 CAGAGGCTGAGAAGGACAGTTGG - Intergenic
1177842029 21:26245432-26245454 CACAGGATGAGATGGGCGGTTGG + Intergenic
1177971326 21:27793475-27793497 CAGAGGGTGGGAATGGGGGTAGG + Intergenic
1178091292 21:29166161-29166183 CAGAGGTTGGGGAGGGTGGTAGG - Intronic
1178177737 21:30123743-30123765 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1178260099 21:31091538-31091560 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1178688281 21:34728734-34728756 CAGAGGGTGGGGAGAGAGGGTGG + Intergenic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179374561 21:40838358-40838380 CAGGGGCTGAGGGGGGCTGTTGG - Intronic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180041240 21:45281395-45281417 CAGAGGTTGTGGAGGGAGCTAGG - Intronic
1180041806 21:45283927-45283949 GAGGGGGTGAGGAGCGCTGTGGG - Intronic
1180070281 21:45432410-45432432 CAGAGGGAGAGGAGGCCGCTAGG - Intronic
1180098685 21:45574309-45574331 CGGAGGGGGAGGAGGGTGGCCGG - Intergenic
1180169178 21:46049076-46049098 TAGAGGGCATGGAGGGCGGTGGG - Intergenic
1180387490 22:12192115-12192137 CAGAGGGTGAGGTAGGAGGATGG - Intergenic
1180475736 22:15704765-15704787 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1180481175 22:15756840-15756862 CAGAGGCTGAGCAGGTCGGGTGG - Intergenic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181126386 22:20704223-20704245 CATCAGGTGAGCAGGGCGGTGGG + Intergenic
1181387828 22:22558166-22558188 CACAGGGTGGGGTGGGGGGTCGG + Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1182009781 22:26990744-26990766 CAGAAGGGGTGGAGAGCGGTTGG - Intergenic
1182198343 22:28542353-28542375 CAGAAGGTGAGGAAGGAGGGAGG + Intronic
1182540826 22:31040583-31040605 CAGAGGCTGAGCAGGCCTGTGGG - Intergenic
1182617257 22:31595737-31595759 GAGAGGGTGAGGATGGTGGCTGG + Intronic
1182685504 22:32119839-32119861 CAGAGAGGTAGGAGGGCGGCTGG - Intergenic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182910736 22:33982072-33982094 AACAGGAAGAGGAGGGCGGTGGG + Intergenic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184289085 22:43488828-43488850 CAGCGCCTGAGGAGGGCGGACGG - Intronic
1184379497 22:44136228-44136250 CAGAGGGTGGGGAGGAGGATAGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184857470 22:47154227-47154249 CAGAGTGTGAGGAGGTGGGCTGG - Intronic
1184915315 22:47564864-47564886 CAGAGGATGAGCAGAACGGTGGG - Intergenic
1184920226 22:47600681-47600703 CAGAGGCTGAGGGGGGTGGGGGG - Intergenic
1184920309 22:47600997-47601019 CAGAGGCTGAGGGGGGCGGTGGG - Intergenic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950340923 3:12243674-12243696 CTGGGGGTTAGGAGGGCTGTAGG + Intergenic
950914097 3:16626091-16626113 CAGAGGCTGAGAAGGGGAGTAGG + Intronic
951637417 3:24794902-24794924 CAGAGGGAGAGAAGGGCCGAGGG - Intergenic
951945459 3:28130984-28131006 CAGTGAGTGAGGAGAGTGGTAGG - Intergenic
952538371 3:34338295-34338317 CAGAGGCTGAGGAGGTAGGGTGG + Intergenic
952944194 3:38466199-38466221 CAGAGGCTAAGGAGGTAGGTAGG + Intronic
952966342 3:38623420-38623442 CAGAGGTGGAGGAGGGCGATTGG - Intronic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
954143344 3:48621610-48621632 CAAAGAGTGTGGAGGGCTGTAGG - Exonic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
955002191 3:54937835-54937857 CAGAGGGTGAGGAAGGAGCTTGG + Intronic
