ID: 985514310

View in Genome Browser
Species Human (GRCh38)
Location 5:332091-332113
Sequence CTCTGGAAACTATACATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 2, 2: 3, 3: 20, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514310_985514313 16 Left 985514310 5:332091-332113 CCATGTATGTATAGTTTCCAGAG 0: 1
1: 2
2: 3
3: 20
4: 219
Right 985514313 5:332130-332152 TTTATGATTTTATTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514310 Original CRISPR CTCTGGAAACTATACATACA TGG (reversed) Intronic
902170970 1:14610729-14610751 CTCTGGAAAATACACCTGCATGG + Intronic
904475206 1:30760376-30760398 CTCTGGAACCTGTGCGTACATGG + Intergenic
905577429 1:39056572-39056594 CTCAGGAAACTAGAAATAAAAGG + Intergenic
906056277 1:42920134-42920156 CTCAGGAAACTAGAAATAGAGGG + Intergenic
907339367 1:53723699-53723721 CTTTGGAAACTATAGAAACATGG - Intronic
909403914 1:75264495-75264517 CTTGGGAAACTATAAATAAATGG + Intronic
909693205 1:78434306-78434328 TTCTGGAAGCTAGACATTCAAGG + Intronic
910564898 1:88632548-88632570 CATAGGAAACTATAAATACATGG - Intergenic
910865511 1:91784744-91784766 CTCAGGAATCTATACATCAAGGG + Intronic
913580178 1:120218894-120218916 CTCTGAAGACTATACATAGTAGG - Intergenic
913627998 1:120679499-120679521 CTCTGAAGACTATACATAGTAGG + Intergenic
914562103 1:148830335-148830357 CTCTGAAGACTATACATAGTAGG - Intronic
914610727 1:149299886-149299908 CTCTGAAGACTATACATAGTAGG + Intergenic
915761788 1:158320801-158320823 CTTTGGAAACTACAAATACATGG - Intergenic
917014748 1:170517575-170517597 GGCTTGAAACTATACATACCTGG + Intergenic
917607691 1:176651457-176651479 CTATGGAAACTATACAGATCAGG - Intronic
918264902 1:182832724-182832746 CTCAGGAAACTTTACAATCATGG + Intergenic
921085775 1:211791250-211791272 CTCTGGAACCTAAACACACCAGG + Intronic
923252510 1:232190647-232190669 TTCTGGAAACTATATATGTAAGG + Intergenic
923850203 1:237786033-237786055 ATATGCAAACTATACATACTCGG - Exonic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924935732 1:248767951-248767973 CTCAGGAAAATCTACATAGAAGG + Intergenic
1063737198 10:8772018-8772040 CTCAGTAAACTATACTTACGTGG + Intergenic
1065472520 10:26097243-26097265 TTCTGGACACTTTACATACAAGG + Intronic
1067200459 10:44167026-44167048 CTCGGCAAACTAGAAATACAAGG + Intergenic
1069177352 10:65309490-65309512 CTCCAGGAACTTTACATACATGG - Intergenic
1070588983 10:77788248-77788270 CTCTTTAAACTATACATTTATGG + Intergenic
1071418755 10:85467162-85467184 TTTTGGAAACTATACATACATGG + Intergenic
1072395527 10:95035985-95036007 CTCTAGCAACTATACAAGCACGG + Intergenic
1072894263 10:99352193-99352215 TTCTGGAAATTTTACATAAATGG + Intronic
1077990808 11:7410135-7410157 CTCTGGTACCTACAGATACATGG - Intronic
1079824250 11:25171184-25171206 CTTTGGAAACCATATATATATGG - Intergenic
1082099507 11:48160788-48160810 CTTTGGAAACCATGCAGACATGG + Intronic
1082179486 11:49101057-49101079 CTCTGGAAACTATTCCCGCATGG - Intergenic
1083203864 11:61135740-61135762 CCATGGAAACTTTACTTACATGG + Intronic
