ID: 985511834

View in Genome Browser
Species Human (GRCh38)
Location 5:317899-317921
Sequence CAGGGTGAGGGGCAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1403
Summary {0: 1, 1: 3, 2: 11, 3: 241, 4: 1147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985511834 Original CRISPR CAGGGTGAGGGGCAGGTGCA AGG (reversed) Intronic
900120805 1:1047942-1047964 AGGGGTGAGGGGCAGGGGCATGG - Intronic
900151435 1:1180871-1180893 CAGGGACGGGGGCAGGGGCAGGG - Intronic
900151449 1:1180901-1180923 CAGGGGCAGGGGCAGGCGTAGGG - Intronic
900151475 1:1180960-1180982 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900151496 1:1181012-1181034 CAGGGGCAAGGGCAGGGGCAGGG - Intronic
900151499 1:1181018-1181040 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900162136 1:1228805-1228827 CAGGGTGTGGGCCAGGTGCTGGG + Exonic
900187735 1:1340209-1340231 GAGGGTTGGGGGCAGGGGCAGGG - Intronic
900201030 1:1406681-1406703 CCGGGCGAGGGGCTGGAGCAGGG + Intronic
900204301 1:1425589-1425611 CAGGGTGTGGGGCCCGTACACGG - Intergenic
900226248 1:1534871-1534893 CAGGGTGGGGTGCAGGTGGCTGG - Intergenic
900229065 1:1547086-1547108 CATGCAGAGGGGCAGGTGCAGGG + Intronic
900363578 1:2301455-2301477 CCAGGGGAGGGGCAGGTGCCTGG - Intronic
900402397 1:2477923-2477945 CAGGGGCGGGGGCAGGGGCATGG + Intronic
900414428 1:2528530-2528552 GCAGGTGAGGGGCAGGGGCAGGG - Intergenic
900458979 1:2791128-2791150 TGGGGTGGGGGGCAGGTGCGCGG - Intronic
900476456 1:2878587-2878609 GAGGGTGAGGGGCTGGCCCAGGG + Intergenic
900510929 1:3060787-3060809 CAGGATGGGGGGCGGGGGCAGGG - Intergenic
900528242 1:3139734-3139756 CAGGACCAGGGTCAGGTGCATGG - Intronic
900537120 1:3184385-3184407 CAGGGTGCGGGGCGGGGGCCGGG + Intronic
901036417 1:6338764-6338786 CAGGGAGAGGACCAGGGGCAGGG + Intronic
901404939 1:9039385-9039407 AAGTGTGAGGGGCTGGTGCGGGG + Intronic
901672820 1:10866304-10866326 CAGGTTGGGGGGCAGGTGGAGGG - Intergenic
902288012 1:15419133-15419155 TGGGGAGAGGGGCAGGGGCAGGG + Intronic
902292105 1:15442298-15442320 CAGGGTGAGGGGAAGGGCCTGGG - Intronic
902359776 1:15936014-15936036 CACCATGAGGGGCAGGAGCAGGG - Exonic
902410340 1:16208280-16208302 CAGGGCCAGGGGCAGCAGCAGGG - Intronic
902503430 1:16925053-16925075 CAGGGTGTGGGGCGGGAGCTGGG + Intronic
902567411 1:17321257-17321279 GAAAGTGGGGGGCAGGTGCAGGG + Intronic
902604470 1:17561260-17561282 CGGGGCGGGGGGGAGGTGCAGGG - Intronic
902611008 1:17597137-17597159 CATGGTGAGGGGCAGGAGATGGG - Intronic
902843811 1:19093624-19093646 CAGGGAGAGTGGCAGGAGCCGGG - Intronic
902919007 1:19655559-19655581 CAGGGTGAAGGGCTTGTGCTGGG + Intronic
902938839 1:19785100-19785122 CAGGGAGAATGGCAGGTGCAAGG - Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
903322792 1:22552796-22552818 CGGGGTGAGGGGAGGGTGCCAGG + Intergenic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903894547 1:26595385-26595407 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894550 1:26595391-26595413 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894553 1:26595397-26595419 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894556 1:26595403-26595425 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894559 1:26595409-26595431 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
904038395 1:27570875-27570897 GAGGCAGAGGGGCAGGGGCAGGG - Intronic
904044881 1:27603167-27603189 AAGGGGGAGGGGGAGGTGGACGG - Intronic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904586261 1:31582593-31582615 CAGGGCAAGGGGCAGATGCATGG + Intronic
904598141 1:31659381-31659403 GGGGGTGAGGGGCAGGGGCTTGG + Intronic
904606853 1:31702730-31702752 CAGGGTCAGGGGCTGGTGACTGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905295691 1:36953176-36953198 CAGGGGGAGGGGCAAGGACAGGG - Intronic
905295693 1:36953182-36953204 CAGGGGCAGGGGGAGGGGCAAGG - Intronic
905388563 1:37621520-37621542 GGGGGTGAGGGGCAGGGGCAAGG + Intronic
905627305 1:39497739-39497761 CGGGGTGGGGGGCAGGGGCAGGG - Intronic
906035519 1:42748177-42748199 GTGAGTGCGGGGCAGGTGCAGGG - Intronic
906143257 1:43545989-43546011 CAGGCTGAGGGGGAGGGGCGAGG + Intronic
906337428 1:44945603-44945625 CATGGTGAGTTGCAGGTGTAGGG - Intronic
906390506 1:45411326-45411348 TCGGGTGAGGGTCAGGTGGAGGG + Intronic
906398366 1:45486568-45486590 GAGGCTGAGGGGCAGGAGAATGG + Intronic
906533612 1:46538948-46538970 CAGGGTCATGGGCAGCTGAATGG - Intergenic
906673979 1:47679919-47679941 CAGGGACAGGGACAGGTCCAAGG + Intergenic
906698890 1:47843276-47843298 CAGGGTGCAGGGCAGACGCAGGG + Intronic
907020120 1:51059250-51059272 CAGAGTGGGGGCCAGGAGCAGGG - Intergenic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
908257314 1:62313699-62313721 GAGGGTGAGGGGCAAGGGGAGGG + Intronic
909391182 1:75124612-75124634 CAGGGTGATGGTCAGGCCCAAGG + Intergenic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
909670011 1:78177623-78177645 CAGGGTGGGGAGCTGGTGCACGG + Intergenic
910130705 1:83902077-83902099 CAGGGGGGAAGGCAGGTGCATGG - Intronic
910319391 1:85926667-85926689 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
911155043 1:94628532-94628554 TAGGGGCAGGGGCAGGGGCAGGG + Intergenic
911209510 1:95124585-95124607 TAGGGTGAGGTGTAGGTTCATGG + Intronic
912382079 1:109253220-109253242 CAGGGTCATGGGCAGGTACTCGG - Exonic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
913968617 1:143397053-143397075 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
914062996 1:144222652-144222674 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
914116154 1:144743702-144743724 CAGAGTGAGGGGCGGATGCAGGG - Intergenic
915170281 1:153972814-153972836 CTTGGTGAGGGGCAGGTGAGAGG - Exonic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915743999 1:158142158-158142180 CAGGGGCGGGGGCAGGGGCAGGG + Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916986900 1:170201473-170201495 CAGGGTGGGGTGGAGGTGTATGG + Intergenic
917284646 1:173411256-173411278 TAGTGTCAGGGGCAGGGGCAGGG + Intergenic
917284650 1:173411262-173411284 CAGGGGCAGGGGCAGGGGCGGGG + Intergenic
917623213 1:176819167-176819189 CAGGGGGAGGGTCAGCAGCAGGG + Intronic
918007871 1:180558998-180559020 CAGGGTGTGGGGGTGGTGAAAGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918697321 1:187560401-187560423 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
919148953 1:193670664-193670686 TAGGGTGAGGGGCTGGGGGAGGG - Intergenic
919465656 1:197919856-197919878 CAGGGAGAGCGGCAGGGGCCAGG - Intronic
919880010 1:201895046-201895068 CAGGATGAGTGGGAGGTGCTGGG + Intergenic
919917129 1:202145539-202145561 CAAGGAGAGGGGCAGGAGTAAGG - Intergenic
920148790 1:203886627-203886649 AAGGGTGAAGGGCAGGTTGAAGG - Intergenic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
921080975 1:211738196-211738218 AAGGCTGAGTGGGAGGTGCAAGG - Intergenic
921172346 1:212560695-212560717 CAGCATGAGGGGCAGGAGCTGGG - Intergenic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921238579 1:213153306-213153328 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921238582 1:213153312-213153334 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921470592 1:215543516-215543538 CTGGAGGAGGGGCAAGTGCATGG + Intergenic
922126133 1:222725864-222725886 CAGGGTGAAGTGCAGTGGCACGG - Intronic
922504020 1:226115948-226115970 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
922928888 1:229373523-229373545 GAGGGTGAGGGGCAGACACAGGG - Intergenic
923008017 1:230067436-230067458 CAGGGTGGGGGGTGGGCGCAGGG - Intronic
923086388 1:230706279-230706301 CAGGGCGAGGGGCAGGATCTGGG - Intronic
923209025 1:231786702-231786724 CATGGTGTGGGACAGGTGCAAGG - Intronic
923219980 1:231884008-231884030 CAGGGTGGGTGGCAGGGGAATGG + Intronic
923629191 1:235638646-235638668 GGGGGTGAGGGGCAAGGGCAGGG - Intronic
923630116 1:235644261-235644283 CAGGGTGAGGTGTAGGTCCAGGG - Intronic
923672306 1:236051253-236051275 GAGGGGGAGGGGCAGGGGGAGGG - Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799883 10:371192-371214 TAGGGTGAGGGGATGGTGCAGGG - Intronic
1062839165 10:657215-657237 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839179 10:657263-657285 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839191 10:657299-657321 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839196 10:657311-657333 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839218 10:657383-657405 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839243 10:657467-657489 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839269 10:657563-657585 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839289 10:657635-657657 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839310 10:657707-657729 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839338 10:657827-657849 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839352 10:657875-657897 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839367 10:657923-657945 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839372 10:657935-657957 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839394 10:658007-658029 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839421 10:658103-658125 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839448 10:658199-658221 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839468 10:658271-658293 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1062839489 10:658343-658365 CAGGTCCAGGGGCAGGTCCAGGG - Intronic
1063477360 10:6340735-6340757 CAGGGGGAGAGCCAGGTGCCAGG + Intergenic
1063529979 10:6821520-6821542 CAGGGAGAGGGCCAGCTTCACGG - Intergenic
1064739323 10:18416145-18416167 AAGGGTGAGTGGGGGGTGCAGGG - Intronic
1065125135 10:22566696-22566718 GAGGAAGAGCGGCAGGTGCAAGG - Intronic
1065763812 10:29008210-29008232 CAGCGTGTGGGGCTGGTGCTTGG - Intergenic
1066006922 10:31154186-31154208 GAGGGTGAAGGGGAGGTGAAAGG + Intergenic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1067067732 10:43113126-43113148 CAGGGTCAGGGACAGGGGGAAGG + Intronic
1067092216 10:43273656-43273678 CAGAGGGAGGGGCCTGTGCAAGG + Intergenic
1067166051 10:43867391-43867413 CAAGGGCAGGGGCAGGGGCAGGG + Intergenic
1067525575 10:47036347-47036369 GAGAGTGAGGGGCAGGTGTCAGG + Intergenic
1068826664 10:61447840-61447862 CAGAGTGAGGGGGGTGTGCAGGG - Intronic
1070274181 10:74988941-74988963 CAAGGACAGTGGCAGGTGCAGGG + Intronic
1070693269 10:78543258-78543280 CATGGTGAGGGGCAGGGTCCTGG - Intergenic
1071589836 10:86862362-86862384 GACTGTGAGCGGCAGGTGCAAGG + Intronic
1072585264 10:96776058-96776080 CAGGCTGAGGTGCAGTGGCATGG + Intergenic
1072661693 10:97367252-97367274 CAGGGTGTGGGCCAGGAGCAGGG - Intronic
1072917889 10:99550940-99550962 CAGGGGGTGGGTAAGGTGCAGGG - Intergenic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073091135 10:100940779-100940801 GAGGGGCAGGGGCAGGAGCAGGG - Intronic
1073091139 10:100940791-100940813 CAGGGGCAGGGGGAGGGGCAGGG - Intronic
1073120502 10:101119742-101119764 AAGAGTGAGGGGCACGAGCAAGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073208894 10:101782820-101782842 CATGGTGAGGGGCAGGGGAGTGG - Exonic
1073216176 10:101837932-101837954 CAGGGCCAGGGCCAGGTCCAGGG - Intronic
1074499759 10:114012794-114012816 CAGAGAGAGGGGCAGGGACAGGG - Intergenic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1074919474 10:117992977-117992999 AAGGGTGAGGGGAAGGAGCGGGG + Intergenic
1075108731 10:119560506-119560528 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075815204 10:125259754-125259776 CAGGGGCAGGGGTAGGGGCAGGG + Intergenic
1076015128 10:127021637-127021659 CAGGACGAGGGGCAGGTGCAAGG - Intronic
1076302965 10:129441840-129441862 GAGGGGGAGGGGGAGTTGCAGGG - Intergenic
1076307785 10:129476937-129476959 CAGGGTGAGAGCCAGCCGCATGG + Intronic
1076314174 10:129529155-129529177 GAGTGTGAGGGGCAGTGGCAGGG + Intronic
1076483779 10:130802568-130802590 CTGGGTGATGCGCATGTGCAGGG - Intergenic
1076499400 10:130924462-130924484 CTGGGTGAGGGGCTGCAGCAAGG + Intergenic
1076705639 10:132299936-132299958 CAGGGAGAGGCAGAGGTGCATGG + Intronic
1076790669 10:132775178-132775200 CAGGGAGAGAGGGAGGGGCAGGG + Intronic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076858322 10:133128063-133128085 CAGGCAGGGGGCCAGGTGCAGGG - Intronic