955028530 3:55193572-55193594 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955658679 3:61273020-61273042 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956573564 3:70725389-70725411 CAGAGGTTGAGAAGGGTAGTGGG + Intergenic
956829934 3:73036234-73036256 CAGAGGCTGAGAAGGGTGGGGGG + Intronic
958602505 3:96315408-96315430 CAGAGGCTGAGAAGGGCAGTGGG - Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959060752 3:101614166-101614188 AGGAGGCTGAGGAGGGCGGATGG - Intergenic
959633317 3:108533617-108533639 CAGACTGTGAGGAGGGAGTTGGG + Intergenic
959717978 3:109454416-109454438 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
959940878 3:112079649-112079671 TAGAGGGTGAGTAGGACAGTGGG + Intronic
960784600 3:121358261-121358283 CAGAGGGTGAGAAGGGTAGTGGG - Intronic
961171738 3:124802100-124802122 TAGAGGGTGATGAGTGCTGTGGG - Intronic
962067982 3:132003392-132003414 CAGAGGGTGAGTAGACTGGTGGG - Intronic
962108505 3:132417663-132417685 GTGAGGGTGAGGAGGCCGGAGGG + Exonic
962468602 3:135684880-135684902 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
963916677 3:150865112-150865134 GAGAAGGTGAGGAGAGCAGTCGG + Intergenic
964016449 3:151953096-151953118 CTGAGGGAGAGAAGGGCTGTGGG + Intergenic
964759609 3:160122305-160122327 CAGAGGCTGGTGAGGGTGGTAGG + Intergenic
966362823 3:179148510-179148532 CCGAGGGAGAGGAGAGCGGGCGG - Exonic
966490467 3:180522482-180522504 CAGAGAATGGGGAGGGCGGGAGG + Intergenic
966905459 3:184521165-184521187 CAGAGGCTGAGGTGGGAGGGTGG - Intronic
966944132 3:184765774-184765796 CAGCGAGGGAGGAGGGAGGTAGG + Intergenic
967502312 3:190212969-190212991 CAGAGGTTGAGAAGGGTAGTGGG + Intergenic
968066368 3:195761787-195761809 CAGCGGTGGAGGAGGGCGGGAGG + Intronic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968266993 3:197370040-197370062 CAGAGGCTGAGGTGGGTGGGAGG - Intergenic
968315411 3:197720175-197720197 CAGAGGATGAGGAGGGTAGGAGG - Intronic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
968662853 4:1805935-1805957 CAGAAGGTGGGCAGGGCGGCAGG + Exonic
968947761 4:3674652-3674674 CACAGGGTCAGGACGGGGGTCGG - Intergenic
969029831 4:4203024-4203046 CAGAGGGTGTGGATGATGGTTGG - Intronic
969226956 4:5804957-5804979 CAGCGGGTGAGGAAGGCCGATGG - Intronic
969281660 4:6174852-6174874 CAGAGGGTGAGGAAGGGGCCAGG - Intronic
969464112 4:7344559-7344581 CAGAAGGGGAGTAGGGCAGTGGG + Intronic
969870843 4:10103786-10103808 GAGAGTGGGAGGAGGGAGGTGGG - Intronic
969939848 4:10721149-10721171 CAGGGACTGAGGAGGGAGGTGGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970824290 4:20253615-20253637 AGGAGGGTGGAGAGGGCGGTGGG + Exonic
972269210 4:37493728-37493750 CAGAGGCTGAGAAGGGTAGTGGG - Intronic
973853330 4:54984339-54984361 CAGAGGCTGAGAAGGGCAGTGGG + Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974620806 4:64351124-64351146 CAGAGGTTGAGAAGGGTGATTGG + Intronic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975336072 4:73176556-73176578 CAGAGGCTGGGGAGGGTAGTTGG + Intronic
975630276 4:76394472-76394494 CAGAGGGTGGGAAGGGTAGTGGG + Intronic
975669471 4:76766427-76766449 CAGAGGATGAGGTGGGAGGCAGG + Intronic
975733357 4:77358642-77358664 CAGATGGTGGGGGGGGGGGTGGG + Intronic