1084811500 11:71614511-71614533 CACTGGGAACTATACGTGCATGG + Intergenic
1084957134 11:72697469-72697491 CCCAGGACACTGTACATACAGGG - Exonic
1085362417 11:75902360-75902382 TACTGTAAACTATACATGCAAGG - Intronic
1086685798 11:89731860-89731882 CTCTGGAAACTATTCCTGCATGG + Intergenic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1088547789 11:110978496-110978518 CAGTGTATACTATACATACATGG + Intergenic
1090340656 11:126017142-126017164 CTCCGGAAACTATTCCTGCATGG - Exonic
1090476197 11:127023315-127023337 CTCTGGAGAATATAAATACCTGG - Intergenic
1091637656 12:2209658-2209680 CTCTGGAAAATATTCACAGAGGG + Intronic
1092590051 12:9945025-9945047 CTCTTTAAAATATACATATACGG + Intergenic
1095635923 12:44433605-44433627 CTATTGAAACTATAGATTCAGGG + Intergenic
1096910126 12:54974784-54974806 CTCTGAAAACTCTAAATACCGGG + Intronic
1097304168 12:58051371-58051393 CTCAACAAACTAGACATACAAGG + Intergenic
1098762902 12:74447225-74447247 CTCCGGTACTTATACATACAAGG + Intergenic
1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG + Intergenic
1100111784 12:91254014-91254036 TTCTGAAAACTATACATATGAGG + Intergenic
1100114155 12:91282533-91282555 CTCAGCAAACTATAAATAGAAGG + Intergenic
1100580314 12:95932924-95932946 CTCAGGAACATATCCATACATGG + Intronic
1100757009 12:97762488-97762510 GTATGGAAAATATACACACAAGG - Intergenic
1101407990 12:104445787-104445809 CTCTGGAAACTAGAAGTCCAAGG + Intergenic
1103914361 12:124368843-124368865 CGCTGGAAACTGCACAGACAAGG - Intronic
1104594899 12:130114307-130114329 CTCTGGACACTTTACACACATGG - Intergenic
1105478712 13:20753225-20753247 CTTTGGAAACTAAAAATACAGGG - Intronic
1108809304 13:54201647-54201669 CTCTGGAAACTTAACAATCATGG - Intergenic
1109349519 13:61160529-61160551 CTCTGAATACTACACATTCAAGG - Intergenic
1109372933 13:61448053-61448075 CTATGGAAAATATAAATAGAGGG - Intergenic
1109629849 13:65032525-65032547 CTCAGGAAACTTAACATCCATGG + Intergenic
1109778335 13:67073677-67073699 AACTGGAAAGTATACATACCAGG - Intronic
1110248035 13:73349633-73349655 CTCTACAAACTAAAAATACAAGG + Intergenic
1110518847 13:76450176-76450198 CACTGGAAACATCACATACAAGG - Intergenic
1111137224 13:84063781-84063803 CTCTGAAAACTATATATACACGG - Intergenic
1111879226 13:93934146-93934168 TTTTAGAAAATATACATACAAGG + Intronic
1112103236 13:96213212-96213234 CTATGAAAACTACATATACAAGG - Intronic
1116887535 14:50235689-50235711 CTCAGGAAACTTTACAATCATGG + Intergenic
1118263878 14:64274892-64274914 TTTTGGAAACTATACAAACATGG - Intronic
1118727756 14:68641616-68641638 CTCAGTAAACTAGAAATACAGGG - Intronic
1120100584 14:80440582-80440604 TTTTGAAAACTATACAAACATGG + Intergenic
1121376976 14:93420805-93420827 CTTTGGAAACTCTACAAACGTGG + Intronic
1121745693 14:96289057-96289079 CTGTGGAAATTAGACCTACATGG + Intronic
1121914814 14:97828689-97828711 CTAGAGAAACTGTACATACAGGG + Intergenic
1125292754 15:38167785-38167807 CTTTGGAAGCTATTCACACATGG + Intergenic
1126440880 15:48687046-48687068 TTTTGGAAACTATACAAACATGG + Intergenic
