ID: 985511645

View in Genome Browser
Species Human (GRCh38)
Location 5:317208-317230
Sequence CACCCACGCCTTCCTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 195}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985511641_985511645 -10 Left 985511641 5:317195-317217 CCTGCAGGGAGGCCACCCACGCC 0: 1
1: 0
2: 3
3: 19
4: 237
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511636_985511645 4 Left 985511636 5:317181-317203 CCCATCCTCAGGCGCCTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 225
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511631_985511645 23 Left 985511631 5:317162-317184 CCACACTGCCAGCACAGACCCCA 0: 1
1: 1
2: 3
3: 93
4: 586
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511632_985511645 15 Left 985511632 5:317170-317192 CCAGCACAGACCCCATCCTCAGG 0: 1
1: 0
2: 2
3: 62
4: 486
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511638_985511645 3 Left 985511638 5:317182-317204 CCATCCTCAGGCGCCTGCAGGGA 0: 1
1: 0
2: 1
3: 29
4: 292
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511630_985511645 27 Left 985511630 5:317158-317180 CCAGCCACACTGCCAGCACAGAC 0: 1
1: 0
2: 2
3: 48
4: 380
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511634_985511645 5 Left 985511634 5:317180-317202 CCCCATCCTCAGGCGCCTGCAGG 0: 1
1: 0
2: 3
3: 35
4: 308
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511640_985511645 -1 Left 985511640 5:317186-317208 CCTCAGGCGCCTGCAGGGAGGCC 0: 1
1: 0
2: 2
3: 36
4: 371
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195
985511629_985511645 28 Left 985511629 5:317157-317179 CCCAGCCACACTGCCAGCACAGA 0: 1
1: 0
2: 1
3: 71
4: 1165
Right 985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985511645 Original CRISPR CACCCACGCCTTCCTGGGTG AGG Intronic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
901661946 1:10804199-10804221 CTCCCACGCCTGCCAGGGTGGGG + Intergenic
904859148 1:33521683-33521705 CACCCACCCTTGCCTAGGTGTGG - Intronic
906060933 1:42948164-42948186 CATCCATGGCTTCCTGGGAGAGG - Intronic
908816843 1:68043592-68043614 TGCCCACGCTTTTCTGGGTGTGG + Intergenic
910850903 1:91649136-91649158 CTCCCTCTCCTTCCTGGGGGTGG + Intergenic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
916078714 1:161218616-161218638 CCCCCATGCCTCCCTGGGTGGGG + Intronic
919607651 1:199705771-199705793 CATCCACGCTTTCCTGTGTTTGG - Intergenic
920191931 1:204199194-204199216 CAACATCCCCTTCCTGGGTGCGG - Exonic
920818515 1:209358132-209358154 CACCCACGCCTGTCCAGGTGTGG + Intergenic
920936565 1:210440454-210440476 CACCCAAGCCTTTCTGGGGTGGG - Intronic
922235755 1:223721455-223721477 GACCTATGCCTTCCTGGCTGGGG - Intronic
922252685 1:223864318-223864340 CCCCCACGCCATCCTGTGTCTGG - Intergenic
922619248 1:226980258-226980280 CAGCCAGCCCTGCCTGGGTGGGG + Intronic
924672918 1:246147627-246147649 GCGCCCCGCCTTCCTGGGTGGGG + Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1069488553 10:68841991-68842013 CACACACACCTCCCTGGGTGCGG - Intronic