976597135 4:86904994-86905016 GAGAGGCTGAGGTGGGCGGATGG + Intronic
977429761 4:96916596-96916618 CAGACGGGGTGGAGGGCGGATGG + Intergenic
977800884 4:101229759-101229781 GAGAGGGTGAAAAGGGCAGTAGG + Intronic
978005415 4:103609760-103609782 CAGAGGCTGAGGAGAGTGGCAGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978277036 4:106964343-106964365 CAGAGGCTGAGAAAGGCAGTGGG + Intronic
978320965 4:107495327-107495349 CAGAGGCTGGGGAGTGGGGTAGG - Intergenic
978519219 4:109598590-109598612 CAGAGGGAGAGGGAGACGGTGGG + Intronic
978542796 4:109836913-109836935 CAGAGGGTGGTGCGGGGGGTGGG + Intronic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979745362 4:124206043-124206065 CAGAGGGTCAGGAGGTGGGGAGG + Intergenic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
980482832 4:133410946-133410968 AAGATGGTGAGGAGGGAGGTTGG - Intergenic
981039228 4:140207458-140207480 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
981203242 4:142008631-142008653 CAGAGGCTGAAAAGGGCAGTGGG - Intergenic
981334206 4:143550589-143550611 CAGAGGCTGAGAAAGGCAGTGGG - Intronic
981342961 4:143643647-143643669 CAGAGACTGGGGAGGGCAGTTGG + Intronic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
982439403 4:155417542-155417564 CAGAGGGTGTGAAGGGTGGGTGG - Intergenic
982689243 4:158529497-158529519 GAGAGGCTGAGGTGGGCGGATGG - Intronic
982745451 4:159101511-159101533 CAGAGGATGGGGAAGGCTGTGGG + Intergenic
984453111 4:179929054-179929076 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
984634743 4:182098659-182098681 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
984853531 4:184173896-184173918 CAGTGAGTGAGGAGGTGGGTGGG + Intronic
984950755 4:185005870-185005892 CAGAGGCTGGGAAGGGCAGTAGG - Intergenic
984974191 4:185215899-185215921 GGGAGGGTGAGGTGGGAGGTGGG - Intronic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985523792 5:391622-391644 CACAGGGCGAGGAGGGCGCAGGG + Intronic
985523849 5:391818-391840 CACAGGGCGAGGAGGGCGCAGGG + Intronic
985552597 5:541188-541210 GAGATGGCAAGGAGGGCGGTGGG - Intergenic
985648886 5:1098346-1098368 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648894 5:1098373-1098395 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648902 5:1098400-1098422 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648920 5:1098455-1098477 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648928 5:1098482-1098504 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648955 5:1098564-1098586 CAGAGGGTTAGAAGGGGGCTTGG - Intronic
985648971 5:1098618-1098640 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648979 5:1098645-1098667 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985776453 5:1846556-1846578 CCAGGGGTGGGGAGGGCGGTGGG + Intergenic
985828684 5:2212625-2212647 CAGAGGACCAGAAGGGCGGTTGG - Intergenic
985841969 5:2313313-2313335 CAGAGGCTCAGGAGGAGGGTGGG - Intergenic
986393630 5:7306557-7306579 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
986831818 5:11588876-11588898 CAGGGAGGGAGGAGGGAGGTGGG - Intronic
987057399 5:14207188-14207210 GAGAGGCTGAGGTGGGAGGTTGG + Intronic
987189058 5:15454753-15454775 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
989630028 5:43472785-43472807 CAGAGGCTGTGAAGGGTGGTGGG + Intronic