1076864176 10:133159331-133159353 CTGGGAGTGGGGCAGGTGCTGGG - Intergenic
1076908988 10:133378175-133378197 CAGGGAGAGGGGCGGGTGCCTGG - Intergenic
1076963668 10:133787195-133787217 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963670 10:133787201-133787223 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963672 10:133787207-133787229 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077235847 11:1481709-1481731 CAGGAGCAGGGGCAGGGGCAGGG + Intronic
1077235850 11:1481715-1481737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077235853 11:1481721-1481743 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077235864 11:1481743-1481765 GAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077327910 11:1971629-1971651 CAGGTTGGGTGGCTGGTGCAAGG - Intronic
1077330617 11:1982437-1982459 CAGGGTCAGGGCCAGGGTCAGGG + Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077440999 11:2569170-2569192 AAGGGTGTGGGCCAGGTGCGGGG - Intronic
1077500451 11:2907683-2907705 CAGGGGGAGGAGCGGCTGCAGGG + Intronic
1077770730 11:5216147-5216169 TGGGGTGGGGGGCAGGGGCAGGG - Intergenic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1078057139 11:8018198-8018220 CAGGGTGGGGTGGAGGTGCCAGG - Intergenic
1078474542 11:11620186-11620208 CAGGCTCAGGGGCCAGTGCATGG - Intronic
1078640804 11:13094074-13094096 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1078640806 11:13094080-13094102 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1079004257 11:16781179-16781201 GAGGGTGAGGGACAGATCCACGG + Intronic
1079690145 11:23406812-23406834 AAGGGGGAGGGGGAGGGGCAGGG - Intergenic
1080139030 11:28892295-28892317 TAGGGTGAGGGGCTGGTGCTTGG - Intergenic
1081781488 11:45716182-45716204 CAGGGAGTGGGCCGGGTGCAAGG - Intergenic
1081967566 11:47178875-47178897 CAGGGTGAGAGCCAGGAGCGCGG - Exonic
1081977672 11:47246019-47246041 GAGGGTGAGGGCCAGATGTATGG - Intronic
1082768498 11:57187326-57187348 CAGGGTCAGGGTCAGGTGGCAGG - Exonic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1083052964 11:59793254-59793276 GAGGGGGAGCTGCAGGTGCAGGG + Intronic
1083225745 11:61283371-61283393 CAGAGTGAAGGTCAGGGGCAAGG - Intronic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1083308877 11:61774629-61774651 CAGGCTGAGGGGCAGGCACAGGG - Intronic
1083432339 11:62620546-62620568 CAGGGGGCTGGGCAGGGGCAGGG + Exonic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083743247 11:64722175-64722197 CAGGGGGAGAGGAAGCTGCAGGG - Intronic
1083779906 11:64912376-64912398 CGGGGTCAGGAGCAGGTGCAGGG + Exonic
1083783109 11:64928250-64928272 CAGGGTCAGGGTCAGGGGAAAGG - Intronic
1083783111 11:64928256-64928278 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1083795918 11:65016606-65016628 CTGGGGGAGGAGCAGGTTCAGGG + Intronic
1083891482 11:65597971-65597993 CAGGGAGGAGGGGAGGTGCAGGG - Exonic
1083996464 11:66275514-66275536 CAGGGAGAGAGACAGCTGCAGGG + Intronic
1084035769 11:66509335-66509357 GAGGGGGAGGGGCAGGAGCTTGG + Exonic
1084093422 11:66894318-66894340 GAGGGAGAGGGGCAGGTGCTAGG - Intronic
1084155787 11:67311771-67311793 CAGGAGCAGGGGCAGGGGCAGGG + Exonic
1084155790 11:67311777-67311799 CAGGGGCAGGGGCAGGGGCAGGG + Exonic
1084363951 11:68685708-68685730 CAGGCGGAGGGGCAGGAGCCAGG - Intronic
1084430631 11:69108871-69108893 AAGGGGCAGGGGCAGGTGCTTGG - Intergenic
1084459025 11:69286031-69286053 CAGGCTGAGGGGCAGCTGCAGGG - Intergenic
1084460340 11:69293536-69293558 GAGGGGGATGGGCAGGGGCAAGG - Intergenic
1084665474 11:70573983-70574005 CGGGCTGGGGGCCAGGTGCATGG - Intronic
1084774989 11:71369181-71369203 CAGGGAGCAGGGCAGGTGCCCGG + Intergenic
1084937998 11:72597468-72597490 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1085001341 11:73038699-73038721 CAGGGAGTGAGGCAGGGGCAAGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085270829 11:75268929-75268951 TAGGGTGAAGGGCAGTTCCACGG + Exonic
1085313852 11:75531565-75531587 TAGGGTGGGAGGCAGGAGCAGGG + Intergenic
1085448351 11:76615940-76615962 CATGCTGAGGGGCAGGTTCCTGG - Intergenic
1085449323 11:76622601-76622623 CAGTGGGAGGGGCCGTTGCAGGG - Intergenic
1085464989 11:76717091-76717113 CAGGGTGTGGAGCACGTCCAGGG + Intergenic
1086365843 11:86109743-86109765 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365846 11:86109749-86109771 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365849 11:86109755-86109777 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1087052826 11:93903828-93903850 CAGGAGGAGGTGCAGGTGCAGGG - Intergenic
1087904124 11:103675753-103675775 CAGGGTGAGGGACAAGGGGAGGG + Intergenic
1088429598 11:109744635-109744657 CTGGGAGAGGGGCAAGTACAGGG + Intergenic
1088533724 11:110837713-110837735 GAGAGTGAGGGGGAGGTACATGG + Intergenic
1088794499 11:113256369-113256391 CACAGTGAGGTGCAGGTGCCTGG - Intronic
1089044900 11:115491946-115491968 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
1089384408 11:118058525-118058547 CAGGGTGAGAGGCACGTGCCTGG + Intergenic
1089502399 11:118940305-118940327 CAGGCTGGGGAGGAGGTGCAGGG + Intronic
1089621075 11:119722547-119722569 CAGGGAGCGAGGCAGGTGCCGGG + Intronic
1089730411 11:120515460-120515482 CAGTGTGAAGGGCACCTGCATGG + Intronic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090273024 11:125401076-125401098 TTGGGTGGGGGGCAGGGGCAAGG + Intronic
1090363217 11:126187342-126187364 CAGGGAGCGAGGCAGGTGCGAGG + Intergenic
1090429401 11:126633526-126633548 CAAGGCGAGGGGGAGGTGCCAGG - Intronic
1090862181 11:130663708-130663730 CGGGGTGCGGGGCAGGGGGAGGG + Intergenic
1091334917 11:134759065-134759087 GAGGGTTTGGGGCAGCTGCAGGG + Intergenic
1202810890 11_KI270721v1_random:26809-26831 CAGGTTGGGTGGCTGGTGCAAGG - Intergenic
1202813595 11_KI270721v1_random:37616-37638 CAGGGTCAGGGCCAGGGTCAGGG + Intergenic
1091404547 12:201082-201104 CAGGTTGATGGGCAAGTGCATGG + Intronic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091666679 12:2423891-2423913 TAAGGTCAGTGGCAGGTGCAGGG + Intronic
1092086499 12:5767228-5767250 TAGTGTCATGGGCAGGTGCAGGG + Intronic
1092527023 12:9315603-9315625 CAGGGGCAGGGGCAGGGGCTGGG - Intergenic
1092527026 12:9315609-9315631 GAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1092527029 12:9315615-9315637 GAGCGGGAGGGGCAGGGGCAGGG - Intergenic
1092540240 12:9416157-9416179 GAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1092540243 12:9416163-9416185 GAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1092540246 12:9416169-9416191 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1092540249 12:9416175-9416197 CAGGGGCAGGGGCAGGGGCTGGG + Intergenic
1092839739 12:12528310-12528332 CTGGGAGAGGGGCCGGTGTATGG + Intronic
1093653903 12:21674177-21674199 AAGGGGCAGGGGCAGGGGCAGGG - Intronic
1094191122 12:27699612-27699634 CAGGGTGGGGGCAGGGTGCAAGG - Intergenic
1094421599 12:30277174-30277196 CAGGGTGAGGGACATTTCCAGGG + Intergenic
1094512806 12:31106308-31106330 GAGAGGGAGGGGCAGGTGCAAGG - Intergenic
1094555739 12:31497894-31497916 CAAGGGGAGGGGTAGGGGCAGGG + Intronic
1094555742 12:31497900-31497922 GAGGGGTAGGGGCAGGGGCAGGG + Intronic
1094555744 12:31497906-31497928 TAGGGGCAGGGGCAGGGGCAAGG + Intronic
1094555747 12:31497912-31497934 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1095584965 12:43839391-43839413 CTGGATGGGGAGCAGGTGCAGGG - Intronic
1095800905 12:46269234-46269256 GAGGGAGAGGGGCAGGTGCCAGG - Intronic
1096121001 12:49089518-49089540 CAAGGTGAGGGGCTGGGGCATGG - Exonic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096470334 12:51871592-51871614 CAGAGTGGGGGGCTGGTGGAGGG + Intergenic
1096533710 12:52257609-52257631 GAGGGTGAGGGGCTGGCCCAAGG - Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096555089 12:52398924-52398946 CAGGCTGAGCAGCAGGTGCTAGG - Intronic
1096778770 12:53979987-53980009 CAGGTTGAGGGGCAGGTCCAGGG - Intergenic
1096780875 12:53991454-53991476 CAGGGCCAGGGCCAGATGCAGGG + Intronic
1096908899 12:54962515-54962537 CTGGGTGATGGACAGGTCCAAGG + Exonic
1096958895 12:55557433-55557455 AAGGGTGGGGGGCAGGAGGAGGG - Intergenic
1097052381 12:56231111-56231133 CTCGGTGGGGAGCAGGTGCAAGG + Intronic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1098159012 12:67630045-67630067 GAGAGAGAGGGGCAGGTGCAAGG + Intergenic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1100020990 12:90069419-90069441 GAGGGTGAGAGGAAGTTGCAGGG + Intergenic
1100685890 12:96985711-96985733 TGGGGTGCGGGGCAGGTGCGCGG + Intergenic
1100712748 12:97275502-97275524 CAGGGAGGGGGGCAGAGGCAGGG + Intergenic
1101321987 12:103680706-103680728 CAGGGTGAGGTGCAGGGCCTTGG - Intronic
1101967648 12:109292055-109292077 CGGGGTGAGGTGCAGGGGCAGGG + Intronic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1102772159 12:115487400-115487422 GAAGCTGAGGGGCAGATGCATGG - Intergenic
1103167738 12:118784734-118784756 CAGGGACAGGGGCAGGCTCAAGG + Intergenic
1103332597 12:120164558-120164580 AAGGGTGTGTGGCAGGTGGAAGG - Intronic
1103559101 12:121783066-121783088 CAGTGATTGGGGCAGGTGCACGG + Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1103763814 12:123268483-123268505 CGGAGAGAGGGGCAGGTGCCGGG - Intronic
1104968655 12:132521245-132521267 CAGGCTGTGGGGCTGGGGCAGGG + Intronic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105340043 13:19514017-19514039 AAGGGTGAGGGACAGATACAGGG + Intronic
1106016963 13:25878795-25878817 CAGAGTGAGTGGAAGGTGCTGGG - Intronic
1106171709 13:27294377-27294399 GAGGGTGAGAGGCAGGAGGAGGG - Intergenic
1107958183 13:45537847-45537869 CAGGGCTGGGGGCAGGGGCAGGG - Intronic
1108634605 13:52320193-52320215 AAGGGTGAGGGACAGATACAGGG + Intergenic
1108692901 13:52875812-52875834 CAGGAGGAGGGGCAGGGGGAAGG - Intergenic
1109209191 13:59514940-59514962 CAGGGTGAGGGTTCTGTGCATGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1111173597 13:84562756-84562778 GAGGAAGAGGGGCAGGAGCAGGG - Intergenic
1111610690 13:90603210-90603232 CATGCAGATGGGCAGGTGCAGGG + Intergenic
1111999720 13:95198958-95198980 GAGGGTGAGGGGCAAGGGGAAGG + Intronic
1112648150 13:101359027-101359049 CGGGGTGAGGGGCAGGGGGAGGG + Intronic
1113176558 13:107571513-107571535 CAAGGTATGGGGCAGGGGCACGG - Intronic
1113366443 13:109681080-109681102 CAGGATGAGGGACAGGTGGCTGG - Intergenic
1113381675 13:109811164-109811186 CAGTGTGAGGGGCTGGGACAGGG - Intergenic
1113627876 13:111859621-111859643 CAGCGGGAGGGGCACATGCATGG + Intergenic
1113852397 13:113425220-113425242 CATGGAGTGGGGCGGGTGCAGGG + Intronic
1113868784 13:113545735-113545757 TTGGGTGGGGGGCAGATGCAGGG + Intronic
1114030346 14:18573031-18573053 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1114030348 14:18573037-18573059 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114493666 14:23118615-23118637 CAGAGTTGGGGGCAGGTGCATGG + Exonic
1114865984 14:26597117-26597139 CTAGGCGCGGGGCAGGTGCAGGG + Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116868721 14:50052004-50052026 CAGAGAGTGGGGCAGGTGGAAGG + Intergenic
1117715009 14:58571629-58571651 AAGGGGGAGGGAAAGGTGCAAGG - Intergenic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1117763840 14:59059702-59059724 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1119174836 14:72561527-72561549 GAGGGTGAGGGGCACGAGCGAGG - Intronic
1119406685 14:74403370-74403392 AAAGGAGAGGGGCAGGTCCAGGG + Intergenic
1119655429 14:76413886-76413908 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655480 14:76414028-76414050 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119664292 14:76473512-76473534 CAGGCTTAGGGCCAGGTGCAGGG + Intronic
1119740649 14:77011923-77011945 CAGGGTGAGAGTCAGGTGCTGGG - Intergenic
1120137830 14:80890626-80890648 CAGGGTGAGGGGCAAGCAGAGGG + Intronic
1120644173 14:87052605-87052627 CAGGGACAGGGGCAGGATCATGG + Intergenic
1121030509 14:90654674-90654696 GTGGGACAGGGGCAGGTGCAAGG + Intronic
1121137400 14:91510697-91510719 CAGGGGCAGGGGCAGAGGCAGGG - Intergenic
1121173150 14:91871004-91871026 CAGGGTGGGAGGCAGGAGGAGGG + Intronic
1121562998 14:94887995-94888017 CAGGGTGATGGGCACGTTCATGG - Intergenic
1122501335 14:102202085-102202107 GAGGGTGCAGGGCAGGTGCCTGG - Intronic