1069989819 10:72308379-72308401 CCCCCAGCCCTTCCTGGGGGAGG + Intergenic
1070605287 10:77894028-77894050 CACCCACAGCTTCCTATGTGAGG - Intronic
1070785984 10:79162470-79162492 CACCCAGGCCTCCTTTGGTGGGG - Intronic
1070802805 10:79253547-79253569 TTCCCACCCCTTGCTGGGTGAGG - Intronic
1071349093 10:84721399-84721421 ACTCCACACCTTCCTGGGTGGGG + Intergenic
1073323800 10:102631049-102631071 CAACCAGGCCTACCTGGGAGAGG + Exonic
1073376153 10:103036652-103036674 CAACCATGCTTTCCTGGGTGAGG - Intronic
1074099771 10:110345654-110345676 CAGACAGGCCTTCCTGAGTGGGG + Intergenic
1076264309 10:129097918-129097940 CACCCTGGCCTTCCCCGGTGAGG + Intergenic
1078855184 11:15201178-15201200 CACTCAGCACTTCCTGGGTGGGG + Intronic
1080856530 11:36116418-36116440 CATCCCCGCCTTCCTGGAAGAGG - Intronic
1081690430 11:45074215-45074237 CCCCTTCTCCTTCCTGGGTGTGG - Intergenic
1085244729 11:75090989-75091011 CCCACACTCCTTCCGGGGTGAGG + Intergenic
1087177416 11:95108357-95108379 CTCACACACCTTCCTGGCTGTGG - Intronic
1089344621 11:117783125-117783147 CACACACTCCTTCCTGGGAGCGG + Intronic
1091137490 11:133205104-133205126 CACCCTCTTCTTCCTGGGAGGGG + Intronic
1091591616 12:1846057-1846079 CACCCACTCCCACCTTGGTGTGG - Intronic
1092253425 12:6914104-6914126 CACCCACGCCTGCCCGAGGGCGG - Exonic
1102426881 12:112850686-112850708 CACCCACACTTCCCTGGGAGGGG + Intronic
1102454929 12:113065434-113065456 CGCCCGCGCCTTCCGGGCTGGGG + Intronic
1106642109 13:31595793-31595815 CATCCACCCTTCCCTGGGTGGGG - Intergenic
1107577587 13:41743993-41744015 CTCCCAAGCATTTCTGGGTGAGG - Intronic
1109917852 13:69015504-69015526 GATCCTCTCCTTCCTGGGTGGGG - Intergenic
1110436398 13:75481871-75481893 CTCCCGCGCCTGCCTGGGAGCGG + Exonic
1114393780 14:22338273-22338295 CACCCAGGTCTCCCTGGGAGAGG + Intergenic
1115307106 14:31944599-31944621 CACCCACCTCTGCCTGGGTGTGG + Intergenic
1119907719 14:78320825-78320847 CACCCAGCCCTGGCTGGGTGCGG + Intronic
1122900839 14:104781729-104781751 CACTCAGGCCCTGCTGGGTGGGG - Intronic
1123063943 14:105606789-105606811 CCCCCACCCCTTCCTGTCTGAGG + Intergenic
1123073257 14:105652432-105652454 CCCCCACCCCTTCCTGTCTGAGG + Intergenic
1125435908 15:39645434-39645456 GAGCCTCGCCCTCCTGGGTGAGG + Intronic
1125769067 15:42153184-42153206 CACCCAAGCCCTCCTCGGAGGGG - Intronic
1126742040 15:51787028-51787050 CCCCAACCCCTTCCCGGGTGAGG - Intronic
1127520480 15:59738792-59738814 CACCCACACCTAGCTGGGTGAGG - Intergenic
1128290730 15:66476577-66476599 CATCCACTTCTTCCTGGTTGGGG - Intronic
1129299916 15:74619619-74619641 CTCCTAAGCCTTCCTTGGTGAGG + Intronic
1129714339 15:77838200-77838222 CACCCAGACCGTCCTGGGCGGGG - Intergenic
1129752167 15:78073679-78073701 AACACACGCCTGGCTGGGTGCGG + Intronic
1132673751 16:1113278-1113300 CACCACCTCCTTCCTGGTTGAGG + Intergenic
1132731069 16:1362304-1362326 CCCCCACGCCTTGCTAGGTAGGG + Exonic
1132930672 16:2457521-2457543 CACCCACTTCCTTCTGGGTGGGG + Exonic