1127693876 15:61424882-61424904 CTGTGGAAACTTTAAAGACAAGG + Intergenic
1131735808 15:95330919-95330941 CTCTGGAAATAATACTTACATGG - Intergenic
1136061893 16:27732412-27732434 CTCTGGGGACTAAACTTACAGGG - Intronic
1138738869 16:59283603-59283625 CTCTGGAAACTACAAATATATGG + Intergenic
1138928544 16:61622661-61622683 GTCTGCAAACTACACATACTGGG - Intergenic
1139409369 16:66746993-66747015 CACTGGAGTCTGTACATACAGGG - Intronic
1141347676 16:83262227-83262249 CTGGGGAAATTATACTTACAGGG - Intronic
1142344791 16:89546989-89547011 CTCTGGAAACAACACAGACCGGG - Intronic
1143086161 17:4417605-4417627 CTTTGGAATCTATAAATATAGGG - Intergenic
1143693666 17:8593157-8593179 CTCAGCAAACTAGAAATACAAGG + Intronic
1146776197 17:35619646-35619668 CTCTGTAAAGTATACATAATTGG + Intronic
1153870302 18:9312766-9312788 CTCAGCAAACTAGAAATACAAGG + Intergenic
1153916061 18:9745752-9745774 CTCAGGAAACTAGAGATAGAGGG + Intronic
1156857527 18:41799570-41799592 CTCTGTAAACTATTTTTACAGGG - Intergenic
1159307221 18:66659529-66659551 CTCTGGCCAGTATCCATACATGG + Intergenic
1162284925 19:9730977-9730999 CTTTTTAAATTATACATACAAGG + Intergenic
1164559402 19:29278720-29278742 ATGTGTAAACTATGCATACAAGG - Intergenic
926438198 2:12859040-12859062 CTCTGGAGACTAGAAATCCAAGG + Intergenic
928834438 2:35526623-35526645 TTTTGGAAACTACACAAACATGG - Intergenic
930747886 2:54903553-54903575 CTCTAGAAACAATGCATAAATGG - Intronic
930780392 2:55219472-55219494 CTCTGAAAAATCTACCTACATGG + Intronic
930845193 2:55895884-55895906 CTCTGGAAACTCTACTGACTTGG + Intronic
931890807 2:66670015-66670037 CTCTAAAAACTATAAATATAAGG - Intergenic
933499998 2:83099428-83099450 CTCAGGAAACTAGGAATACAAGG + Intergenic
935752994 2:106255398-106255420 CTCTGGTAAAGATAAATACATGG - Intergenic
935913414 2:107922931-107922953 CTCTGGTAAAGATAAATACATGG - Intergenic
938643745 2:133310164-133310186 CTTTGGGAACTATACAGACAAGG + Intronic
940288800 2:152058129-152058151 CTCAGGAAACTTTACAGTCATGG - Intronic
940357254 2:152757151-152757173 CTCTTGAAACTACATCTACATGG - Intronic
941136921 2:161729017-161729039 ATCAGGAAACTATAAATAGAAGG + Intronic
942044147 2:172089731-172089753 CTCTGGAGACAGTTCATACAGGG + Intergenic
942882281 2:180875470-180875492 CTCTGGAAACTATACAAACATGG + Intergenic
944359118 2:198830834-198830856 CTCTGGAAATTACGCTTACAAGG - Intergenic
944823327 2:203453939-203453961 CTCAGGTCACAATACATACATGG + Intronic
947039512 2:225900136-225900158 TTTTGGAAACTACAAATACATGG + Intergenic
1170463178 20:16598397-16598419 CCTAGGAAACTATACATATAGGG - Intergenic
1173259936 20:41424963-41424985 ATCTGGAAACTGTAAAGACAGGG + Intronic
1174891021 20:54393322-54393344 CTCAGGAAACTAGAAATAGAAGG - Intergenic
1181081298 22:20417599-20417621 CTCTAGATACTCCACATACATGG + Intergenic
950721180 3:14883776-14883798 TTCTGCAAATTATACTTACATGG - Intronic
951414363 3:22405059-22405081 CTCTGGAAACAATAAGAACATGG + Intergenic
951781798 3:26371689-26371711 CTCTGAAAACTGTATATACTTGG + Intergenic
