ID: 985512605

View in Genome Browser
Species Human (GRCh38)
Location 5:321061-321083
Sequence GCTCTCGGCCGCGCGGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985512597_985512605 3 Left 985512597 5:321035-321057 CCCTAAGGACCTGCAGGCAGGAC 0: 1
1: 0
2: 0
3: 8
4: 157
Right 985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG No data
985512598_985512605 2 Left 985512598 5:321036-321058 CCTAAGGACCTGCAGGCAGGACC No data
Right 985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG No data
985512599_985512605 -6 Left 985512599 5:321044-321066 CCTGCAGGCAGGACCCTGCTCTC 0: 1
1: 0
2: 2
3: 29
4: 352
Right 985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985512605 Original CRISPR GCTCTCGGCCGCGCGGTCCC GGG Intronic