1132934160 16:2472613-2472635 ATCCCACGCCTGCCTCGGTGAGG + Exonic
1132950415 16:2558799-2558821 CACCCAGGCCCTCCAGAGTGAGG - Intronic
1132963933 16:2641371-2641393 CACCCAGGCCCTCCAGAGTGAGG + Intergenic
1136230358 16:28882341-28882363 CACACACCCCTGCCTGTGTGGGG + Intronic
1139084904 16:63572946-63572968 CTCCCAAGCCTTCCTGGAGGAGG - Intergenic
1139347913 16:66316356-66316378 GGCCCACTCCTTCCTGGTTGAGG + Intergenic
1139939230 16:70592452-70592474 CAGCCACACCTTCCAGGGTTGGG - Intronic
1140481509 16:75265254-75265276 CAGCCAAGCCGTCCTGGGGGAGG + Intronic
1141622229 16:85242368-85242390 GACCCACCCCTTCCTGCATGGGG - Intergenic
1141965216 16:87437553-87437575 CACACAGGCCTGCCTGGGTGCGG - Intronic
1141999836 16:87658003-87658025 CAGCAAAGACTTCCTGGGTGTGG + Intronic
1142617038 17:1142769-1142791 CACCCACCCCTGCCTGTCTGTGG - Intronic
1142817979 17:2442907-2442929 CACCTCCGCCTTCCGGGTTGAGG + Intronic
1143495955 17:7312705-7312727 CCCCCACCCCATCGTGGGTGAGG - Exonic
1149678134 17:58485411-58485433 CACCCTTGCCTTCCTGGAAGAGG + Intronic
1151125147 17:71836808-71836830 CACCCACCCCTTCTTGAGTTAGG - Intergenic
1151539576 17:74758232-74758254 CACCCACGCAGTCCAGGGAGCGG - Intronic
1151923173 17:77173284-77173306 CACCGAAGTCTTCCTGGGGGAGG + Intronic
1152605859 17:81289685-81289707 GACCTACGCCGGCCTGGGTGAGG - Exonic
1152653967 17:81511455-81511477 CCCCCACGCCATCCTGCGTCTGG - Exonic
1152749598 17:82056541-82056563 CCCCCACGCTTACCTGGATGAGG - Exonic
1153379746 18:4425041-4425063 TAACCACGCATTCCTTGGTGGGG + Intronic
1154503015 18:15005808-15005830 CCCCCACGCCTTCACAGGTGGGG - Intergenic
1155311979 18:24532918-24532940 CACCCAGTCCTCCCAGGGTGGGG + Intergenic
1157314813 18:46578653-46578675 CTGCCACGACTTCCTTGGTGAGG - Intronic
1158218158 18:55122011-55122033 AACCTCTGCCTTCCTGGGTGGGG + Intergenic
1158773706 18:60552727-60552749 GAGCCCTGCCTTCCTGGGTGGGG + Intergenic
1162458929 19:10802972-10802994 CACGCAGGCCTTCCTGCCTGAGG + Intronic
1162746271 19:12800429-12800451 CACCCACCCCACCCTGGGTTGGG + Intronic
1163162780 19:15475532-15475554 CACTGAGGCCTTCCTGGGTGAGG - Exonic
1164253455 19:23505849-23505871 AAACCTGGCCTTCCTGGGTGAGG - Intergenic
1164285116 19:23807923-23807945 AAACCTGGCCTTCCTGGGTGAGG + Exonic
1164296928 19:23919483-23919505 AAACCTGGCCTTCCTGGGTGAGG + Exonic
1164317526 19:24106050-24106072 AAACCTGGCCTTCCTGGGTGAGG + Exonic
1165733650 19:38162404-38162426 GAGCCAGGCCTGCCTGGGTGTGG + Intronic
1165830721 19:38728980-38729002 CACCCTCTCCTTGCAGGGTGAGG + Exonic
1166376644 19:42331175-42331197 CACCCCAGCCTTTGTGGGTGGGG + Intronic
1166720295 19:44992546-44992568 CACCCAGGCCCACCTGGCTGTGG + Intronic
1167740470 19:51322195-51322217 CCCCTTCACCTTCCTGGGTGGGG + Intronic
1167836584 19:52076952-52076974 GAACCTCGGCTTCCTGGGTGAGG - Exonic
1168428552 19:56258586-56258608 CAGACACGCCTTCCAGTGTGGGG + Intronic
925671659 2:6316446-6316468 CACCTAGGCTTTTCTGGGTGAGG + Intergenic