990311563 5:54544027-54544049 TAGGGGGTGGGGGGGGCGGTGGG + Intronic
991380359 5:66016559-66016581 CAGAGGCTGAGGAGGGTAGTGGG - Intronic
991938044 5:71822062-71822084 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
992248584 5:74854605-74854627 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
993683075 5:90903914-90903936 CAGAGGCTGAGAAGGGTAGTTGG - Intronic
993768169 5:91889208-91889230 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
994246662 5:97486538-97486560 CAGAGGCTGAGAAGGGTAGTAGG - Intergenic
994596733 5:101847603-101847625 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
994854277 5:105097300-105097322 CAGAAGCTGAGAAGGGCAGTAGG + Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996931138 5:128889693-128889715 CAGAGGCTGAGAAGGGTAGTGGG - Intronic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997207248 5:132057067-132057089 CAGAGGGCGAGGAGGTTGGGAGG - Intergenic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
997980919 5:138466947-138466969 CTGAGGACGAGGAGGCCGGTGGG - Exonic
998168207 5:139856424-139856446 CAGAGGGTAAAGAGGACAGTCGG - Intronic
998265051 5:140661731-140661753 CAGGGTGTGAGGAGGGGTGTGGG + Intronic
998528206 5:142861548-142861570 CTGACGGTGAGGAGGGCGAGAGG + Intronic
999232394 5:150069488-150069510 CAGAGGCTGATGAGGGAGGCAGG - Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000285174 5:159820444-159820466 TGGAGGGTGAGGAGGGCAGGGGG - Intergenic
1000685759 5:164247133-164247155 CAGAGGCTGAGAAGGGTAGTAGG - Intergenic
1001106508 5:168858960-168858982 CAGAGAGTGAGGCTTGCGGTGGG + Intronic
1001130793 5:169061866-169061888 CAGAGGGTAGGGAGTGGGGTGGG - Intronic
1001308726 5:170595184-170595206 CTGGGGGTGAGGAGTGGGGTGGG + Intronic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002322102 5:178382415-178382437 CAGAGGAGGAGGAGGGCGAAGGG - Intronic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002547357 5:179958471-179958493 CAGAGGCCGAGGAGAGCTGTTGG - Intronic
1002657880 5:180767130-180767152 CAGAGGGTGGGAAGGGTCGTGGG - Intergenic
1003226514 6:4210934-4210956 CAGTGGGTGAGGCGGGGGGCGGG - Intergenic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005889278 6:30123551-30123573 CAGAGGGTGGGGAGGAGGGATGG + Intergenic
1005989331 6:30893319-30893341 CAGCCGATGAGGATGGCGGTCGG - Exonic
1006059073 6:31405712-31405734 CAGAGGCTGAGAAGGGTAGTGGG - Intronic
1006071558 6:31500596-31500618 CAGAGGCTGAGAAGGGTAGTGGG - Intronic
1006109441 6:31735855-31735877 CTGAGGGTGAGTAGTGCAGTAGG - Intronic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006472312 6:34235929-34235951 AAGATGGCGGGGAGGGCGGTGGG - Intergenic
1006706512 6:36025572-36025594 CAAAGGGTGAGGAGGAAGCTTGG - Intergenic
1006719774 6:36142734-36142756 CAGAGGATGAAGCGGGGGGTGGG - Intronic
1007249876 6:40488349-40488371 AAGATGGTGGGGATGGCGGTGGG - Intronic
1007397384 6:41585537-41585559 CAGGGGGTGAGGGCGGTGGTGGG - Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007616110 6:43180606-43180628 CAAAGGGGGAGGAGGGGGGTGGG - Exonic
1007753522 6:44084117-44084139 CAGAGAGTGAGGATAGAGGTAGG + Intergenic
1007809904 6:44478338-44478360 CAGAGGGTGCAGTGGGGGGTTGG + Intergenic
1008148886 6:47925936-47925958 CAGAGGCTGAGGCTGGGGGTTGG + Intronic