952731455 3:36640972-36640994 CTCTGGAAATTTCACATATATGG + Intergenic
953948871 3:47172473-47172495 CTCTTAAAACTTTACATAAATGG - Intergenic
954172016 3:48811888-48811910 CTCTGGGAATTTTACATAAATGG - Intronic
955928923 3:64036388-64036410 CTCTGGCAACTATAGACAAAAGG + Intergenic
958002985 3:87774777-87774799 CTCAGCAAAATAGACATACAAGG - Intergenic
958770412 3:98419282-98419304 CTCTACAAATTATACATAGAAGG + Intergenic
960792274 3:121446230-121446252 TTTTGGAAAGTATACAAACATGG - Intronic
960824138 3:121765635-121765657 CTCAGCAAACTAGACATAGAAGG - Intergenic
964440436 3:156703168-156703190 CTCTGGAATGTATAGCTACAAGG - Intronic
965027584 3:163322832-163322854 CTTTAGAAAATATACAAACATGG - Intergenic
965209299 3:165764647-165764669 TTTTGGAAACTATAAATACAAGG - Intergenic
966211712 3:177460215-177460237 CTCTGAAATCTCTACATTCAAGG - Intergenic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
969141122 4:5073548-5073570 CACTGGAAACGTTATATACATGG - Intronic
970675680 4:18447835-18447857 CTCAGGAAACTATTAATAGAAGG + Intergenic
970726596 4:19052776-19052798 CTATGCAAACTATATATATATGG + Intergenic
972447200 4:39156207-39156229 CTCTGGAGAATATACACAAATGG + Intergenic
972993288 4:44848970-44848992 CTCTAAAAACTATAAATATAGGG + Intergenic
973874281 4:55200319-55200341 CGCTGAAAAATATACATAGATGG + Intergenic
974609047 4:64191200-64191222 CTTTGGAAACTATAAACAAATGG - Intergenic
974872375 4:67659520-67659542 CTCAGGAAACTATACCATCATGG - Intronic
979001082 4:115220657-115220679 CACTGGAAACCATACAGTCATGG - Intergenic
979379243 4:119988992-119989014 CTTTGGAAACTACAAACACAAGG + Intergenic
979655751 4:123191524-123191546 TTCTTGTGACTATACATACAAGG + Intronic
980691833 4:136305318-136305340 CTCGGGAAACTCTACAACCAAGG - Intergenic
981422448 4:144566772-144566794 ATTTAGAAACTATACATATAAGG - Intergenic
981853410 4:149258178-149258200 ATTTTGAAAATATACATACAGGG + Intergenic
983674203 4:170272917-170272939 CCCTGGAATATATATATACAGGG + Intergenic
985514310 5:332091-332113 CTCTGGAAACTATACATACATGG - Intronic
986100514 5:4605659-4605681 CTCTTGAATCTATACATTTATGG + Intergenic
986764550 5:10913049-10913071 CTCTGGATACTTCACATAGATGG - Intergenic
986866640 5:11996969-11996991 CTCAGGAAACTAGGCATAGAAGG - Intergenic
989494625 5:42098212-42098234 TTTTGGAAACTACAAATACATGG - Intergenic
989671414 5:43921587-43921609 TTTTGGAAACTATACAAATATGG - Intergenic
990287590 5:54315243-54315265 CTTTGAAAAATAGACATACAAGG - Intergenic
990677147 5:58200083-58200105 CTTTGGAAATTATAGAAACATGG + Intergenic
991145773 5:63301910-63301932 CTCTGAAAAGAAGACATACATGG - Intergenic
992189733 5:74280093-74280115 CTTTGGAATCAATACATAGATGG - Intergenic
992545259 5:77808119-77808141 CTTTGGAAACTACAAATACATGG - Intronic
993140095 5:84021493-84021515 CTTTGGAAACTATATATACATGG - Intronic
993990497 5:94651578-94651600 TTTTGTAAAATATACATACAAGG - Intronic
994554048 5:101274453-101274475 CTCTGGAAAATAGACTTACATGG - Intergenic