928323179 2:30300122-30300144 CACTAACGCCTGCCTGGGGGTGG + Intronic
929979572 2:46666005-46666027 CAGCCAGGCCTTCCATGGTGTGG + Intergenic
930716207 2:54596220-54596242 TCCCCAAGCCTTGCTGGGTGGGG + Intronic
932905826 2:75749986-75750008 CACTCTCCTCTTCCTGGGTGGGG - Intergenic
934738603 2:96703061-96703083 CCCCGACGACTTCCTAGGTGAGG + Intergenic
935183105 2:100707422-100707444 CACCCACCATTTCCTGGGTGTGG - Intergenic
935950740 2:108326157-108326179 CACCCATGACTTCCTGTGAGAGG + Intergenic
936112457 2:109676224-109676246 CACTCACACCTTCCAGGGTGTGG - Intergenic
937047831 2:118861465-118861487 CCCCCAGGGCTTCCAGGGTGTGG + Intergenic
937349515 2:121151880-121151902 CACCCGGGGCTTGCTGGGTGAGG - Intergenic
938091818 2:128439501-128439523 CGGCCACGCCTTCCTTGATGTGG + Intergenic
938397711 2:130963410-130963432 CTCCCACGCCATCCAGGGCGAGG - Intronic
946698854 2:222389464-222389486 CACCCACACCTTTGGGGGTGTGG - Intergenic
947791395 2:232871286-232871308 CACCCAGACCTCCCAGGGTGTGG - Intronic
948397869 2:237661073-237661095 CTCCCACCGCTTCCTGGGTTGGG + Intronic
948973479 2:241447770-241447792 CACACACGCCTGCGGGGGTGGGG + Intronic
949030679 2:241795743-241795765 CACCCACGTCTTCGTGAGAGAGG - Intronic
1169091083 20:2861871-2861893 CACCCACGAGTTCCTGCATGAGG + Exonic
1170643314 20:18175296-18175318 CACTAGAGCCTTCCTGGGTGAGG - Intronic
1171438550 20:25142627-25142649 CAGCCCCTCCTTCCTGGTTGAGG - Intergenic
1171486783 20:25491273-25491295 CACCCACGTCATCCTGGTTGAGG - Intronic
1172319285 20:33983585-33983607 CACCCAGGCCTTCTTGAGGGAGG + Intergenic
1173605734 20:44330056-44330078 CAACCCCGCCTTGCTGGGTCAGG + Intergenic
1173618117 20:44416037-44416059 CACCCAAACCTCCCTGGCTGGGG + Intronic
1173704163 20:45097970-45097992 CGCGCACGCCTTCCGGGCTGCGG + Exonic
1173874865 20:46364119-46364141 CACCTGCGACGTCCTGGGTGCGG - Intronic
1174046866 20:47739998-47740020 CACCCAAGCCTTCAGGGGTCGGG - Intronic
1174190230 20:48735243-48735265 CACCCACGCCATCCTTGTTTAGG - Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175237522 20:57525022-57525044 CGGCCACGCCTTCCGCGGTGAGG - Exonic
1175688171 20:61046323-61046345 CACCCATGCATCCATGGGTGGGG + Intergenic
1175702397 20:61149370-61149392 CACACAGGCCTTCATGGGAGAGG - Intergenic
1175911574 20:62407599-62407621 CACCCACGCCGCCCTGGGTCCGG - Intergenic
1175912710 20:62412450-62412472 CACCCTCGCCCTCCTCTGTGGGG + Intronic
1179457467 21:41508772-41508794 CAGCCACGTCTTCCTGGCTGAGG - Intronic
1180722191 22:17917706-17917728 CACCAAGGCCTCCCTGGGCGGGG + Intronic
1180958054 22:19750012-19750034 CAGCCACCCCATCCTGGGCGGGG - Intergenic
1181005873 22:20013263-20013285 CTCCCAAGCCTTCCCAGGTGTGG - Intronic
1181151899 22:20890147-20890169 CAACCAGGCCTTCCTGGGCATGG - Exonic
1181532831 22:23526746-23526768 GATGCACGCCTTCCTGGCTGAGG - Intergenic
1181756598 22:25028808-25028830 CACCCACGTCTTCTCGGGAGGGG - Exonic
1181867188 22:25868156-25868178 CACCTGCACCTTCCTGTGTGAGG + Intronic