1122630956 14:103107598-103107620 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1122647650 14:103206058-103206080 CAGGCTCAAGGGCAGGTGAAGGG - Intergenic
1122651492 14:103229363-103229385 TAGGGTGTGGGGCAGGAGGAAGG - Intergenic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1122745256 14:103894049-103894071 CACGGTGAGGGCCAGGTTCTGGG + Intergenic
1122771281 14:104099025-104099047 CTGGGCGAGGGGCTGCTGCAGGG + Intronic
1122864264 14:104596436-104596458 CAGGGTGAGGGTCAGCTCCCAGG - Intronic
1122881481 14:104692392-104692414 CACGGTGCCAGGCAGGTGCAGGG + Intronic
1122893234 14:104742593-104742615 CAGGAGGAAGGGCAGGTGCTGGG + Intronic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1122986896 14:105216587-105216609 CCAGGGGAGGGGCAGGGGCAGGG + Intronic
1123053711 14:105559750-105559772 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053714 14:105559756-105559778 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053717 14:105559762-105559784 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053720 14:105559768-105559790 CACGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053723 14:105559774-105559796 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123053729 14:105559786-105559808 CAGGGGCACGGGCAGGGGCACGG - Intergenic
1123053731 14:105559792-105559814 CAGGGGCAGGGGCACGGGCAGGG - Intergenic
1123067764 14:105626993-105627015 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123071783 14:105645718-105645740 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123078289 14:105680155-105680177 CAGGGCCAGGGCCAGGGGCAGGG - Intergenic
1123078294 14:105680167-105680189 CAGGGGCAGGGGCAGGGCCAGGG - Intergenic
1123078296 14:105680173-105680195 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078299 14:105680179-105680201 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078302 14:105680185-105680207 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078305 14:105680191-105680213 CACGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078308 14:105680197-105680219 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123078311 14:105680203-105680225 CAGGGGCAGGGGCACGGGCAGGG - Intergenic
1123078314 14:105680209-105680231 CAGGGGCAGGGGCAGGGGCACGG - Intergenic
1123091447 14:105743994-105744016 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123097217 14:105772335-105772357 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123134112 14:106011779-106011801 CCGGGTCTGGAGCAGGTGCAGGG - Intergenic
1123165801 14:106324112-106324134 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123168498 14:106349140-106349162 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123171074 14:106373518-106373540 CCGGGTCCGGAGCAGGTGCAAGG - Intergenic
1123176187 14:106421566-106421588 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123194756 14:106605974-106605996 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123197041 14:106627106-106627128 CCCGGTCAGGAGCAGGTGCAGGG - Intergenic
1123198381 14:106638976-106638998 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123222815 14:106872687-106872709 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1202947497 14_KI270726v1_random:41999-42021 CCGGGTCAGGAGCAGGTGCAGGG + Intergenic
1123442917 15:20303699-20303721 CAAGGGCAAGGGCAGGTGCAGGG - Intergenic
1123443016 15:20304015-20304037 CAGGGCCAGGGTCAGGAGCAAGG - Intergenic
1123584140 15:21742223-21742245 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1123620790 15:22184826-22184848 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1124161126 15:27271224-27271246 CAGCGTGCAGGGCAAGTGCAGGG - Intronic
1125353983 15:38797616-38797638 GAGGGTGAGGGGCTGGGGGAGGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125401899 15:39312909-39312931 CAGGGTGAGGGGCTAGCGGAGGG + Intergenic
1125730883 15:41892306-41892328 CAGGGTGAGGGGCTGGTGCAGGG - Intronic
1125760869 15:42094629-42094651 GGGGAAGAGGGGCAGGTGCAGGG - Intergenic
1126760382 15:51964400-51964422 TGGGGTGAGGGGCAGGGGGAGGG + Intronic
1126919314 15:53503146-53503168 CAGGGTGCGGGGCATGGGGAGGG + Intergenic
1127775780 15:62263491-62263513 CAGAGTGGGGTGCAGGGGCAAGG - Intergenic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128358344 15:66943685-66943707 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1128568156 15:68714724-68714746 CAGGGGGTGGGGCAGGTGCAGGG - Intronic
1128877703 15:71215458-71215480 CAGCGTGCGAGGCAGGGGCAGGG - Intronic
1129236099 15:74224559-74224581 TAGGGTGAGAGGCAGGTGCATGG + Intergenic
1129244363 15:74270671-74270693 CAGGGTGAGGGTCAGGGTCCGGG + Intronic
1129273524 15:74431760-74431782 GGGGGTGGGGGGCAGGTGAATGG + Intronic
1129543339 15:76369821-76369843 CAGGCTGCGGGGCAAGGGCAGGG - Intronic
1129692229 15:77720360-77720382 CAGGCAGAGGGGCAGGTGCGTGG - Intronic
1129769436 15:78193913-78193935 CAGGGTGAGTGGCGGGGGCAGGG - Exonic
1129910103 15:79219979-79220001 TGGGGTGAAGGGCAGGGGCATGG + Intergenic
1130010984 15:80152838-80152860 CAGGGTAGGGGGGAGGGGCAGGG + Exonic
1130428553 15:83823208-83823230 GAGGGTGAGGGGGAGGGGGAGGG + Intronic
1130459819 15:84152636-84152658 CAGGCTGACGGGCAGGCGGACGG + Intergenic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130788924 15:87131120-87131142 TAGGGTCAGGGGCTGGGGCAGGG + Intergenic
1130862921 15:87907495-87907517 CAGTCTTATGGGCAGGTGCATGG - Intronic
1131108606 15:89750675-89750697 CAGGCTGAGGGGCAGGGGCAGGG - Exonic
1131112982 15:89776883-89776905 CAGGCGGAGGGGCAGGGGCAAGG + Exonic
1131112988 15:89776895-89776917 CAGGGGCAAGGGCAGGGGCAGGG + Exonic
1131112991 15:89776901-89776923 CAAGGGCAGGGGCAGGGGCAGGG + Exonic
1131112993 15:89776907-89776929 CAGGGGCAGGGGCAGGGGCAAGG + Exonic
1131112996 15:89776913-89776935 CAGGGGCAGGGGCAAGGGCAGGG + Exonic
1131112998 15:89776919-89776941 CAGGGGCAAGGGCAGGGGCAAGG + Exonic
1131296482 15:91153808-91153830 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1131352973 15:91718355-91718377 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1131432137 15:92395458-92395480 CAGGGAGATGGGCAGGGGCAGGG - Intronic
1131449444 15:92527295-92527317 CTGGGTGAGTGCCAGGTACATGG + Intergenic
1131779791 15:95843831-95843853 CAGGGTGAAGGGAAGATGGATGG - Intergenic
1131812135 15:96183681-96183703 CGGGGTCGGGGGCAGGGGCAGGG - Intergenic
1132206061 15:99987005-99987027 CAGGATGAGGGCTAGGGGCAGGG + Intronic
1132455428 16:19535-19557 CAGGGTGAGGGTCAGGGTCAGGG - Intergenic
1132455448 16:19599-19621 CAGGGTTAGGGTCAGGGTCAGGG - Intergenic
1132455454 16:19617-19639 CAGGGTTAGGGTCAGGGTCAGGG - Intergenic
1132455503 16:19765-19787 CAGGGTGAGGGTCAGGGTCAGGG - Intergenic
1132455521 16:19831-19853 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455523 16:19837-19859 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455532 16:19862-19884 CAGGGTCAGGGTCAGGGTCAAGG - Intergenic
1132676456 16:1123198-1123220 CAGGCTGTGGGGCAGGCTCAGGG + Intergenic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1132972959 16:2697813-2697835 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1133015703 16:2938464-2938486 CAGGCTGTGGGGCAGAGGCAGGG + Intronic
1133116587 16:3581062-3581084 CAAAGTAAAGGGCAGGTGCAAGG + Intergenic
1133233045 16:4375284-4375306 CTGGGAGAGGGGCAGGCACAGGG - Intronic
1133241411 16:4416396-4416418 CAGGGGGAGGGGCAGCCGGACGG + Intronic
1133246362 16:4451376-4451398 CAGGGGCAGGGGCAGGGGCTGGG + Intronic
1133586709 16:7202792-7202814 CAGGGTGGGGGGCTGTTGCAGGG - Intronic
1133738534 16:8633649-8633671 GAGGGTGAGTGGCAGATGCGGGG - Intronic
1133996491 16:10752395-10752417 CAGGCTGAGGGGTAGGGGAATGG + Intronic
1134219644 16:12343715-12343737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1135007457 16:18839334-18839356 GAGGGTGGGGGGCAGGAGGAGGG - Intronic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1135811936 16:25595690-25595712 TAGGGTGGGGGGCTGGGGCAGGG - Intergenic
1136156096 16:28383263-28383285 CAGGTTGATGTGCAGGTGGAAGG + Exonic
1136206990 16:28732025-28732047 CAGGTTGATGTGCAGGTGGAAGG - Exonic
1136289682 16:29264156-29264178 GAGGGTGCGTGGCAGGAGCATGG - Intergenic
1136289700 16:29264218-29264240 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1136289726 16:29264311-29264333 AAGGGTGAGTGGCAGGAGCAAGG - Intergenic
1136501063 16:30669863-30669885 AAGGGAGAGGGGCGTGTGCATGG + Exonic
1136580861 16:31150009-31150031 AAGGGGGAGGAGCAGGTGCCGGG + Exonic
1136841543 16:33545942-33545964 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1137433475 16:48436757-48436779 GAGGGAGAAGGGGAGGTGCAGGG + Intronic
1138694236 16:58796842-58796864 GGGGGTGAGGGGCAGGGGGATGG - Intergenic
1139358031 16:66379058-66379080 GAGGGTGAGGAGTAGGTACAAGG + Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140758508 16:78090211-78090233 CAGGGTGTGTGGCTGGTTCATGG + Intergenic
1140983339 16:80132873-80132895 AAGGGTGAGGTGGAGGTGGAAGG - Intergenic
1141049383 16:80746703-80746725 GAGGGTGTGGGGCAGGGGGAGGG + Intronic
1141356849 16:83354754-83354776 CAGGGAGATGGGCAAGGGCAAGG + Intronic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1141949326 16:87330558-87330580 GAGGGGCTGGGGCAGGTGCATGG + Exonic
1142031704 16:87841709-87841731 CCGGGGCAGGGGCAGGAGCAGGG + Intronic
1142095428 16:88237167-88237189 GAGGGTGAGTGGCAGGAGCAAGG - Intergenic
1142095453 16:88237260-88237282 GAGGGTGAGTGGCGGGAGCACGG - Intergenic
1142095463 16:88237291-88237313 GAGGGTGAGTGGCGGGAGCACGG - Intergenic
1142095473 16:88237322-88237344 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095498 16:88237415-88237437 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095507 16:88237446-88237468 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095516 16:88237477-88237499 GAGGGTGCGTGGCAGGAGCACGG - Intergenic
1142095525 16:88237508-88237530 GAGGGTGCGTGGCAGGAGCAAGG - Intergenic
1142095534 16:88237539-88237561 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095543 16:88237570-88237592 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095560 16:88237632-88237654 GAGGGTGAGTGGCAGGAGCAAGG - Intergenic
1142095569 16:88237663-88237685 GAGGGTGAGTGGCAGGAGCACGG - Intergenic
1142095586 16:88237725-88237747 GAGGGTGCGTGGCAGGAGCACGG - Intergenic
1142095595 16:88237756-88237778 GAGGGTGAGTGGCAGGAGCAAGG - Intergenic
1142095604 16:88237787-88237809 GAGGGTGAGTGGCGGGAGCAAGG - Intergenic
1142134774 16:88446654-88446676 CAGAGTGAGGAGCTGGTCCAAGG - Intergenic
1142395963 16:89831779-89831801 AAGGGGGAGGGGCAGGAGAAAGG - Intronic
1203124067 16_KI270728v1_random:1560583-1560605 CAGGGTCAGGGCCAGGGCCAGGG - Intergenic
1203151708 16_KI270728v1_random:1846239-1846261 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1142467018 17:141887-141909 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1142467020 17:141893-141915 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142610439 17:1106862-1106884 CAGAGCAAGGGGCAGGTACAGGG - Intronic
1142852332 17:2710353-2710375 TGGGGTGAGGGACAGGTGCTGGG - Intronic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1143125851 17:4640578-4640600 CATGGTGAGGGGACGGGGCACGG - Intronic
1143386698 17:6535195-6535217 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1143402627 17:6656244-6656266 CATGGTGAGGGGACGGGGCACGG + Intergenic
1143433985 17:6909079-6909101 TATGGTGAGGGGCAGGAGAACGG + Intronic
1143444353 17:6998640-6998662 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143729470 17:8872894-8872916 CAGAGTGAGAGGCACGTGCCAGG - Intergenic
1143767785 17:9149034-9149056 CAGTGGGAGAGGCTGGTGCAAGG - Intronic
1144232263 17:13219903-13219925 AAGGGTGGAGGGCAGGTGGAGGG - Intergenic
1144334272 17:14255155-14255177 CAGGCTGAGGGGTGGGTACAGGG - Intergenic
1144642227 17:16943883-16943905 CGGGCTCCGGGGCAGGTGCAGGG - Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144812062 17:18006838-18006860 CGAGGTGTGGGGCAGGGGCAGGG + Intronic
1144849865 17:18238616-18238638 CAGGGGCAGGGGCAGGGACAGGG + Intronic
1144954652 17:19013000-19013022 CAGGTTGAGGGCCTGGGGCAGGG + Intronic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145206931 17:20989596-20989618 CAGGCTTGGGGGTAGGTGCAGGG + Intergenic