996121338 5:119676370-119676392 CTTTAGAAACTACAAATACATGG - Intergenic
999905609 5:156138096-156138118 CTTTTGAAACTTCACATACACGG + Intronic
1000571481 5:162919898-162919920 CTCTGCAAACTATTTATAGATGG - Intergenic
1001572604 5:172740334-172740356 CTCTGGACATTTTATATACATGG - Intergenic
1002052514 5:176579268-176579290 CTCTGGAAACTACACAGTCCTGG - Intronic
1002472985 5:179448320-179448342 TTCTGGAAATTATACACAGAAGG - Intergenic
1002481239 5:179502334-179502356 TTCTGGAAATTATACACAGAAGG + Intergenic
1003751074 6:9056841-9056863 CTCTGGAAAACATAAATATATGG + Intergenic
1004205536 6:13588461-13588483 TTCTGGAAACTTTACAAACCTGG - Exonic
1005593333 6:27351159-27351181 TTTTGGAAACTAAAAATACATGG + Intergenic
1005810776 6:29514255-29514277 TTCTGGACACTTTACATACATGG - Intergenic
1009194395 6:60666664-60666686 CTCAGGAAACTTAACAAACATGG + Intergenic
1010579208 6:77573530-77573552 CTCTGGAAATGATAACTACATGG - Intergenic
1010874436 6:81084523-81084545 CTCAGGAAACTATGGATAGAAGG - Intergenic
1011764015 6:90599589-90599611 CTTTGGTGACTTTACATACAAGG - Intergenic
1012600370 6:101089472-101089494 CTTTGGAAACTACAAATGCATGG - Intergenic
1012615355 6:101271378-101271400 CTTTGGAAACTACGAATACAGGG + Intergenic
1014745619 6:125197193-125197215 CTCTAGAGACTGTTCATACAAGG - Intronic
1016024737 6:139274795-139274817 CGCTGGAAACTAAACATGAATGG + Intronic
1016130202 6:140458644-140458666 CTTTGGAAACTGTAGATATAAGG - Intergenic
1016591438 6:145749197-145749219 TTCTGGAAACTTCACATAAATGG - Intergenic
1017064881 6:150519384-150519406 TTGTGGAAACTATACCTTCAGGG + Intergenic
1017414066 6:154201115-154201137 CTCAGGAAACTTTACAATCATGG - Intronic
1017580297 6:155857937-155857959 CTCTGGAAATGGTAAATACATGG - Intergenic
1020539670 7:9444588-9444610 CTCAGCAAAGTCTACATACATGG + Intergenic
1020666138 7:11046474-11046496 CTCTGTAAACTATTCCTAGAAGG - Intronic
1020819986 7:12955225-12955247 CTATGCAAAGTGTACATACATGG - Intergenic
1024378400 7:48665448-48665470 CTGTGGTACCTATACATAAAGGG - Intergenic
1024733718 7:52280065-52280087 CTCTGGCATATATACATACATGG - Intergenic
1024782595 7:52868922-52868944 CTCTGCAAACTAGGCATAGAAGG + Intergenic
1024933722 7:54690947-54690969 CTTTGGAAACTAAACATGGATGG + Intergenic
1025148874 7:56529683-56529705 CTCTGAAAACTAGAAATAGAGGG + Intergenic
1026535626 7:71236476-71236498 CTCTGCAAACTACACATCCTGGG + Intronic
1026561664 7:71455461-71455483 CCCTGGAAAATATTCATACTGGG - Intronic
1027628490 7:80573802-80573824 CTTTGGAAACTACAGATACATGG - Intronic
1027898134 7:84071889-84071911 CTGTGGAAAAACTACATACAGGG + Intronic
1028282702 7:88951664-88951686 TTCTATAAACTATATATACATGG + Intronic
1028524287 7:91766170-91766192 ATCTGCAAACTATTCATTCAAGG + Intronic
1028964817 7:96790335-96790357 CTCTGTACACTATAGATACTCGG + Intergenic
1028981337 7:96970853-96970875 CTCTGGAACCCATACATCAAAGG + Intergenic
1030165488 7:106550750-106550772 ATCTGAAAAAAATACATACATGG + Intergenic
1031568917 7:123333938-123333960 CTCAGCAAACTATCCATAGAAGG + Intergenic