1181985792 22:26799136-26799158 CTCCCACTCCTGCCTGGGGGGGG - Intergenic
1183292689 22:37012471-37012493 CCCCCACCCCTGCCAGGGTGTGG - Intronic
1183582326 22:38733388-38733410 CAACCCCACCCTCCTGGGTGCGG - Exonic
1183675695 22:39297691-39297713 CCCCCTCCCCTTCCTGGGTCAGG + Intergenic
1183726851 22:39594662-39594684 CTCCCACTCCTCTCTGGGTGGGG + Intronic
1183745052 22:39687239-39687261 CACCCCCGCCCTCCTGGGGGTGG - Exonic
1184393859 22:44221095-44221117 TCCCCACGCCTGCCAGGGTGGGG - Intergenic
1184423050 22:44392831-44392853 CACCCACTCCTTCTGGGGAGGGG - Intergenic
1184512712 22:44942748-44942770 CACCCAGGCTTCCCTGGGAGTGG + Intronic
1184538075 22:45100887-45100909 CCCCCAGGCCCTCGTGGGTGAGG - Intergenic
1184713608 22:46267982-46268004 CACCCGGGCCTTCCTGGGAGTGG - Exonic
950073580 3:10171424-10171446 CCCACACCCCTCCCTGGGTGGGG - Intronic
950157045 3:10729486-10729508 CACCCAGTCCTTCCTGCCTGAGG + Intergenic
951400277 3:22224803-22224825 CACCCACTGCTCCCTGCGTGGGG + Intronic
954334151 3:49906423-49906445 CACCCACCCCTTTTTGGGGGTGG + Intronic
955195541 3:56801981-56802003 CAGCCACGCCTTGATGGGTGGGG + Intronic
961314613 3:126026127-126026149 CACACACCCCTGCCTGGGTGAGG + Intronic
969328818 4:6461133-6461155 CAGGGACGCCTTCCTGGGAGAGG - Intronic
969582494 4:8073291-8073313 CACCCAGGCCGTCCTCGCTGAGG + Intronic
969682617 4:8651801-8651823 CACCCAGGCCTGCCCCGGTGAGG + Intergenic
979991194 4:127377613-127377635 CACCCATTTCTTCCTAGGTGCGG - Intergenic
983513067 4:168629630-168629652 CTCCCATCCCTTCCTGGGTGGGG + Intronic
985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG + Intronic
985581201 5:696080-696102 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
985595826 5:787412-787434 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
988485067 5:31661934-31661956 CAGACACGTCATCCTGGGTGAGG + Intronic
990639012 5:57761674-57761696 GAGCCACGCCCTCCTGGGTGGGG + Intergenic
994316472 5:98339240-98339262 CCCCCACGCCATCCTGCGTCTGG + Intergenic
997096913 5:130923791-130923813 CACCCTAACCTCCCTGGGTGGGG + Intergenic
997454733 5:134008047-134008069 CTCCAAAGCCTTCCTGGGAGTGG + Intergenic
997595366 5:135103591-135103613 GACCCACGTCTGCCTCGGTGAGG - Intronic
998173040 5:139883440-139883462 CACCCAAGCCTTCCTGTGCCAGG - Intronic
1001197551 5:169686999-169687021 CACCTAGATCTTCCTGGGTGAGG + Intronic
1001227164 5:169954882-169954904 CACCCACGCTCCCCTGGCTGTGG - Intronic
1001816317 5:174672122-174672144 CACCCCGGCCTGGCTGGGTGAGG + Intergenic
1001882589 5:175257672-175257694 CATCCACCCCCTCCTGTGTGGGG + Intergenic
1003569324 6:7246128-7246150 CACTCACACCTTCCTGGGGGCGG + Intronic
1003837563 6:10088034-10088056 CACCCACCCCTTCCTGAGGAAGG + Intronic
1006228151 6:32558253-32558275 CATCCAGGGCTCCCTGGGTGGGG + Intronic
1007274594 6:40663940-40663962 GGCCCACCCCTGCCTGGGTGTGG + Intergenic
1007399938 6:41597861-41597883 CACCCACGTCATCGTGGCTGAGG - Exonic
1013225953 6:108119500-108119522 GCCCCACGCCTTCCTCGGTGGGG - Intronic