1145777080 17:27536743-27536765 CAGGGTCAGGTGCATGAGCAGGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1145931620 17:28690033-28690055 CAGGTTGGGGGGCAGCTGCAAGG + Intronic
1146012779 17:29208871-29208893 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1146061089 17:29607779-29607801 CAGCGTGGTGGCCAGGTGCAGGG - Exonic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146407781 17:32554187-32554209 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146407784 17:32554193-32554215 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146407787 17:32554199-32554221 TAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146425520 17:32733710-32733732 CAGGGTGAGGGGCAGCTTTAGGG + Intronic
1146538373 17:33673136-33673158 CAGGCTCAGGTGCAGGTGCAGGG + Intronic
1146619882 17:34389062-34389084 CAGGGAGAGGGGAAGGAGCATGG + Intergenic
1146742541 17:35299147-35299169 TAGGTTGAGGAGCAGATGCAGGG - Intergenic
1147157116 17:38549590-38549612 AAGGGTGAGGGGCAGTGGGAAGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147310926 17:39595844-39595866 CTGGTGGAGGGGCAGGTGCCAGG + Intergenic
1147327634 17:39677312-39677334 GAAGTTGAGGGGCAGGTGAACGG - Intronic
1147595126 17:41712104-41712126 CATGGTGAGGGGCTGGAGCGGGG - Intergenic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1147609709 17:41794223-41794245 CAGGGGGAGGGGTGGGTGCATGG + Intergenic
1147677497 17:42218355-42218377 CATGATGAGGGGCTGGTGCAGGG + Intronic
1147923382 17:43932408-43932430 GGTGGTGAGGGGCAGGTGAAGGG - Intergenic
1147935535 17:44008590-44008612 CATGGTGAGGGTCAGCTGCCTGG - Exonic
1147964455 17:44186754-44186776 CAGGGTGAGAGGCGGGGCCAGGG - Intergenic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1147978196 17:44259774-44259796 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148060040 17:44830043-44830065 CCGGGTGAGGGGCGGCCGCAGGG - Intronic
1148341944 17:46878518-46878540 CAAGGTGTGGGCCAGGTGCTTGG - Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148614671 17:48991221-48991243 CAGGGGCAGGGGGAGGGGCAGGG + Intergenic
1148647945 17:49230083-49230105 TAGGGGCAGGGGCAGGGGCAGGG + Intronic
1148688043 17:49511793-49511815 CCGTGTGAGGGCCAGGGGCATGG - Intronic
1148693649 17:49546699-49546721 CTGGGTGAGGGCCAGTGGCAGGG - Intergenic
1148722355 17:49763454-49763476 CACGGGGAGGGGGAGGGGCATGG - Intronic
1148872879 17:50668892-50668914 CAGAGTGGGGGGCAGGTCCTGGG - Exonic
1148921462 17:51038691-51038713 CATGGGGATGTGCAGGTGCATGG - Intronic
1149084497 17:52698919-52698941 CATGGGGAGGGGCAGATGCAAGG - Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149491065 17:57085469-57085491 GAGCCTGAGGTGCAGGTGCAGGG + Intronic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1149586022 17:57787395-57787417 GAGGGAGAGGGGCAAGTCCAGGG + Intergenic
1149686111 17:58535932-58535954 CAGGATGAAGGGCAAGTGAAGGG - Intronic
1149981745 17:61316466-61316488 CTGGGTGAGGGGCATGTCCGGGG - Intronic
1150150897 17:62808223-62808245 GAGGAAGAGGGGCAGGTGTAGGG - Exonic
1150747202 17:67825670-67825692 AAGGGGGAGGGGCGGGCGCAGGG - Exonic
1151464251 17:74274342-74274364 CAGGGTAAGGGGCGGGCGCCAGG + Intronic
1151478511 17:74356696-74356718 GACGATGAGGTGCAGGTGCAGGG + Exonic
1151491292 17:74433382-74433404 CTTGGTGCGGGGCAGGGGCAGGG + Intronic
1151705138 17:75763425-75763447 CAGGGAGGGGGGCAGCTGCAGGG + Exonic
1151756959 17:76080508-76080530 CAGGGTGCGGGGCAAGGGGAAGG + Intronic
1151780092 17:76240100-76240122 GAGGGAGAGGGGCAGGGGCAGGG - Intronic
1151950796 17:77352600-77352622 CAGGGTGAAGGCCAGGTGGGGGG - Intronic
1152032636 17:77853656-77853678 CATGGTGTGAGGCAGCTGCAGGG - Intergenic
1152067719 17:78120852-78120874 AAGGCTGAGGGGCGGGTACAGGG + Intronic
1152209436 17:78995270-78995292 CCGGGTGGGAGCCAGGTGCAGGG - Intronic
1152344276 17:79742010-79742032 CAGGAGCAGGGGCAGGGGCAGGG - Exonic
1152572002 17:81125022-81125044 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1152592834 17:81222301-81222323 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1152610713 17:81313897-81313919 CAGGGTGGGGGGCCGGAGCCAGG + Exonic
1152612553 17:81322865-81322887 CAGGGTCAGGGGCTGGGTCAGGG - Intronic
1152612555 17:81322871-81322893 CAGGGTCAGGGTCAGGGGCTGGG - Intronic
1152818608 17:82424038-82424060 CAGGCTGAGGGGCACCAGCAAGG - Intronic
1152964890 18:105595-105617 CAGGGTGAGGGTGAGGGTCAGGG - Intergenic
1152964894 18:105607-105629 CAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1152964898 18:105619-105641 CAGGGTGAGGGTCAGGGTGAGGG - Intergenic
1153168298 18:2286704-2286726 GAGGGTGAAGGGTAGGTGGAGGG - Intergenic
1153748944 18:8209821-8209843 CAGGGTGAGGGGTAAGGGGAGGG + Intronic
1154176086 18:12087877-12087899 CAGGGTAAGGGTCAGGGCCAAGG - Intergenic
1154415192 18:14172389-14172411 CAGGGTCAGGGACAGGGCCATGG + Intergenic
1154415351 18:14172960-14172982 CAGGGTAAGGGTCAGGGCCAGGG + Intergenic
1154415528 18:14173637-14173659 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1154415572 18:14173783-14173805 CAGGGTCAGGGCCAGGGCCAGGG + Intergenic
1155012681 18:21796391-21796413 CAGGGTGGGGGGCAAGGGGAGGG + Intronic
1155064779 18:22258840-22258862 CAGGGTGGGCGGCAGGGGCGGGG - Intergenic
1155416512 18:25605075-25605097 AAGGGCAAGGGGCAGGTGCATGG + Intergenic
1155453453 18:25986704-25986726 GAGGGTGAGAGGAAGGTCCAAGG - Intergenic
1156401761 18:36745764-36745786 GGGGATGAGTGGCAGGTGCATGG - Intronic
1157613527 18:48974235-48974257 ATGGGTGAGAGGCAGCTGCAGGG - Intergenic
1157689425 18:49668878-49668900 CCAGGTGAGGGGCAGGTGGTAGG + Intergenic
1158119804 18:54036604-54036626 CAGGGTGAGGGGCAAAGGGAGGG - Intergenic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1158500363 18:57995489-57995511 TAGTGGGAAGGGCAGGTGCATGG + Intergenic
1159814707 18:73058778-73058800 CACGGGGAGGGGCAGGGCCATGG - Intergenic
1159887100 18:73919191-73919213 CAGGGTGAGTAGCATTTGCAAGG + Intergenic
1160333325 18:78015143-78015165 CAGGGAGAGGGGCTGGAGAAAGG - Intergenic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160613652 18:80108377-80108399 CTAGGTGAGGTTCAGGTGCAGGG + Intergenic
1160632819 18:80258495-80258517 GAGGGTGAGGGGTAGGGGTAGGG + Intergenic
1160653243 19:245789-245811 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1160691383 19:461910-461932 CTTGGGGCGGGGCAGGTGCAGGG - Intergenic
1160910543 19:1471910-1471932 CAGGGTGTGGGCCCGGAGCATGG - Exonic
1160919603 19:1513450-1513472 AGGGGTGAGGGGCAGGACCAGGG - Intronic
1160960630 19:1719130-1719152 GTGGGTGGGGGGCAGATGCAGGG - Intergenic
1161004924 19:1930292-1930314 CAGGGTGAGGGGCAGCAACGCGG - Intergenic
1161046200 19:2136216-2136238 CAGGGTGTGGTGCAGGTCCTGGG - Intronic
1161066928 19:2243274-2243296 CAGGGTGAGGGGCAGTCTCGAGG + Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161170156 19:2808462-2808484 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161170159 19:2808468-2808490 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161319427 19:3634125-3634147 CAGAGTGAGGGCCAAGTTCAGGG + Intronic
1161342931 19:3752754-3752776 CAGGGCCCGGTGCAGGTGCACGG + Intronic
1161394252 19:4037073-4037095 CAGGGAGTGTGGCAGCTGCAGGG - Intronic
1161409730 19:4110476-4110498 CCGGGGCAGGGGCAGGGGCAGGG - Intronic
1161547595 19:4891160-4891182 CAGGGACCAGGGCAGGTGCACGG + Exonic
1161982863 19:7638922-7638944 CAGTGGGAGGGGCAGTTTCAAGG - Intronic
1162552270 19:11364464-11364486 CAGGGGTAGGGGCAGGGGCAAGG - Exonic
1162730527 19:12715786-12715808 CAGTGGGAGGGGGAGGTGCTAGG - Intronic
1162966174 19:14157160-14157182 GAGGGTGAGGGGCTGCTGCCTGG + Intronic
1163018722 19:14471792-14471814 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1163225306 19:15956503-15956525 GAGGGTGAGAGGAGGGTGCAGGG - Intergenic
1163525236 19:17816916-17816938 CAGGGTTGGTGGCAGCTGCACGG + Exonic
1163668449 19:18613819-18613841 CATGGGGAGGGGCAGGAGGAGGG - Intronic
1163696370 19:18765538-18765560 CAAGGTGGGGGGCAGGTGGGAGG + Intronic
1163699876 19:18781726-18781748 CAGGATGGGGGGCAGGGGCTGGG + Exonic
1163768779 19:19178355-19178377 CAGGCTGGGGAGCAGGGGCAAGG + Intronic
1163796518 19:19341224-19341246 GAGGGAGAGGCGCAGGTGTAGGG - Intronic
1164055880 19:21621766-21621788 GAGGGTGAGGAGTAGGTACAAGG + Intergenic
1164670766 19:30070776-30070798 CAGAGGGAGTGGCAGGGGCAGGG - Intergenic
1164715932 19:30390412-30390434 CAGGGTGGCAGGCAGCTGCAGGG + Intronic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1164844211 19:31418133-31418155 CAGGTTGAGGAGCACCTGCAAGG + Intergenic
1164847063 19:31441511-31441533 CAGGGTATGGGGCAGGTGACAGG - Intergenic
1165108875 19:33489731-33489753 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
1165274435 19:34735560-34735582 GAGGGTTAAGGGCAGATGCAGGG - Intronic
1165310747 19:35028258-35028280 CAGGGTGTGGGGCAGGACCATGG - Intergenic
1165313490 19:35041684-35041706 CTGGGCGAGGGGCGGGTGAAGGG - Intronic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165343997 19:35232247-35232269 CTGGGTGAGGGTCAAGGGCAGGG + Intergenic
1165417939 19:35706340-35706362 GTAGGTGCGGGGCAGGTGCATGG + Intronic
1165758858 19:38309152-38309174 CAGGGGTGGGGGCAGGTGCATGG - Intronic
1165792910 19:38502756-38502778 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792913 19:38502762-38502784 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792916 19:38502768-38502790 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792919 19:38502774-38502796 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792922 19:38502780-38502802 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792925 19:38502786-38502808 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165843802 19:38805428-38805450 CAGGCAGAGGGGCAGGGGCTGGG - Intronic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1166299332 19:41905217-41905239 TAGGGCGAGAGGCAGGGGCAGGG - Exonic
1166301357 19:41913595-41913617 CAGGGTGAGCAGCAGGTCTAGGG - Intronic
1166363969 19:42269378-42269400 CAAGGTGAGGGGCGGGGCCAGGG + Intronic
1166768148 19:45264792-45264814 CAGGGTCAGGTGCAGCGGCAGGG - Intronic
1166806282 19:45489141-45489163 CAGGGTCAGGGTCAGGGGAAGGG + Intronic
1166872368 19:45878550-45878572 CAGGGTTAGGGGGAGGCTCAGGG - Intergenic
1166983856 19:46648593-46648615 CTGGGGGTGGAGCAGGTGCAGGG - Exonic
1167308230 19:48720954-48720976 GAGGATGAGGGGCGGGTGCGAGG + Exonic
1167327087 19:48833262-48833284 CAGGGTCAGGGGGTGGGGCAGGG + Intronic
1167429816 19:49447808-49447830 CCGGGTGAGGGGCAGGTCCTGGG - Exonic
1167509746 19:49889779-49889801 GAGGGGCAGGGGCATGTGCATGG - Exonic
1167603382 19:50467225-50467247 CGGGGAGAGGGGCTGGGGCACGG + Intronic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
1167758141 19:51426264-51426286 CAGGGTGAGGGGCAGAAGCCAGG + Intergenic
1167898161 19:52598420-52598442 CAGGGTGGGGGAGAGGGGCAGGG + Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167988467 19:53338146-53338168 CAGGGCCTGGGGCAAGTGCAAGG + Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168147671 19:54429076-54429098 CAGGGTGTGGGGTATGAGCAGGG - Intronic
1168353083 19:55687496-55687518 GGGGGTTAGGGGCATGTGCAAGG + Intronic
1168376207 19:55882001-55882023 GAGGGTGAGAGGGAGGTGCAGGG - Intergenic
1168412247 19:56147236-56147258 AAGGGAGAGGGGAAGGTGCCAGG + Intronic
1168642490 19:58039462-58039484 AAGGGTGGGTGGCCGGTGCAGGG - Intronic
1168726661 19:58586580-58586602 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726663 19:58586586-58586608 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726675 19:58586623-58586645 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1202702406 1_KI270712v1_random:174523-174545 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
925069519 2:955955-955977 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069542 2:956033-956055 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069545 2:956039-956061 TAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069548 2:956045-956067 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
925069551 2:956051-956073 CAGGGTCAGGGGTAGGGGCAGGG - Intronic
925069603 2:956195-956217 CAGGGGCAGGGGCAGTGGCAGGG - Intronic
925069627 2:956245-956267 CAGGGGGAGGCGCAGGGGCGGGG - Intronic