1031569342 7:123339863-123339885 CAATGGAAACTATACAGGCAAGG - Intergenic
1032038889 7:128541797-128541819 CTCTAGAAAATATACAGACTGGG - Intergenic
1032310426 7:130781137-130781159 CTCAGGAAGCTAGAAATACAAGG - Intergenic
1032932231 7:136686555-136686577 CTGTGGAAATTCTAAATACAGGG - Intergenic
1033068730 7:138181704-138181726 TTCTGGAATCCATGCATACATGG - Intergenic
1033872321 7:145770283-145770305 CTCTAGAAACTACAAACACATGG - Intergenic
1034742736 7:153493916-153493938 CTCAGGAAACTTTACAATCATGG - Intergenic
1035838557 8:2786057-2786079 CTATGGAAACTACACATGGACGG + Intergenic
1036163855 8:6413075-6413097 TTCTGGAAAGGATACATAAAAGG + Intronic
1038405229 8:27317139-27317161 CTCTGAAAATGAGACATACAGGG - Intronic
1039663487 8:39494356-39494378 CTCAGCAAACTAAAAATACAGGG - Intergenic
1039727834 8:40239195-40239217 TCTTGGAAACTATACAAACATGG - Intergenic
1039826783 8:41181468-41181490 ATGTGGATAATATACATACAAGG + Intergenic
1040063356 8:43123353-43123375 CTTTGGAAACTACAAATCCATGG - Exonic
1040492728 8:47939740-47939762 CAATGGAATCTATACAAACATGG + Intronic
1040653640 8:49479019-49479041 TTCTGGAAACTGTACATAAATGG + Intergenic
1046243204 8:111526306-111526328 CTCTGGAGACTATAACCACAAGG + Intergenic
1046523376 8:115354110-115354132 ATCTGGCAATTCTACATACAAGG + Intergenic
1046688344 8:117253104-117253126 CTCTCAAAACCACACATACATGG + Intergenic
1047063598 8:121255177-121255199 CTCTGGAACCTGTGAATACATGG + Intergenic
1048825075 8:138416524-138416546 CTCTGGAACTTATACAGAGAAGG - Intronic
1052491765 9:29178642-29178664 CTTTGGAAACTATGTATATAGGG + Intergenic
1053186745 9:36022763-36022785 TTCTGCAGACTATACAAACATGG + Intergenic
1056058588 9:82858084-82858106 CTCAGGAAACTAGAGATAGAAGG + Intergenic
1056874771 9:90317469-90317491 CTCTGGGATCTATGCATGCAGGG - Intergenic
1060070136 9:120539721-120539743 CACTGGATAGTAGACATACAAGG - Intronic
1061261138 9:129481785-129481807 CTTGGGAAACTTTACATAGAGGG - Intergenic
1188174291 X:26969605-26969627 CTCTGTAAAATAGACAGACATGG - Intergenic
1190629050 X:52367514-52367536 CTCTGGAAACTTAACAATCATGG + Intergenic
1190961820 X:55257953-55257975 CTCAGGAAACTAGAAATAGAAGG + Intronic
1192840726 X:74852646-74852668 CTTTGGAAACTACAAACACATGG + Intronic
1193801322 X:85940060-85940082 CTCAGGAAACTTTACAACCATGG + Intronic
1193876832 X:86871286-86871308 ATATGGAATATATACATACATGG + Intergenic
1193876834 X:86871318-86871340 ATATGGAACATATACATACATGG + Intergenic
1193876836 X:86871348-86871370 ATATGGAACATATACATACATGG + Intergenic
1193876838 X:86871382-86871404 ATATGGAACATATACATACATGG + Intergenic
1194448570 X:94015279-94015301 CTCTGGGAAGTATACAGATATGG - Intergenic
1197475998 X:126926139-126926161 CTCAGCAAACTCGACATACAAGG - Intergenic
1197487538 X:127072688-127072710 CTGTGGAAACTATACAGGCCAGG - Intergenic
1197787588 X:130214512-130214534 CTCAGGAAATTACATATACAGGG + Intronic
1198446540 X:136723068-136723090 TTCTGGAAGTTTTACATACATGG - Intronic
1201369103 Y:13241221-13241243 CTGTGGAAACTATACATACATGG + Intergenic