1009211771 6:60870958-60870980 CACAGGGTGAGGATGGGGGCTGG + Intergenic
1009266807 6:61566223-61566245 CAGAGGCTGAGAAGTGCAGTGGG + Intergenic
1009441624 6:63687175-63687197 GGGAGGCTGAGGTGGGCGGTAGG + Intronic
1010224326 6:73475200-73475222 GAGAGGCTGAGGTGGGCGGATGG - Intronic
1010643943 6:78364632-78364654 TAGGGGGTGAGGTGGGCTGTAGG - Intergenic
1013217367 6:108040010-108040032 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
1013288414 6:108699591-108699613 CAGAGGGTGACGACAGCGGGAGG - Intergenic
1013832125 6:114285665-114285687 GTCAGGGTGGGGAGGGCGGTGGG + Intronic
1014864545 6:126511507-126511529 CAGAGGGTGAGGTGGAGGGGAGG + Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015678093 6:135772908-135772930 CAGAGGCTGAGAAGGGTGGTGGG - Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017915047 6:158825223-158825245 GAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1018126495 6:160687960-160687982 CAGAGGCTGAGAAGGGTAGTTGG + Intergenic
1018134945 6:160770117-160770139 TGGAGGGTGAGGAGGGTAGTCGG + Intergenic
1018281529 6:162191185-162191207 CAGAGGGTGAGAAGCACGTTGGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018916715 6:168136722-168136744 CAGAGTGTGGGGAGGGTTGTAGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019488165 7:1298945-1298967 CAGGGGGAGAGGGGGGCTGTGGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019643935 7:2119209-2119231 GAGAGGGAGAGGAGGGCACTGGG - Intronic
1019929048 7:4211362-4211384 CAGGGAGTGAGGAGGCCGGCCGG + Intronic
1020080223 7:5282805-5282827 AAGAGGGTGAGGAAGGGGGAGGG + Intronic
1020462986 7:8444290-8444312 CAGAAGGTGAAAAGAGCGGTCGG + Intronic
1021168243 7:17366860-17366882 GGGAGGCTGAGGCGGGCGGTTGG + Intergenic
1021835621 7:24670694-24670716 CAGGGGGTGAGGAAGTTGGTGGG - Intronic
1022222158 7:28324085-28324107 CACAGCGTGAGGTGAGCGGTGGG - Intronic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023998532 7:45176690-45176712 CAGAGGTTGGGAAGGGCAGTGGG + Intronic
1024027417 7:45424466-45424488 CACATGGTGAGGAGGGAGGGAGG + Intergenic
1024368575 7:48552967-48552989 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
1024481049 7:49863668-49863690 CGGAGGCTGAGGTGGGCGGATGG - Intronic
1025060382 7:55800675-55800697 CAGAGGCTGGGAAGGGTGGTAGG + Intronic
1026117717 7:67510218-67510240 CAGAGGCTGAGAAGGGTGGAAGG - Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027130266 7:75585637-75585659 CAGAGGCTGAGGCGGGGAGTCGG - Intronic
1027246858 7:76373486-76373508 GAGAGGGTGGGGAGGACGCTGGG + Intergenic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029001747 7:97161578-97161600 CAGAGGGTGAGGGGGGCTAGGGG - Intronic
1029123833 7:98284406-98284428 CAGAGGGCGAGCAGGGGGCTGGG + Intronic
1029349976 7:100006330-100006352 GAGAGGCTGAGGTGGGCGGGCGG - Intergenic
1029414735 7:100435831-100435853 CCGAGGGTGAGGGGGGCGGGCGG - Exonic
1029424146 7:100486184-100486206 CAGAGGGTTGGGGGGGCGGCTGG - Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029465024 7:100720212-100720234 TAGACGGTGAGGAGTGAGGTGGG + Intergenic
1029476132 7:100785952-100785974 AAGAGAGTGAGGAGGGGGCTGGG - Intronic
1032184231 7:129709967-129709989 GGGAGGCTGAGGAGGGCGGATGG - Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032792271 7:135251356-135251378 CAGAGGGTCAGGAAGGCTCTGGG - Intronic