925069638 2:956268-956290 CAGGGGGAGGTGCAGGGGCAGGG - Intronic
925069641 2:956274-956296 CAGGCGCAGGGGGAGGTGCAGGG - Intronic
925134609 2:1517554-1517576 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134611 2:1517572-1517594 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134613 2:1517590-1517612 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134615 2:1517608-1517630 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134617 2:1517626-1517648 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134619 2:1517644-1517666 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134621 2:1517662-1517684 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134623 2:1517680-1517702 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134625 2:1517698-1517720 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925134627 2:1517716-1517738 CAAGGTGAGAGGCAGCAGCAAGG - Intronic
925209299 2:2033131-2033153 CAGGGTGAGAGGCACGGGCGAGG - Intronic
925309916 2:2875114-2875136 GAGGGGGAGGCCCAGGTGCAGGG - Intergenic
925858153 2:8150331-8150353 CACAGTGTGGGGCAGGAGCAGGG - Intergenic
926113524 2:10197066-10197088 CAGGGGTAGGGGCAGAGGCACGG - Intronic
926305800 2:11636753-11636775 CAGGGGCAAGGGCAGGGGCAGGG + Intronic
926305803 2:11636759-11636781 CAAGGGCAGGGGCAGGGGCAGGG + Intronic
926305805 2:11636765-11636787 CAGGGGCAGGGGCAGGGGCACGG + Intronic
926305807 2:11636771-11636793 CAGGGGCAGGGGCACGGGCATGG + Intronic
926305820 2:11636807-11636829 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926305859 2:11636945-11636967 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926305864 2:11636963-11636985 CAGGGACAGAGGCAGGGGCATGG + Intronic
926305879 2:11637011-11637033 CAGGGACAGAGGCAGGGGCATGG + Intronic
926305895 2:11637059-11637081 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926305899 2:11637071-11637093 CAGGGGCAGGGGCAGAGGCAGGG + Intronic
926305902 2:11637077-11637099 CAGGGGCAGAGGCAGGGGCAGGG + Intronic
926706998 2:15843995-15844017 CATGGTGAGGGGCTGGTTTATGG + Intergenic
927915446 2:26933154-26933176 CAGGGGGAGGCGCTGGTGCCAGG + Intronic
928858379 2:35827572-35827594 AAGGGGCAGGGGCAGGGGCAGGG - Intergenic
928858382 2:35827578-35827600 CAAGGTAAGGGGCAGGGGCAGGG - Intergenic
929555032 2:42920779-42920801 CAGGGTGAGGGGCCTTTGAAAGG - Intergenic
929579321 2:43071616-43071638 CAGGGTGGGGGACAGGTTTAGGG + Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
929943298 2:46351583-46351605 CAGGCTGTGGGTCAGGTGGAGGG + Intronic
930200912 2:48551440-48551462 CAAGGCCAGGGGCAGGGGCAGGG - Intronic
932334745 2:70923729-70923751 CAAGGTAAGGGGGAGGTGCGTGG + Intronic
932406159 2:71513653-71513675 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932544067 2:72688534-72688556 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932569578 2:72931538-72931560 CAGGGTGGGGGGCAGGGGCCAGG + Intronic
932621240 2:73265847-73265869 CAGGGTGAGGGTGGGCTGCATGG + Intronic
933673903 2:85036015-85036037 CAGGGGTAGGGGCAGGTGTTTGG + Intronic
933691390 2:85181874-85181896 CAAGGCCAGGGGCAGGTACAAGG + Intronic
933790401 2:85879497-85879519 CAGGGGGAGGGGCAGTTCTAGGG - Intronic
933980222 2:87543166-87543188 TAGGGTGAGGGGAGGGTGAAGGG + Intergenic
934173318 2:89557977-89557999 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
934283633 2:91632330-91632352 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
934662222 2:96149055-96149077 CCGGGTGAGAGGCAGGGCCAGGG - Intergenic
934774412 2:96928000-96928022 GAGGGAAAGGGGCAGGAGCACGG + Intronic
935574396 2:104693925-104693947 CAGGCTGAAGGGCAGTGGCATGG + Intergenic
935580333 2:104750660-104750682 CAGGACCAGGGGCAGGAGCAAGG + Intergenic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
936313604 2:111407625-111407647 TAGGGTGAGGGGAGGGTGAAGGG - Intergenic
936397585 2:112141057-112141079 CAGGGTGAGGGGCCCGGCCATGG + Intronic
936465893 2:112749917-112749939 CAGGGTGAGGGACCGTTGCTGGG - Intronic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937094072 2:119224349-119224371 CAGGGACAGGGGCAGGTGCAGGG + Intronic
937094832 2:119228621-119228643 CAGGGTGATGGGTGGGTGGAGGG + Intronic
937287961 2:120765109-120765131 CAGGGGCAGGGGGAGGTTCAGGG - Intronic
937340178 2:121086245-121086267 CAAGGTGAGGGGCAGAAGGAAGG + Intergenic
937914451 2:127092131-127092153 CAGGGCCTGGGGCAGGGGCAGGG - Intronic
938083140 2:128380870-128380892 GAGGGTGAGGGAGAGGAGCAGGG - Intergenic
938201152 2:129374130-129374152 CAGGGTGGGCAGCAGGTGCTGGG + Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938423785 2:131167245-131167267 CGGGGTGGGGGGCAAGTGGAGGG - Intronic
938429367 2:131218729-131218751 CAGGGGGAGCGGCAAGAGCAAGG + Exonic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938703330 2:133898628-133898650 CGGGGTGGGGGGTGGGTGCAGGG - Intergenic
938899670 2:135789516-135789538 AAGGGTGAAGGGCAGGTGGAAGG - Intronic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
944346106 2:198667558-198667580 CAGGGTGAGTGGAAGCTACATGG + Intergenic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
946178330 2:217935433-217935455 CAGGGTGAGGGGTGGGGGCTGGG - Intronic
946188019 2:217992166-217992188 CAGGGTGAGTGCCTGGGGCAGGG - Intronic
946192533 2:218015166-218015188 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
946324974 2:218980590-218980612 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946324997 2:218980660-218980682 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946332297 2:219017329-219017351 GAGGGAGTGGGGCAGCTGCATGG + Intronic
946364988 2:219243520-219243542 CAGGCTGAGCGGCAGCAGCAGGG + Exonic
946414934 2:219535197-219535219 CAGGGGGTGGGGCAGAAGCACGG - Exonic
946737598 2:222770075-222770097 CAGGGAGAAGGGCTGGAGCAGGG - Intergenic
946862743 2:224015328-224015350 CAGGGTGAGAGGCAGTGGCCAGG + Intronic
947022338 2:225693715-225693737 CAAGGTGATTGGGAGGTGCATGG - Intergenic
947332757 2:229047282-229047304 CAGGGTGGGGGCCAGATGGAAGG - Intronic
947392821 2:229656436-229656458 CAAGGTGAGGGGCAGACACATGG + Intronic
947550389 2:231041432-231041454 CATCCTGAGGGCCAGGTGCATGG + Intronic
947590838 2:231384244-231384266 CAGGGGCAGGGGCAGGGCCAGGG - Intergenic
947590840 2:231384250-231384272 GAGGGGCAGGGGCAGGGGCAGGG - Intergenic
947716591 2:232342809-232342831 CAGGGTGAGGGGCCAGTCCCTGG + Intronic
947752587 2:232540576-232540598 CAGGGGGAGGGGCAGTTGCTAGG - Intronic
947795721 2:232892852-232892874 CAGGGGCAGGGGGAGGTGCCCGG - Intronic
947964735 2:234269918-234269940 AAGGGTGAGGGGCAGGAACGAGG + Intergenic
948100819 2:235371292-235371314 CAGGTGCACGGGCAGGTGCATGG - Intergenic
948593708 2:239066569-239066591 GGGGGTGGGGGGCAGGTGCAAGG + Intronic
948673414 2:239583307-239583329 CAGGTCCAGGGGAAGGTGCAGGG - Exonic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
949089092 2:242183401-242183423 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
949089094 2:242183407-242183429 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168771575 20:419865-419887 CAGGGTCACAGCCAGGTGCAGGG - Intronic
1168998708 20:2151086-2151108 CAGGCTGAGGGGCTGTGGCATGG - Intronic
1169347233 20:4838474-4838496 CAGGGTGTGGGGCTGGGGAAAGG - Intergenic
1169459310 20:5780659-5780681 CATGGTCAGGGGCAGCTGCAAGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169910923 20:10646871-10646893 CAGGGGCAGAGGCAGGGGCAGGG + Intronic
1170518163 20:17153421-17153443 CAGGGTCAGTGGCAGGTCCACGG + Intergenic
1170657748 20:18305607-18305629 CAGGGTGAGGGGCAGGGATAAGG - Intronic
1170731608 20:18980871-18980893 GAGGGTGAGGGGCAAGGGGAGGG - Intergenic
1170842361 20:19934413-19934435 AAGGGTCAGATGCAGGTGCATGG + Intronic
1170955881 20:20978982-20979004 CAGGGAGTGGGGCAGGGGCTGGG + Intergenic
1171266175 20:23773748-23773770 AAGTGTGTGGGGGAGGTGCATGG - Intergenic
1171321558 20:24248843-24248865 CAGGGAGAGGGACATGTGCCTGG - Intergenic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172379434 20:34475697-34475719 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172379437 20:34475703-34475725 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172766619 20:37354583-37354605 CAGGGGCAGGGGCAGGGGCCGGG + Intronic
1172845168 20:37925821-37925843 CAGGGAGAGAAGCAGGTTCAAGG - Intronic
1173444550 20:43106004-43106026 GGGGGTGAGGGGCAGGTGCCTGG + Intronic
1173575645 20:44111642-44111664 CAGGATGAGGGGCTGGCTCAAGG - Intergenic
1173897983 20:46565463-46565485 CAGGCTTAGTGGCAGGTGCCTGG - Intronic
1174258710 20:49277990-49278012 CAGGGGCAGGGGCAGTTGCGGGG + Intronic
1174275234 20:49398839-49398861 GAGGGTGAGAGAGAGGTGCAGGG - Intronic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175360338 20:58405252-58405274 CAGATGGAAGGGCAGGTGCAAGG + Intronic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175795406 20:61767511-61767533 CAGAGAGAGGGGCAGGAGCAGGG + Intronic
1175819544 20:61901222-61901244 TAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175819547 20:61901228-61901250 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175819550 20:61901234-61901256 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175894094 20:62328442-62328464 CAGGCTGTGGGGCGGGTACAGGG + Exonic
1176113534 20:63421451-63421473 CAGGGGGAGGTGCAGCTGCACGG - Intronic
1176120612 20:63452955-63452977 CAGGCTGAGGGGAGGGTCCAGGG + Intronic
1176235661 20:64052402-64052424 GAGGGAGAGGGGCAGGTGGCAGG - Intronic
1176278310 20:64286833-64286855 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278312 20:64286839-64286861 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278322 20:64286870-64286892 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278324 20:64286876-64286898 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176301567 21:5101361-5101383 CAGGGGCAGGGACAGGGGCAGGG + Intergenic
1176301651 21:5101604-5101626 CAGGGAGAGGGGCAGGGACGTGG + Intergenic
1176301669 21:5101649-5101671 CAGGGGCAGGGACAGGGGCAGGG + Intergenic
1176301670 21:5101655-5101677 CAGGGACAGGGGCAGGGACACGG + Intergenic
1176379198 21:6103361-6103383 CAGGGGCAGGGGCAGCAGCAGGG + Intergenic
1176379212 21:6103397-6103419 CAGCGGCAGGGGCAGGGGCAGGG + Intergenic
1176379215 21:6103403-6103425 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1176379218 21:6103415-6103437 CAGGGGCAGGGGCAGCAGCAGGG + Intergenic
1176379224 21:6103433-6103455 CAGGGGCAGGGGCAGCGGCACGG + Intergenic
1176734166 21:10527746-10527768 AAGGGTGAGGGACAGATACAGGG - Intronic
1176857792 21:13985631-13985653 CTGGGTCAGGGCCAGGAGCAAGG - Intergenic
1176857969 21:13986304-13986326 CAGGGTAAGGGTCAGGGCCAGGG - Intergenic
1176866621 21:14057880-14057902 CAGGGTAAGGGTCAGGGCCAGGG + Intergenic
1176866798 21:14058558-14058580 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1178102216 21:29281930-29281952 CAGGCAGAAGGGCATGTGCAGGG + Intronic
1178567808 21:33704373-33704395 CAGGGTGAAGCGTGGGTGCAGGG - Intronic
1178618563 21:34154499-34154521 CAGCGTGAGGGTCATCTGCAAGG - Intergenic
1178766858 21:35462192-35462214 CAGGGTGAGGTTAAGTTGCAGGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179576787 21:42312976-42312998 CGTGGTGGAGGGCAGGTGCAGGG - Intronic
1179744249 21:43434804-43434826 CAGGGGCAGGGGCAGCGGCACGG - Intergenic
1179744255 21:43434822-43434844 CAGGGGCAGGGGCAGCAGCAGGG - Intergenic
1179744258 21:43434834-43434856 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1179744261 21:43434840-43434862 CAGCGGCAGGGGCAGGGGCAGGG - Intergenic
1179744275 21:43434876-43434898 CAGGGGCAGGGGCAGCAGCAGGG - Intergenic
1179855361 21:44160244-44160266 CAGGGACAGGGGCAGGGACACGG - Intergenic
1179855362 21:44160250-44160272 CAGGGGCAGGGACAGGGGCAGGG - Intergenic
1179855380 21:44160295-44160317 CAGGGAGAGGGGCAGGGACGTGG - Intergenic
1179855464 21:44160538-44160560 CAGGGGCAGGGACAGGGGCAGGG - Intergenic
1179885642 21:44313210-44313232 CAGGGTGACGGCCATCTGCAAGG + Intronic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180002552 21:45001936-45001958 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1180042329 21:45287193-45287215 CAGGGGCAGGGGCAGGGGCCGGG - Intronic