1013415054 6:109917542-109917564 CACCCACCCCTGCCTTGGTGGGG + Intergenic
1018964379 6:168473192-168473214 CACTGAGACCTTCCTGGGTGAGG + Intronic
1019056428 6:169226998-169227020 CACAGACGCCATCCTGGATGGGG + Intronic
1019083388 6:169452227-169452249 CACCCACGCCTTACTCACTGCGG + Intergenic
1019733510 7:2639647-2639669 CACCCCCGGCTTCCTGGATGGGG - Intronic
1019886804 7:3912609-3912631 CAGCCATGCCTGCCTGGGAGAGG - Intronic
1019980803 7:4620495-4620517 CACCCGTACCTTCCTGGGTATGG - Intergenic
1023790597 7:43750214-43750236 GAGCCATGCCCTCCTGGGTGGGG - Intergenic
1028641297 7:93044514-93044536 CACCCAGACCTTCTTGGGAGAGG + Intergenic
1028692652 7:93671283-93671305 CACAGAGGCCTTCCTTGGTGTGG + Intronic
1033415977 7:141161566-141161588 CACCCAGGCCTTCCTGCGCATGG - Intronic
1035746754 8:1966504-1966526 CACCCAGGCCTTTCGGGATGTGG - Intergenic
1036220224 8:6915131-6915153 CACCCCTGCCTTCCAGGGTTGGG - Intergenic
1036497910 8:9286180-9286202 CACCCTCCCCTTCCTGGGGAGGG - Intergenic
1037273266 8:17153386-17153408 CGTCCACGCCTTCCTGGGTTTGG + Intergenic
1045034740 8:98168342-98168364 TACCCACGCCTTTCTGGGTGCGG - Intergenic
1049177400 8:141202369-141202391 CCCCCACTCCCTCCTGGGTGGGG + Intergenic
1049224786 8:141444995-141445017 CTCCCACGCCCTCCAGGGAGCGG - Intergenic
1049647601 8:143742644-143742666 CAGCCACACCTTCCTGGTGGAGG - Intergenic
1049744942 8:144259333-144259355 CACCACCGCCTTCCTGGCCGAGG + Exonic
1052989243 9:34509149-34509171 CACCCACACTGTCCTGGGTGGGG + Intronic
1053175214 9:35917622-35917644 CACCTACGACTTCCAGGCTGAGG + Intergenic
1053278999 9:36805166-36805188 CACCCACACCTCGCTGGGAGTGG - Intergenic
1053283385 9:36835843-36835865 CACCCATGCCTGCCTGGGCCTGG + Exonic
1054835534 9:69672127-69672149 CACCCACCCCTCCCTGGCTGTGG + Intronic
1057267621 9:93629682-93629704 CTACCAAGCCTGCCTGGGTGAGG - Intronic
1060114010 9:120926840-120926862 CACCTATGACTTCCTGAGTGGGG - Exonic
1060208333 9:121695636-121695658 CAGCCAGGCCTTAGTGGGTGTGG + Intronic
1060683063 9:125582889-125582911 CAGCCAATCATTCCTGGGTGAGG - Intronic
1060878460 9:127100588-127100610 TACCCAAGGCTTCCTGGGTGAGG + Intronic
1061327693 9:129874220-129874242 CACACGTGCCTTCCTTGGTGCGG - Intronic
1061368817 9:130186597-130186619 CTCCCACCCCTTCCTGGGGCTGG - Intronic
1061369100 9:130187905-130187927 CTCCCACCCCTTCCTGGGGCTGG + Intronic
1061904833 9:133691273-133691295 CTCCCATGCCCTCCTGGGAGAGG - Intronic
1061999373 9:134208033-134208055 AACCCAGGCCCTCCTGGGTGAGG - Intergenic
1062057397 9:134475645-134475667 CCCCCACCCCATCCTGGCTGGGG - Intergenic
1062337609 9:136079283-136079305 CAGGCAGCCCTTCCTGGGTGTGG - Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187466803 X:19534740-19534762 CACCTTGGTCTTCCTGGGTGGGG - Exonic
1189187086 X:39063845-39063867 CACCCCCTCTTTCATGGGTGGGG - Intergenic
1192368714 X:70496283-70496305 CAGCCAGTCCTTTCTGGGTGGGG + Intronic
1197769672 X:130082169-130082191 CACCCATGCCTGCCTCGCTGTGG + Intronic