1033286335 7:140043769-140043791 GGGAGGCTGAGGAGGGCGGATGG - Intronic
1033600656 7:142886120-142886142 CAGAGAGTGAGGCAGGTGGTCGG - Intergenic
1033855047 7:145550814-145550836 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034122017 7:148636806-148636828 AAGAGGGTGAGGAGGGTGAAGGG - Intergenic
1034344847 7:150379628-150379650 CCGAGGGTGGGGAGGGCGCCAGG + Intronic
1034353063 7:150429761-150429783 AAGAGGGAGAGGTGGGGGGTTGG - Intergenic
1034590110 7:152131495-152131517 CAGAGCGTGAGGATGGCGCGGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035911177 8:3567727-3567749 CAGAGGATGTGGAGGAAGGTTGG - Intronic
1036198987 8:6750314-6750336 CAGAGGATAAGCAGGGCAGTGGG - Intronic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1037432549 8:18828965-18828987 AAGAGGCTGAGGTGGGCGGACGG + Intronic
1037691720 8:21186433-21186455 CAGAGGGAGATGAGGGAGCTGGG - Intergenic
1037742910 8:21621735-21621757 CAGAGGGGGTGGATGGGGGTGGG - Intergenic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037825838 8:22160101-22160123 AAGGGGGTGAGGAGGGTGGTGGG + Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038977367 8:32715192-32715214 CAGAGGCTGAGGCGGGTGGATGG - Intronic
1039228491 8:35417238-35417260 CAGAAGGTGAGAAGGGTAGTGGG - Intronic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040362144 8:46676068-46676090 CAGAGGCTGAGAAGGGTGGTGGG + Intergenic
1040628489 8:49179965-49179987 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1042099555 8:65260083-65260105 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1042823055 8:72952747-72952769 AAGAGGGTGAAGAGGGCGACTGG - Intergenic
1042861081 8:73315134-73315156 GAGAGAGAGAGGAGGCCGGTGGG - Intronic
1042861090 8:73315163-73315185 GAGAGAGAGAGGAGGCCGGTGGG - Intronic
1042861099 8:73315192-73315214 GAGAGAGAGAGGAGGCCGGTGGG - Intronic
1042861108 8:73315221-73315243 GAGAGAGAGAGGAGGCCGGTGGG - Intronic
1042861117 8:73315250-73315272 GAGAGAGAGAGGAGGCCGGTGGG - Intronic
1043235820 8:77864705-77864727 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043945421 8:86245956-86245978 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1044384099 8:91566980-91567002 CAGAGGTTGAGGAGGCCAGTGGG + Intergenic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044732476 8:95240481-95240503 CAGAGGGTGGGAAGGGTAGTGGG - Intergenic
1044947219 8:97400608-97400630 CAGAGGCTGAGAAGGGCAGTGGG - Intergenic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1046116502 8:109791005-109791027 CAGAGGCTGGGGAGGGTAGTAGG + Intergenic
1046147419 8:110179292-110179314 CAGAGGCTGAGAAGGGTAGTGGG - Intergenic
1047072818 8:121366025-121366047 CAGAGGCTGGGGAGGGGAGTGGG + Intergenic
1047096974 8:121636386-121636408 CAGAAGGGGAGAAGGGAGGTTGG - Intronic
1048119387 8:131563085-131563107 CATAGGGTGATGAAGGCAGTGGG + Intergenic
1048549297 8:135419058-135419080 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1049701042 8:144012745-144012767 AAGAGAGTGAGGAGGGAAGTGGG + Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050278868 9:4029602-4029624 CATAGGCTGAGAAGGGTGGTGGG - Intronic
1050405995 9:5309260-5309282 CAGAGAGTGAGAAGGGATGTGGG - Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050572516 9:6956090-6956112 CAGAGGCTGAGGAGGGTAGTTGG + Intronic