1180042332 21:45287199-45287221 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1180184859 21:46134467-46134489 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184874 21:46134515-46134537 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184885 21:46134551-46134573 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184890 21:46134569-46134591 TAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184899 21:46134599-46134621 CAGGGTCAGGGTCAGGTTTAGGG + Intergenic
1180184914 21:46134647-46134669 GAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184923 21:46134677-46134699 CAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180184929 21:46134695-46134717 TAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1180184933 21:46134707-46134729 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180454461 22:15500088-15500110 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180454463 22:15500094-15500116 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180799313 22:18624416-18624438 CAGAGTGAGTGGGAGCTGCAGGG - Intergenic
1180844225 22:18972692-18972714 CTGGCAGAGGGGCACGTGCAGGG + Intergenic
1180872518 22:19154612-19154634 GAGGGTGAGGGGGAGGTGAGGGG - Intergenic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181042637 22:20199502-20199524 CAGGTGGATGGGCAGGTGGATGG - Intergenic
1181057247 22:20266019-20266041 CTGGCAGAGGGGCACGTGCAGGG - Intronic
1181086152 22:20440357-20440379 GAGGGTGAGGCGCAAGAGCATGG - Intronic
1181222405 22:21370850-21370872 CAGAGTGAGTGGGAGCTGCAGGG + Intergenic
1181355221 22:22292898-22292920 CAGGGCCAGGGGCAGGGCCAGGG + Intergenic
1181355225 22:22292904-22292926 CAGGGGCAGGGCCAGGGGCAGGG + Intergenic
1181355226 22:22292910-22292932 CAGGGCCAGGGGCAGGGCCACGG + Intergenic
1181466444 22:23113083-23113105 CAGGGTCAGCCGCAGGGGCAGGG - Intronic
1181546290 22:23604336-23604358 GAGGATGAGTGACAGGTGCAGGG - Intergenic
1181638165 22:24183836-24183858 CAGAGTGAGTGGGAGCTGCAGGG + Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182226103 22:28800225-28800247 CAGGGGCAGGGGCAGGGGCTGGG - Intronic
1182226106 22:28800231-28800253 TAGGGACAGGGGCAGGGGCAGGG - Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182482657 22:30619455-30619477 CAGGGTGAGAAGCAAGTGTAAGG - Intronic
1182671583 22:32000628-32000650 CAGGGTGGGGGGCCAGTGAATGG + Intergenic
1183049689 22:35250734-35250756 AAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1183105149 22:35610219-35610241 CAGGGTTGGGGGCAGGAGCCTGG - Intronic
1183211629 22:36455014-36455036 CACGATGAGGAGCAGGTGCGCGG + Intergenic
1183268245 22:36844231-36844253 CAGGGTGAGGGACCAGTGCTGGG - Intergenic
1183311496 22:37112269-37112291 CAGGGTCAGGGTCAGGCCCATGG - Intergenic
1183476753 22:38039762-38039784 CGGGGTGGCGGGCAGGGGCAGGG + Intronic
1183629562 22:39025047-39025069 CTGGGAGAGGAGCAGGGGCAGGG - Intronic
1183668716 22:39259609-39259631 CAGGGTGGGTGGGAGGTGCGTGG + Intergenic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1183982664 22:41551133-41551155 CGGGGTGAGGGGCAGTGGGAGGG + Intergenic
1183991053 22:41597246-41597268 CAGGGTGTGGGGTAGGACCAGGG + Intergenic
1184402549 22:44282282-44282304 CAGGGTGGGAGCCAGGGGCAGGG + Intronic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184823785 22:46933297-46933319 CAAGGTGAGGTGCAGGTCCTGGG + Intronic
1184865484 22:47199703-47199725 CGGGGTGAGGGCCGGGGGCAGGG - Intergenic
1184924921 22:47630147-47630169 GAGGATGAGGGGCAGGCTCATGG + Intergenic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185143543 22:49117170-49117192 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143546 22:49117176-49117198 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143549 22:49117182-49117204 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143551 22:49117188-49117210 CAGGGGCAGGGGCAGGGCCAGGG + Intergenic
1185143557 22:49117200-49117222 CAGGGCCAGGGGTAGGGGCAGGG + Intergenic
1185143561 22:49117206-49117228 CAGGGGTAGGGGCAGGGGCTGGG + Intergenic
1185285429 22:49997789-49997811 CAGGGGCAGGGACAGGGGCAGGG + Intronic
1185285431 22:49997795-49997817 CAGGGACAGGGGCAGGGACAGGG + Intronic
1185288119 22:50011295-50011317 CAAGGAAAGGGGCAGGGGCAAGG - Intronic
1185329949 22:50248001-50248023 GAGGGTGCGGGGCAGAGGCACGG + Exonic
1185384273 22:50524665-50524687 CTTGCTGAGGTGCAGGTGCAGGG - Intronic
949089242 3:10340-10362 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
949089244 3:10346-10368 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
949421824 3:3873832-3873854 TAGGGTCAAGGGCAGGAGCAAGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950442932 3:13020243-13020265 CGGGGTCTGGGGCAGGGGCAGGG + Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950785109 3:15427755-15427777 CTGGGTGCGAGGCAGGTGCGGGG + Exonic
952111433 3:30128223-30128245 CGGGGTGAGGGGCAAGGGAAGGG + Intergenic
952680184 3:36082919-36082941 CAGGGTGAGGCGATAGTGCAAGG + Intergenic
952851304 3:37732201-37732223 CAGGGTGTGGGGAGGGTACAAGG - Intronic
953389404 3:42525864-42525886 CTGGGTGGAGGGCAGGGGCAAGG - Intronic
953464297 3:43105702-43105724 CGGGGTGAGGGGGAGGTTCTAGG - Intronic
953471925 3:43174987-43175009 TGGGGGTAGGGGCAGGTGCATGG + Intergenic
954042657 3:47901027-47901049 CATAGTGAAGTGCAGGTGCATGG - Intronic
954325484 3:49861152-49861174 CAGGGGGTGGGGCAGGGGCAGGG - Intronic
954411948 3:50374682-50374704 CAGGGTGCGGGGCAGAGGCAGGG + Intronic
954439822 3:50515795-50515817 CAGGGACAGGGGCAGCAGCAGGG - Intergenic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
954623187 3:52007223-52007245 CAAGGTGGGGTGCAGGGGCATGG + Intergenic
954777251 3:53031008-53031030 CATGATGCGGGGCAGGGGCAAGG + Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
954847871 3:53575375-53575397 CAGGGTGTGGGGTGGGGGCATGG + Intronic
954991897 3:54848534-54848556 CAGGGTGAGAGACAGATGAATGG - Intronic
955141817 3:56277304-56277326 CAGGGACAGGGGGAGGTGAAGGG + Intronic
955698380 3:61659043-61659065 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
956145477 3:66187168-66187190 CATGGTGAGGGTCAGGGTCAAGG - Intronic
956145721 3:66188902-66188924 TAGGGTGAGGGTCAGGTTCAAGG - Intronic
956146872 3:66199221-66199243 TAGGGTGAGAGTCAGGTTCAGGG - Intronic
956776321 3:72568352-72568374 CAGCGTGAGGAGCAGGTGAGGGG + Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
957456713 3:80460462-80460484 GAGAGTCAGGGGCAGGTGCCAGG - Intergenic
957458504 3:80486202-80486224 CAGGGGCAGAGGCAGGTGTATGG - Intergenic
958048828 3:88319146-88319168 CAGGTTGAGGGGCAGGGGAGAGG - Intergenic
958078217 3:88711819-88711841 CAGGGTGAGGGGGAGGTAATTGG - Intergenic
959784102 3:110272679-110272701 CAGGGTGTGGGGCAGGAAGAGGG - Intergenic
959843426 3:111004588-111004610 GCGGGTGAGGGGCAAGGGCAGGG + Intergenic
960158753 3:114325988-114326010 CTGGGGTTGGGGCAGGTGCAGGG + Intergenic
960847131 3:122014859-122014881 CTGGTTGAGGGGCAGATGCTTGG + Intronic
961012762 3:123447448-123447470 CAGGGCGATGGCCAGGTGGAGGG + Exonic
961205425 3:125077577-125077599 TAGGGAGAGGGGCAGGTTCCTGG - Intergenic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
961336974 3:126186487-126186509 CAGGGTCAGGGTCAGGTTCAGGG - Intronic
961336977 3:126186499-126186521 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
961442309 3:126960302-126960324 CAGGCTCAGGGGCATATGCAGGG - Exonic
961454424 3:127017115-127017137 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
961484321 3:127206722-127206744 CAGGGACAGGGGTAGGGGCAGGG + Intergenic
961484334 3:127206758-127206780 CAGGGTCAGAGGCAGGGCCAGGG + Intergenic
961484339 3:127206770-127206792 CAGGGCCAGGGCCAGGGGCAGGG + Intergenic
961484343 3:127206776-127206798 CAGGGCCAGGGGCAGGGGCAGGG + Intergenic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
961823870 3:129588711-129588733 CTGGGTTGGGGGCAGGTCCAGGG + Intronic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
962362309 3:134752686-134752708 AAGGGAGAGGTACAGGTGCACGG + Intronic
963338126 3:144000927-144000949 CAGGGTGAGGAGCAGTAGCAAGG + Intronic
963942412 3:151108234-151108256 TGGGGTGAGGGGCAGGTGGTGGG + Intronic
964777343 3:160292756-160292778 CAGGGAGAGGGGGAGGAGAAAGG + Intronic
964790873 3:160452583-160452605 CAGGGGGCTGGGCAGGGGCAGGG - Intronic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
966185217 3:177221050-177221072 AAGGGGGAAGGCCAGGTGCAGGG - Intergenic
966373122 3:179268887-179268909 CAGTGTGAGTTGCAGGAGCATGG + Intergenic
966425494 3:179775852-179775874 GAGGGAGAGGCGCAGGTGGAGGG - Intronic
966711802 3:182980117-182980139 CCGGCAGAGGGGCAGGGGCAAGG + Intronic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
966923541 3:184629875-184629897 CAGGGGGAGGAGGAGGTGAAAGG + Intronic
966995562 3:185276674-185276696 CAGGGTGAGGGTCAAGTAGATGG + Intronic
967119221 3:186367821-186367843 GACAGGGAGGGGCAGGTGCAAGG - Intergenic
967151656 3:186656382-186656404 GAGCGTGAGGGGCAGATGTAGGG + Intergenic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967178851 3:186885581-186885603 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967178854 3:186885587-186885609 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967455941 3:189686709-189686731 GGGGGTGGGGGGCAGGGGCAGGG + Intronic
967491846 3:190101133-190101155 CAGGGAGAGAGACAGGTGAATGG - Intronic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967884585 3:194324378-194324400 CAGGGTGAGTCGCTGCTGCATGG - Intergenic
967983327 3:195078325-195078347 CAGTGTGAGGGACAGGTGGCCGG - Intronic
968085772 3:195873269-195873291 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
968129535 3:196184844-196184866 CTTGGACAGGGGCAGGTGCAGGG - Intergenic
968298640 3:197596522-197596544 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
968538295 4:1148910-1148932 CAGGGGCAGGGGCAGGCCCAGGG + Intergenic
968562986 4:1294808-1294830 CGGGGGCAGGGGCAGGGGCAGGG + Intronic
968562990 4:1294814-1294836 CAGGGGCAGGGGCAGGGGCGGGG + Intronic
968616942 4:1581300-1581322 CAGGGTGAGGGGCGGGGCCTGGG - Intergenic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
968651254 4:1761134-1761156 GCGGGGGAGGGGCAGCTGCATGG - Intergenic
968704103 4:2070034-2070056 CAAGGGCAGGGGCAGGGGCAGGG + Intergenic
968877860 4:3283636-3283658 CAGGGCAAGAGTCAGGTGCAGGG + Intergenic
968943305 4:3650618-3650640 CAGAGAGAAGGGCAGGTGCCAGG - Intergenic
968948646 4:3678943-3678965 CAAGGTGAGGAGCAGGTACTTGG - Intergenic
968961120 4:3744186-3744208 GAGGGTGCCGGGCAGGTGCCTGG + Intergenic
969271441 4:6105996-6106018 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
969271443 4:6106002-6106024 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
969271445 4:6106008-6106030 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
969313083 4:6365542-6365564 CAGGGTCAGTGGCAGAGGCAGGG + Intronic
969549980 4:7859046-7859068 CCGTGTTAGGGGCATGTGCACGG - Intronic
969626085 4:8306484-8306506 CAGTAGGAGGGGCAGGAGCAGGG - Exonic
969827170 4:9766787-9766809 CAGAGTGAGGGGCGGATGCAGGG + Intergenic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
971653891 4:29316959-29316981 TGGGGTGAGGGGCAGGGGGAGGG - Intergenic
971863725 4:32141808-32141830 GAGGGTGAGGAGTAGGTACAAGG - Intergenic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
972284049 4:37631323-37631345 CAGGGTGAGGAGAAGGTACTTGG - Intronic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
973007434 4:45030125-45030147 AAGGGTGAGAAGTAGGTGCAAGG + Intergenic
973237101 4:47917184-47917206 CAGGGTGGGGGGCTGGTGGAGGG - Intronic
973250883 4:48058710-48058732 CAGGGTGTGTGGTATGTGCAAGG - Intergenic
973610865 4:52634990-52635012 CAGGGTGATGGCCAGATCCAGGG - Intronic
974456154 4:62131228-62131250 AAGGGTGAGGGTCACGAGCAGGG - Intergenic
974539908 4:63220104-63220126 CAGGATGAGGGCCAGGGCCAAGG + Intergenic
974626544 4:64433323-64433345 GAGGGGGAGGGGCAGGAGCTTGG + Intergenic
974640389 4:64623330-64623352 GAGGGTGAGGGATAGGTACAAGG - Intergenic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976475889 4:85482535-85482557 AAGGGGGAGGGGCAGAAGCAAGG + Intronic
977033881 4:91924823-91924845 GAAGCTGAGGGGCAGGTGGAGGG + Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977997960 4:103517621-103517643 AAGGGGGAGGGGCAGGGGAAGGG - Intergenic
978264717 4:106810151-106810173 CAGGGCAAGGGGCTGGTGAAAGG - Intergenic
979180972 4:117726617-117726639 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
979765756 4:124462827-124462849 CAGGGTGAGGGGCTGGGCCTCGG + Intergenic
981782137 4:148442422-148442444 CAGGGGCAGGGGCAGGGCCAGGG + Exonic
982136527 4:152278693-152278715 CAGGGTGGGAGGCAGGGGCTGGG - Intergenic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
984873155 4:184345121-184345143 CAGAGGTAGGGGCAGATGCAGGG + Intergenic
984883512 4:184430242-184430264 CAGGGTGAGGCCCAGGGGCTGGG - Intronic
984976614 4:185236118-185236140 GAGGGTGAGAAGTAGGTGCAAGG - Intronic
985462850 4:190122533-190122555 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462852 4:190122539-190122561 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462855 4:190122545-190122567 CAGGGTCAGGGTCAGGGGTAGGG + Intergenic
985462881 4:190122621-190122643 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462883 4:190122627-190122649 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462885 4:190122633-190122655 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471417 5:49544-49566 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
985471443 5:49634-49656 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
985471460 5:49691-49713 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
985471472 5:49736-49758 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471474 5:49742-49764 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471480 5:49760-49782 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985511860 5:317972-317994 CAGGGTTGGGGGGAGATGCAGGG - Intronic
985511935 5:318171-318193 CAGGGTTGGGGGGAGATGCAGGG - Intronic
985511956 5:318223-318245 CAGGGTTGGGGGGAGATGCAGGG - Intronic
985511978 5:318275-318297 CAGGGTTGGGGGGAGATGCAGGG - Intronic
985522960 5:387557-387579 CAGGGTGAAAGGCAGGTGGAGGG - Intronic
985539067 5:479437-479459 CAGGCAGAGGGGCAGCAGCAGGG - Intronic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
985729472 5:1539272-1539294 GAGGGTGAGAGGCAGAGGCAGGG - Intergenic
985790835 5:1926237-1926259 CAGGGGCTGGGGCAGGCGCACGG - Intergenic
985790856 5:1926297-1926319 CAGGGGAAGGGGCAGGCACAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
985790928 5:1926495-1926517 GCGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790941 5:1926530-1926552 CAGGCGCAGGGGCAAGTGCAGGG - Intergenic
985790950 5:1926559-1926581 GCGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790963 5:1926594-1926616 CAGGCGCAGGGGCAAGTGCAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
986442272 5:7792868-7792890 CAGGCTGAGGGACATCTGCATGG + Intronic
986604134 5:9504684-9504706 GAGGCTGAAGGACAGGTGCAAGG + Intronic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
988894327 5:35655639-35655661 CAGGGTTAGGGGCAGTTTCCAGG + Intronic
989480454 5:41925156-41925178 CAGGGTTAGGCCCAGGGGCAAGG - Intergenic
991941578 5:71858120-71858142 CAGGATGTGGAGCAGGGGCAGGG - Intergenic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992167907 5:74073206-74073228 CAGAGTGTGGGTCAGGGGCAGGG + Intergenic
992492431 5:77258376-77258398 CAGGGAGATAGGCAGGGGCAGGG + Intronic
994305527 5:98199276-98199298 CAGGGTGGGGGGCAGGGGTGGGG + Intergenic
996831412 5:127744233-127744255 CAGGGTGAGGGGCTGAGGCATGG + Intergenic
997114987 5:131117002-131117024 CAGGGTGGGGGGCTGGGGGAGGG - Intergenic
997435874 5:133874887-133874909 AAGGGAGAGGGCCGGGTGCAGGG - Intergenic
997569317 5:134913936-134913958 CAAGGTGGGGGGCAGGGGTATGG + Intronic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
998104176 5:139457710-139457732 ATGGGTGTGGGGCAGGAGCAGGG + Intronic
998216759 5:140243343-140243365 CAGGCTGTGAGGCAGGTGGATGG - Exonic
999061570 5:148641127-148641149 TAGGGTGAGGGGGATGTGGAAGG + Intronic
999203884 5:149834806-149834828 CAGGGTGTGGGGCCGGGGCCAGG - Intronic
999204463 5:149837973-149837995 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
999433035 5:151540343-151540365 GAGAGTGAGGGGCAGGAGAAAGG - Intronic
999433044 5:151540387-151540409 GAGAGTGAGGGGCAGGAGAAGGG - Intronic
999433054 5:151540431-151540453 GAGAGTGAGGGGCAGGAGAAGGG - Intronic
999657956 5:153828966-153828988 CAGGAGGAGGGGCAAGTGCAAGG - Intergenic
1000123066 5:158216432-158216454 CAGGGAGAGGGGCAAGGGGAGGG - Intergenic
1001192635 5:169644787-169644809 CAGGGGGTGGGGGAGTTGCAAGG - Intronic
1001290644 5:170456309-170456331 GAGGGTGGGGGGCAAGTGGAGGG + Intronic
1001387593 5:171352834-171352856 CAGGGTTAGGGCCAGGGTCAGGG + Intergenic
1001387598 5:171352846-171352868 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1001483978 5:172106601-172106623 AGTGGTGAGGGGCAGGGGCAGGG - Exonic
1001574226 5:172751420-172751442 CAGGGTGAGGGGCCAGGGCTAGG + Intergenic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001793331 5:174480296-174480318 CAGGCTGTGAGGCAGGTGGATGG - Intergenic
1002000682 5:176194860-176194882 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1002000687 5:176194872-176194894 CAGGGGCAGGGGCAGGAGCGGGG + Intergenic
1002089786 5:176797767-176797789 CAGGGTCTGGCTCAGGTGCAGGG - Intergenic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1002253655 5:177944115-177944137 CAGGGGCAGGGGCAGGAGCGGGG - Intergenic
1002398415 5:178976092-178976114 CAGGCGGAGTGGCAAGTGCAAGG - Intergenic
1002432839 5:179213087-179213109 CAGGGACAGGGGCCGGGGCAGGG + Intronic
1002445689 5:179288534-179288556 CCGGGGGAGGGGCGGGGGCAGGG + Intronic
1002619116 5:180474585-180474607 CAAGGTGTGGGGCAGGGGCTGGG - Intergenic
1002803268 6:547247-547269 CAAGGTGAGGAACAGGTGAAGGG + Intronic
1003526254 6:6900066-6900088 AGGGGTGCGGGGCAGGGGCAGGG + Intergenic
1003625790 6:7740126-7740148 CAGGATGATGGGCAGGTACCAGG + Intronic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004235805 6:13873628-13873650 CAGGGTGATGGGCAGGGACTTGG + Intergenic
1004571554 6:16850558-16850580 GAGGGTGGGGGGCAGATGGAGGG - Intergenic
1005331249 6:24752762-24752784 CAGGGTTAGGGGAACCTGCAAGG + Intergenic
1005388918 6:25313560-25313582 GAGGATGAGGGGCAGGGCCAGGG + Intronic
1005481212 6:26257280-26257302 GAGGGTAAGGAGCAAGTGCAAGG + Intergenic
1005481593 6:26260136-26260158 GAGGGTGAGGAGTATGTGCAAGG + Intergenic
1005710697 6:28501532-28501554 GAGGGGGAGGGGGAGGTGGAGGG - Intergenic
1006173890 6:32110275-32110297 CAGGGTGGGGGGCTGGTGCCTGG + Intronic
1006178282 6:32137151-32137173 CAGGGTGAGGGGTAAGGGAATGG + Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1007077725 6:39078533-39078555 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077728 6:39078539-39078561 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077731 6:39078545-39078567 CTGGGACAGGGGCAGGGGCAGGG - Intronic
1007085656 6:39142883-39142905 CAGGATGATGGACAGGGGCAGGG + Intergenic
1007087234 6:39157306-39157328 CAGGGTGAGTGGCAGGGTGAAGG - Intergenic
1007117322 6:39352012-39352034 CATGGAGTGGGCCAGGTGCAGGG + Intronic
1007250353 6:40490952-40490974 TAAGGTGAGGGGTATGTGCATGG + Intronic
1007511551 6:42378123-42378145 CAGGTTGAGGGGCAGGTGAGGGG + Intronic
1007652722 6:43433194-43433216 GAGGGTGATGGCCAGTTGCAGGG - Exonic
1007722373 6:43892644-43892666 CAGGGTGAGGAGCAAATGCTAGG - Intergenic
1007744369 6:44034467-44034489 CAGGGAGAGAGGCAGGGGAAGGG + Intergenic
1007765891 6:44159485-44159507 CAGGCTGAGGGTGAGGTACAGGG - Intronic
1008149458 6:47932731-47932753 CAGTGTGAGGGTCAGGAGCACGG + Intronic
1008377780 6:50810769-50810791 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377783 6:50810775-50810797 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377786 6:50810781-50810803 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008421747 6:51309016-51309038 CAGAGTGAGGGGCATGGGCCAGG - Intergenic
1008786544 6:55175076-55175098 CAGGGAGAGGGGCCGCGGCAGGG + Intronic
1009634748 6:66250832-66250854 TAGGGTGGGGGGCAGGGGGAGGG + Intergenic
1010537940 6:77053873-77053895 AGGGGTGAGGGGCGGGGGCAGGG + Intergenic
1012214074 6:96560138-96560160 TAGGGTGAGGGGCTGGGGGAGGG + Intergenic
1012544765 6:100405825-100405847 CAGGGTGATGTGCAGCTGGAAGG + Intronic
1013074005 6:106754532-106754554 CATGGTGGGGAGCAGGTGCCTGG + Intergenic
1013117966 6:107116242-107116264 TAGGGGGAGGGGGAGGTGCTGGG + Intergenic
1013163634 6:107569986-107570008 CATTGTGAAGGGCAGGTGTAGGG + Intronic
1013204372 6:107933674-107933696 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013204375 6:107933680-107933702 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013575953 6:111483457-111483479 CTGGGTGAGGGGCAGCGGAAGGG + Intronic
1013626598 6:111943857-111943879 CAGGGAGTGGGGCAGGGGAAAGG - Intergenic
1013799979 6:113931578-113931600 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1014237036 6:118969788-118969810 CGGGGTGGGGGGCAGGGGGAGGG - Intronic
1015270219 6:131330225-131330247 GAGGATGAGGGGCAGATGCAGGG + Intergenic
1015543049 6:134335061-134335083 CAGGCTGAAGGGCAGTGGCATGG + Intergenic
1015911720 6:138175198-138175220 CAGGGAGGGAGGCAGGTCCAGGG + Intronic
1016039005 6:139412487-139412509 TGGGGTGAGGGGCAGGGGGAGGG + Intergenic
1016502211 6:144734466-144734488 CAGGGTGACGGGAGGGGGCAGGG - Intronic
1016929646 6:149391546-149391568 CAGGGACAGGGGCAGGGGCAGGG + Intronic
1017163097 6:151383785-151383807 GAGGGGCAGGGGCAGGGGCAGGG - Intronic
1018160894 6:161041374-161041396 CAGGGTTAGGGGAAGGACCAGGG - Intronic
1018524459 6:164692961-164692983 CAGTGAGAGGGGCAGCTGAACGG - Intergenic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1018847463 6:167565576-167565598 CAGGATGAGGGGCAGGCGGGTGG - Intergenic
1018893437 6:167997593-167997615 AAGGGGCAGGGGCAGGGGCAGGG - Intronic
1019110019 6:169702221-169702243 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1019515181 7:1436723-1436745 TCCGGTGAGGGGCAGGTGCCGGG - Exonic
1020132906 7:5569715-5569737 CAGGGAGGGTGGCAGGAGCATGG + Intergenic
1020275351 7:6621037-6621059 CAGGGTAAGGGGCAGGTCCTGGG + Intronic
1020353223 7:7246667-7246689 TAGGGGCAGGGGCAGGGGCAGGG + Exonic
1020667727 7:11068784-11068806 CAGGGAAAGGGGCTGGGGCAGGG + Intronic
1020804357 7:12770192-12770214 CATGGTGATGGGAAGGGGCATGG - Intergenic
1021440033 7:20667673-20667695 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440036 7:20667679-20667701 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440039 7:20667685-20667707 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440042 7:20667691-20667713 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440045 7:20667697-20667719 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440048 7:20667703-20667725 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440051 7:20667709-20667731 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021451016 7:20784261-20784283 CGGGGAGAGGGGCGGGCGCAGGG + Intronic
1022033928 7:26516597-26516619 GAGGGGGAAGGGCAGATGCAAGG - Intergenic
1023156440 7:37256709-37256731 AAGGGAGAGGGGCAGGGGGAAGG + Intronic
1023645405 7:42307650-42307672 CATGGTGGTGTGCAGGTGCAAGG - Intergenic
1023773600 7:43583019-43583041 CAGGGTGCAGGGCAGGCGCGGGG + Intronic
1024096240 7:45985055-45985077 CAGGGAGAGGGCCGGGAGCAGGG - Intergenic
1024220317 7:47281918-47281940 CAGGGTCAGGGTCAGGGGCATGG - Intronic
1024220319 7:47281924-47281946 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1025949255 7:66130622-66130644 CTGGGTGATGGGCGGGTGAAAGG + Intronic
1026800695 7:73397992-73398014 GGGGGTGGGGGGCGGGTGCAGGG + Intergenic
1026848176 7:73709207-73709229 CAGGGAGAGGGGGAGGGGCAGGG - Intronic
1027189146 7:75987860-75987882 CGTGGTGGGGGGCAGGGGCAGGG - Intronic
1027477208 7:78647996-78648018 CAGGGTGGGGTGCTGGTGGAGGG + Intronic
1029456979 7:100676319-100676341 CCGGGTGAGGGCCTGGTGCGGGG + Exonic
1029457437 7:100678348-100678370 GAGGGTGAGGGTGAGGAGCAGGG - Intronic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029569535 7:101360466-101360488 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569538 7:101360472-101360494 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569541 7:101360478-101360500 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569544 7:101360484-101360506 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029581939 7:101442127-101442149 CAGGGCCCGGGGCAGGCGCAAGG - Intronic