1051221403 9:14852101-14852123 CAGGAGGTGAGGAAGGCGGCTGG - Intronic
1051717555 9:20000878-20000900 GAGAGGGTGTGGAGGACGGAAGG + Intergenic
1051984768 9:23070735-23070757 CAGAGGCTGAGGTGGCCAGTGGG + Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1054464325 9:65484402-65484424 GAGAGGCTGAGGTGGGCGGATGG - Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1055450673 9:76428589-76428611 CAGAGGATGAAGATGGTGGTGGG - Intronic
1056210944 9:84364668-84364690 CAGAGGCTGGGGAGGGTAGTGGG - Intergenic
1056744948 9:89292664-89292686 GAGAGGCTGAGGTGGGCGGATGG - Intergenic
1056835746 9:89953896-89953918 CAGAGGGTCAGCAGGGCGAGGGG + Intergenic
1057312597 9:93951574-93951596 CAGGGGGTGAGGGTGGGGGTGGG - Intergenic
1057744599 9:97741296-97741318 CAGGGGCGGAGGAGGGCGGGGGG - Intergenic
1057791583 9:98128275-98128297 CAGACAGTGAGGAGGGTGGTAGG + Intronic
1057802625 9:98199341-98199363 CCAAGGGTGAGGAAGGCTGTGGG + Exonic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059086710 9:111310889-111310911 GAGAGGGGGAGGAGGGAGGGAGG - Intergenic
1059099733 9:111458633-111458655 GAGAGGGAGAGGAGGGTGGGGGG + Intronic
1059339484 9:113589518-113589540 CAGAGGCTGAGGATGGCGGCTGG + Intronic
1059395077 9:114029008-114029030 CAGGTGGTGAGAAGGGCAGTGGG - Intronic
1059457077 9:114406463-114406485 CAGAGGGTGATGGGGGCAGAAGG + Exonic
1059617593 9:115967652-115967674 CAGAGGCTGTGCAGGGCTGTGGG + Intergenic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1059840168 9:118206137-118206159 GAGAGGGTGGAGAGGGAGGTTGG - Intergenic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1061014663 9:127974847-127974869 GAGAGGGAGAGGAGGCTGGTGGG - Intronic
1061193452 9:129095150-129095172 CAGAGGCTGAGCAGGACGTTAGG - Exonic
1061194658 9:129101079-129101101 CAGGGGGTGTGGAGGCGGGTGGG + Intronic
1061301219 9:129705966-129705988 CAGGGGGTGAGGAGTGAGGTGGG - Intronic
1061625477 9:131838554-131838576 CAGAGGCTGAGGAGTGGGGAAGG - Intergenic
1061796363 9:133087875-133087897 CAGAGGATGGGGAGGGTGCTGGG + Intergenic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1062101609 9:134731470-134731492 CAGAGGGAGAGGAAGGCGCAGGG - Intronic
1062266675 9:135689716-135689738 GAGAGGGGGAGGCTGGCGGTGGG - Intergenic
1062377425 9:136268440-136268462 CAGAGAGGGAGAAGGGCTGTCGG + Intergenic
1062523678 9:136969859-136969881 CAGGGGGTGAGGATGGGGGTGGG - Intronic
1062590372 9:137271914-137271936 CAGCAGGTGAAGAGGGGGGTGGG - Intronic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1062740328 9:138170072-138170094 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1203524692 Un_GL000213v1:76024-76046 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1203529384 Un_GL000213v1:124523-124545 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186246912 X:7624733-7624755 CATAGGTTGAGGAGGGCCTTGGG - Intergenic
1186430696 X:9501913-9501935 CAGAAGGCGCGGAGGGCGGAGGG - Intronic
1186692143 X:11989474-11989496 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1187095680 X:16145487-16145509 CAGAGGCTGAGAAGGGTAGTGGG + Intronic
1187449511 X:19384329-19384351 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1187574552 X:20540715-20540737 CAGAGGCTGAGAAGGGTGGGAGG - Intergenic
1187724542 X:22188909-22188931 CAGAGGTTGGGAAGGGCGGTAGG - Intronic
1188348099 X:29093323-29093345 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188831663 X:34905857-34905879 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1188977618 X:36694037-36694059 CAGAGGCTGAGAAGGGTAGTGGG + Intergenic
1189001105 X:36947960-36947982 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1189478668 X:41376462-41376484 CAGAGGGTGAGCCGGGCAGAAGG - Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1189667363 X:43370985-43371007 GAGAGGGAGAGGAGGGAGGGAGG + Intergenic
1190037340 X:47037942-47037964 CAGAGGGTGGGAAGGGTAGTGGG - Intronic
1190109721 X:47582247-47582269 GAGAGGGAGAGGAGGCGGGTGGG + Intronic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190580235 X:51886113-51886135 CAGAGGCTGAGAAGGGTGGGGGG + Intronic
1191057003 X:56252369-56252391 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1191800969 X:65079020-65079042 CAGAGGCTGAGAAGGGTAGTAGG - Intergenic
1192848062 X:74925762-74925784 GAGAGGGTAAGGAGAGCGGGAGG - Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193550480 X:82886431-82886453 CAGAGGCTGAGAAGGGTAGTCGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193829316 X:86269134-86269156 CAGAGGCTGAGAAGGGTAGTTGG - Intronic
1193869863 X:86783828-86783850 CAGAGGGTGATAAGGGTAGTGGG + Intronic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1194859833 X:98984204-98984226 CAGAGGCTGAGAAGGGTGTTTGG + Intergenic
1194902152 X:99525645-99525667 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1194942794 X:100032454-100032476 CACAGGGTGGAGGGGGCGGTGGG + Intergenic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1195667172 X:107441913-107441935 GAGAGGGAGAGGAGAGCGGGTGG - Intergenic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196762857 X:119215416-119215438 CAGAGGCTGGGGGTGGCGGTGGG + Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197335375 X:125204749-125204771 CTGAGGGTGAGGGGTGGGGTGGG + Intergenic
1197726323 X:129779295-129779317 GAGAGGGTCATGAGTGCGGTTGG + Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197977358 X:132180059-132180081 CAGAGGGTGGGGTGGGGGGAGGG + Intergenic
1198100056 X:133415346-133415368 CAGAGGGTGTGGGCGGCGGCGGG + Exonic
1198436441 X:136621358-136621380 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198791319 X:140349931-140349953 CAGAGTGTGAGGAGAGTGGTAGG - Intergenic
1198796581 X:140403080-140403102 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1199219322 X:145298863-145298885 CAGAGGGTGAGAAGGATAGTGGG + Intergenic
1199686659 X:150271180-150271202 CAGAGGGGGAGGAGGTAGATTGG + Intergenic
1199734748 X:150675242-150675264 CAGAGACTGAGGAGGGTAGTGGG + Intergenic
1199857351 X:151771053-151771075 CAGAGGGTGGGGAGGGGTGGGGG + Intergenic
1199963757 X:152801076-152801098 CAGATGGTGGGGAGGGAGGGAGG - Intergenic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1200480749 Y:3700385-3700407 CATGGGGTGGGGAGGGTGGTGGG - Intergenic
1201303542 Y:12531326-12531348 CAGAGGCTGAGGACAGAGGTGGG + Intergenic
1201438682 Y:13985729-13985751 CTGATGGTGAGGAGGGAGGGAGG - Intergenic
1201445891 Y:14056979-14057001 CTGATGGTGAGGAGGGAGGGAGG + Intergenic