1029611155 7:101627327-101627349 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1029611158 7:101627333-101627355 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1030471865 7:109974711-109974733 CAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1031179058 7:118392051-118392073 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179061 7:118392057-118392079 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179064 7:118392063-118392085 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179067 7:118392069-118392091 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179070 7:118392075-118392097 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179072 7:118392081-118392103 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1032129313 7:129215728-129215750 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1032888963 7:136172780-136172802 GAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033152188 7:138925066-138925088 CAGGGCGAGGTGCAGGTGCCTGG - Intronic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033366861 7:140678562-140678584 GAGAGTGAAGGGCAGGTGCCGGG + Intronic
1033401722 7:141032489-141032511 CAGGGGCTGGGGCAGTTGCATGG + Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033637808 7:143228245-143228267 CGGGGTGGGGGGCTGGTGGAGGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034274034 7:149816285-149816307 CGGGGGGATGGGCAGGTGAAAGG + Intergenic
1034411589 7:150945171-150945193 CAGTGAGAGGGGCAGGGGCAGGG - Exonic
1034431809 7:151044912-151044934 AAGGCTGAGGGGCTCGTGCAGGG + Intronic
1034463829 7:151213909-151213931 CAGGTTGAGGGGCAGGGGAGAGG + Intronic
1034468809 7:151245205-151245227 AAGGGTGAGGGGAGCGTGCAGGG + Intronic
1034845781 7:154443141-154443163 CAGAGGGAGTGGCAGGTGCCTGG - Intronic
1035022138 7:155806186-155806208 GAGGCTGAGGGCCAGGAGCAGGG - Intronic
1035269337 7:157710735-157710757 CGGGCTGAGGGCCAGGCGCAAGG - Intronic
1035344927 7:158191701-158191723 CAGGGCGAGTGGGAGCTGCAAGG - Intronic
1035431368 7:158825246-158825268 CAGGATGAAGGGCAGTGGCATGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035601778 8:901491-901513 GAGTGTGAGGGGCAGAGGCAGGG + Intergenic
1035784603 8:2250773-2250795 CAGGGGGAGTGGCTGGTGCTGGG + Intergenic
1035808204 8:2470940-2470962 CAGGGGGAGTGGCTGGTGCTGGG - Intergenic
1036258366 8:7222218-7222240 CGGGGTGGGGAGGAGGTGCAGGG - Intergenic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1038041535 8:23727719-23727741 CCGGGTGTGGGGCAGCTGCGGGG - Intergenic
1038046430 8:23769106-23769128 CAGGGGGAATGGCAGGTACAGGG - Intergenic
1038190912 8:25319489-25319511 GGGGGTGAGGGGCTTGTGCATGG + Intronic
1038293132 8:26267582-26267604 CATGCCGAGGGGCAGGGGCAGGG - Intergenic
1039075908 8:33690145-33690167 CATGCAGACGGGCAGGTGCAGGG - Intergenic
1039882370 8:41632933-41632955 CAGGGGTAGGGGTAGGGGCAGGG - Intergenic
1039892890 8:41696657-41696679 CAGGGTGAGTGGCGGGCGCAGGG - Exonic
1040014249 8:42688364-42688386 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1041390939 8:57347123-57347145 CAGGGTGATCGGCTGGGGCAGGG - Intergenic
1043352024 8:79372979-79373001 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1044798992 8:95933858-95933880 CAGGGTGAGGCGGAAGAGCAAGG - Intergenic
1045430753 8:102112828-102112850 CAAGGGGAGGGGGAGGTGCCAGG - Intronic
1046527859 8:115404360-115404382 GAGAGAGAGGGGCAGGTGCCAGG - Intergenic
1047673568 8:127174798-127174820 AAGGGAGGGGGGCAGGTGCCAGG + Intergenic
1047730332 8:127722779-127722801 CAGGGCGAGGGGGAGGTGGGAGG - Intergenic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048590189 8:135814148-135814170 GAGGGTGAGTGGAAGGTACAAGG + Intergenic
1048976402 8:139675274-139675296 CAGGCAGTGGGGCAGGTGGAAGG - Intronic
1049107985 8:140625460-140625482 CAGGGTCAGGGGCTGGGGCTGGG - Intronic
1049120546 8:140733142-140733164 GAGGGTGGGGGGCAGGCACAAGG + Intronic
1049245408 8:141559780-141559802 CAGCGTGAGGCGCAGGGGCTGGG + Intergenic
1049257690 8:141622742-141622764 CAGCCTGAGGGGCTTGTGCAGGG + Intergenic
1049269396 8:141686295-141686317 CAGGGTGTGGCTCAGATGCAGGG - Intergenic
1049344024 8:142128945-142128967 CAGCGAGAGGGGCAGATGCCGGG + Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049359619 8:142206104-142206126 AAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049359622 8:142206110-142206132 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049528489 8:143141791-143141813 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1049528491 8:143141797-143141819 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1049619604 8:143592095-143592117 CAGGCTGATGGGCAGAGGCAGGG + Intronic
1049684477 8:143933870-143933892 CAGGGGCAGGGGCAGGGGCGGGG - Intronic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049774590 8:144398506-144398528 CATGGTGAGGGGCAGGGCCTGGG - Exonic
1049831057 8:144700824-144700846 AAGGGTGAGGGGCATGTTCCTGG + Intergenic
1050359926 9:4820231-4820253 CAGGGTGTGTGGGAGGTGAATGG + Intronic
1050421081 9:5465780-5465802 AGGGGTGAGGGGCAGGAGAATGG + Intronic
1050923383 9:11234016-11234038 AAGGGTAAGGAGCAGATGCAGGG + Intergenic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051745401 9:20290645-20290667 CAGGGTGAGGGGAAAGAGCAGGG + Intergenic
1052531197 9:29686324-29686346 GAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1053020544 9:34691113-34691135 CAGGCTGAGGGCCAGTAGCAGGG + Exonic
1053410236 9:37911594-37911616 CAGGGTCAGGGGCTGGAGCTGGG - Intronic
1053650461 9:40163759-40163781 AAGGGTGAGAAGTAGGTGCAAGG - Intergenic
1053755276 9:41300167-41300189 AAGGGTGAGAAGTAGGTGCAAGG + Intergenic
1054302852 9:63390762-63390784 CAAGGGCAGGGGCAGGGGCAGGG - Intergenic
1054302958 9:63391084-63391106 CAGGATCAGGGTCAGGAGCAGGG - Intergenic
1054330969 9:63755532-63755554 AAGGGTGAGAAGTAGGTGCAAGG - Intergenic
1054495154 9:65820094-65820116 CAAGGGCAGGGGCAGGGGCAGGG + Intergenic
1054534123 9:66212444-66212466 AAGGGTGAGAAGTAGGTGCAAGG + Intergenic
1055187494 9:73474260-73474282 GAGGGGGAGGGGCAGGAGCTTGG - Intergenic
1055259713 9:74419178-74419200 GAGGGTGAGGGTGAGGGGCATGG + Intergenic
1055416516 9:76090214-76090236 CAGGGAGAAGGGAGGGTGCATGG - Intronic
1055638137 9:78297480-78297502 CAGGGCCAGGGGCAGCTGCACGG - Intronic
1056300191 9:85232300-85232322 CCGGGTTAAGGGAAGGTGCACGG - Intergenic
1056803837 9:89712910-89712932 CAGGGTGAGGGGCAGGGGCAGGG + Intergenic
1057405670 9:94768647-94768669 CAGGGTGAGACACAGGTCCACGG - Intronic
1057711286 9:97447691-97447713 CAGGAGTTGGGGCAGGTGCAGGG - Intronic
1058473346 9:105303887-105303909 TAGGGTGAGGAGCAGAAGCATGG + Intronic
1058665152 9:107306870-107306892 CAGGGTGGGGGGCAGTGGAAAGG + Intronic
1059357137 9:113708703-113708725 CAGAGTGAGGGAAAGGTGCTGGG + Intergenic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1060041220 9:120303342-120303364 AAGGGTGAGGAGCAGGGGAAAGG + Intergenic
1060104602 9:120865905-120865927 CAGGCTGAGAGACAGGGGCAGGG + Intronic
1060219711 9:121757972-121757994 CAGGGTATGGGGCAGGTGCCAGG - Intronic
1060702114 9:125764160-125764182 CAGGGGGAGGGGCAGGAAAAAGG - Intronic
1060722340 9:125987368-125987390 AAGGCTGAGAGGCAGGTACAGGG + Intergenic
1060723950 9:125995318-125995340 CCGGGGGAGGGGGAGGTGCCAGG + Intergenic
1060735301 9:126063010-126063032 CAGGCTGAGGGTCAGGGTCAGGG - Intergenic
1060789847 9:126478598-126478620 CGGGAAGAGGGTCAGGTGCAAGG + Intronic
1060802108 9:126551406-126551428 CAGGGGCAGGGGCAGGGGAAGGG - Intergenic
1060802111 9:126551412-126551434 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1060802114 9:126551418-126551440 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1061176274 9:128999314-128999336 AAAGGTGAGGGGCAGAGGCAGGG + Exonic
1061237772 9:129352302-129352324 CAGGGCGAGGGGGCGGGGCAGGG - Intergenic
1061326579 9:129868194-129868216 GAGGGTGACGGGCAGGGGCGTGG + Exonic
1061610492 9:131742233-131742255 CAGGATTTGGGGGAGGTGCAGGG + Intergenic
1061625211 9:131837376-131837398 CAGGAGCAGGGGCAGGGGCAGGG + Intergenic
1061679805 9:132237431-132237453 CAGGGGCAGGGGCAGCGGCAGGG - Intronic
1061848194 9:133399982-133400004 CTGGGTGAGGGGCAGTGGCCAGG - Intronic
1061853468 9:133429182-133429204 CAGGGGGTGGGGCAGGTGGGTGG - Intronic
1061896619 9:133651797-133651819 CAGGGTGTGGGGGCGGGGCAGGG - Intronic
1061988091 9:134142080-134142102 CAGGGCACGGGGCAGGTGCGGGG + Intronic
1061991762 9:134163252-134163274 CAGGGTCAGGGGTAACTGCAGGG - Intergenic
1062197673 9:135283152-135283174 CAGGGTCAGGGGCTGGCACAGGG + Intergenic
1062276434 9:135733544-135733566 CAGGTGTGGGGGCAGGTGCAGGG - Intronic
1062535470 9:137019310-137019332 CAGGGGGTGAGGCAGGGGCATGG + Intronic
1062655917 9:137604760-137604782 CGGGGGGCGGGGCAGGTGCTGGG + Intergenic
1062696915 9:137880291-137880313 CCGGGTGAGGAGGAGGAGCATGG + Intronic
1202798347 9_KI270719v1_random:148449-148471 AAGGGTGAGAAGTAGGTGCAAGG - Intergenic
1203768189 EBV:37247-37269 CAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1203768192 EBV:37253-37275 GAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203768195 EBV:37259-37281 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203768197 EBV:37265-37287 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1185700387 X:2227088-2227110 CTGGCTGGGGTGCAGGTGCAGGG - Intronic
1185749605 X:2600193-2600215 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1186139202 X:6553287-6553309 CGGGGAGAGAGGGAGGTGCAAGG + Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186848149 X:13552224-13552246 CAGGGTGAGGGGTAGGGGTGGGG + Intergenic
1187680056 X:21758780-21758802 AAGGGTCAGGAGCAGGTACAAGG + Intergenic
1188916176 X:35913827-35913849 CAGGGAGAAGGGCAGAAGCAGGG - Intergenic
1189113559 X:38320278-38320300 CGGGGCAAGGGGCAGGGGCAGGG + Intronic
1189695741 X:43660066-43660088 AAGGGTGTGGGGCAGGAGGAAGG - Intronic
1190300531 X:49054471-49054493 CAGAGTCAGGGGCAGGGACAAGG - Intronic
1190789799 X:53687655-53687677 CAGGGTGAAGTGCAGTGGCACGG + Intergenic
1190916853 X:54817475-54817497 CTGGGTGATGGGGAGGTTCAAGG + Intergenic
1191772837 X:64781532-64781554 GAGGGTGAGGAGTAGGTACAAGG - Intergenic
1192171065 X:68855085-68855107 CAGGGTGGGGAGCGGGGGCAGGG + Intergenic
1192919375 X:75690306-75690328 TGGGGTGAGGGGAGGGTGCAGGG - Intergenic
1192941939 X:75921713-75921735 TGGGGTGAGGGGAAGGTGAAGGG - Intergenic
1193280946 X:79650364-79650386 TGGGGTGGGGGGCAGGTGGAGGG - Intergenic
1193810790 X:86048438-86048460 CAGGGTGGGGGGCGGTTGGAGGG - Intergenic
1194981869 X:100449741-100449763 CAGGGTGCGGGGGTGGTTCAGGG - Intergenic
1196316711 X:114234986-114235008 AAGGTAGAGGGACAGGTGCAAGG + Intergenic
1196782681 X:119397638-119397660 CAGGGTGAAGTGCAGTGGCATGG - Intergenic
1197353255 X:125402987-125403009 GAGGGTGAGGGGATGATGCAAGG - Intergenic
1197773428 X:130105318-130105340 CAGGGTGAGGAGGAGGGTCAGGG - Intronic
1197918602 X:131563394-131563416 CAAGGTGAAGGGCAGGGACAAGG - Intergenic
1197918607 X:131563412-131563434 GAAGGTGAAGGGCAGGGGCAAGG - Intergenic
1199332869 X:146582375-146582397 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1199332872 X:146582381-146582403 CTTGGTCAGGGGCAGGGGCAGGG - Intergenic
1199840936 X:151648154-151648176 CAGGGTGAGATGCAGCTTCATGG - Intronic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1200075748 X:153549765-153549787 CAGGGCCGGGGGCAGGAGCAGGG + Intronic
1200166564 X:154039657-154039679 CAGGGAGGGAGGCAGGAGCAGGG - Intronic
1200315131 X:155124525-155124547 TTGGGGGAGGGGCAGGTACATGG + Intronic
1200400841 X:156019867-156019889 CAGGGTCAGGGTCAGGGTCAAGG + Intergenic
1200400857 X:156019911-156019933 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1200400873 X:156019965-156019987 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1200400891 X:156020018-156020040 CAGGGTGAGGGTGAGGGTCAGGG + Intergenic
1200400925 X:156020111-156020133 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
1200400931 X:156020129-156020151 CAGGGTTAGGGTCAGGGTCAGGG + Intergenic
1200400951 X:156020193-156020215 CAGGGTGAGGGTCAGGGTCAGGG + Intergenic
1201335622 Y:12878103-12878125 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic