ID: 985514965

View in Genome Browser
Species Human (GRCh38)
Location 5:337704-337726
Sequence TTAGGGGCCTCCCGCAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514965_985514981 23 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514965_985514970 -6 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514970 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 51
985514965_985514967 -10 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514967 5:337717-337739 AGGCCCCTAAGGAGTGCGCTTGG 0: 1
1: 0
2: 1
3: 3
4: 58
985514965_985514974 -3 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514974 5:337724-337746 TAAGGAGTGCGCTTGGAAGGGGG No data
985514965_985514976 16 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514965_985514977 17 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514965_985514972 -5 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514972 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 68
985514965_985514979 22 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG No data
985514965_985514973 -4 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514973 5:337723-337745 CTAAGGAGTGCGCTTGGAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 116
985514965_985514975 15 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514965 Original CRISPR TTAGGGGCCTCCCGCAGCCC CGG (reversed) Intronic
900313228 1:2044768-2044790 TTCCGGGCCGCCCTCAGCCCCGG - Intergenic
900773725 1:4565828-4565850 TGAGGAGCCCCCCGCAGGCCTGG - Intergenic
900941071 1:5798871-5798893 TAGGGGGCCTCCCTAAGCCCTGG - Intergenic
901656695 1:10773534-10773556 TCAGGGGTCTCACGCACCCCGGG + Intronic
902962875 1:19977162-19977184 TTAGGGGCCTCCAGCACCCAGGG - Intronic
904538212 1:31215297-31215319 TAAGGGGGATCCCGAAGCCCTGG - Intronic
907239277 1:53071630-53071652 TGAGGGGCCACCCAGAGCCCAGG + Intronic
907795022 1:57707827-57707849 TTAGGGGGCTCTCTGAGCCCAGG + Intronic
908127216 1:61043527-61043549 TTCGGGGCCTCCCCAAGCCCCGG + Intronic
910342217 1:86201030-86201052 TTAGGGGCCTCATGCTCCCCCGG - Intergenic
911266413 1:95750008-95750030 TTAGTGGCCACCCTCAGCTCAGG + Intergenic
914955045 1:152154512-152154534 TTTGGGGCCTCCCACTGCTCTGG + Exonic
916075304 1:161197134-161197156 CTCTGGGGCTCCCGCAGCCCTGG - Intronic
916742866 1:167661604-167661626 CTAGTGGCCTCCAGGAGCCCAGG - Intronic
923629284 1:235639326-235639348 TTAAGTGCTTCCTGCAGCCCAGG - Intronic
924041621 1:239989459-239989481 TCAGGGCCCTCCCGCAGCAGCGG - Intergenic
1066507573 10:36061225-36061247 TGAGAGGCCTCCTGCAGTCCAGG - Intergenic
1070833709 10:79435405-79435427 TTAGAGGCCTCTGGCTGCCCAGG - Intronic
1075944273 10:126418788-126418810 GTAGAGTCCTCCTGCAGCCCAGG + Intergenic
1077699126 11:4423703-4423725 CTAGGGGCCTCTGGCTGCCCAGG - Intergenic
1078393656 11:10958327-10958349 TTATGGGCCTCTCTCAGCACAGG - Intergenic
1078454853 11:11467098-11467120 TTAAGGGCCTCCTGCCTCCCGGG - Intronic
1078573773 11:12481831-12481853 ATAGGGGCCTCTCGTAGCCCAGG + Intronic
1083171755 11:60927486-60927508 TTGGGAGCCTTCCCCAGCCCCGG + Intronic
1085533071 11:77203045-77203067 GTGGGGGCCTGCCGCAGCACAGG - Exonic
1088181957 11:107122330-107122352 TTAGGGGGCACCCCAAGCCCAGG - Intergenic
1089818378 11:121197904-121197926 GCAGGGGCCACCCACAGCCCTGG - Intergenic
1091056260 11:132421796-132421818 TGTGGGGCCTCCAGCAGTCCTGG + Intronic
1091665867 12:2418192-2418214 TCAAAGGCCACCCGCAGCCCAGG - Intronic
1097754126 12:63390218-63390240 TCATGTGCCTCCCCCAGCCCAGG + Intergenic
1100909046 12:99337713-99337735 TTAGGGGGCACCCCAAGCCCAGG + Intronic
1102946856 12:116997548-116997570 TTAGGTGCCTCCTTCACCCCCGG + Intronic
1103294792 12:119877103-119877125 CTCCAGGCCTCCCGCAGCCCTGG + Intronic
1105353037 13:19633373-19633395 CTCGGGGCCGCCCTCAGCCCTGG + Intergenic
1109936525 13:69292966-69292988 TTAGGGGGCTGGCTCAGCCCTGG + Intergenic
1113755664 13:112808963-112808985 TTGGCGTCTTCCCGCAGCCCGGG + Intronic
1113900099 13:113792002-113792024 TCTGGGGCCTCCCGCAGTTCCGG - Intronic
1117156852 14:52950721-52950743 GTAGGGTCCTCCCGCAGCCCCGG - Intronic
1118168115 14:63357999-63358021 CTGGGGGCCTCCCGCGGCTCAGG - Intergenic
1121930178 14:97965018-97965040 TTAGGGACCTCCCCCATTCCCGG + Intronic
1122153953 14:99739240-99739262 TCCCGGGGCTCCCGCAGCCCCGG - Intronic
1122354768 14:101116198-101116220 TTCATGGCCTCCTGCAGCCCTGG - Intergenic
1122988770 14:105226472-105226494 TGAGGGGCATCCCGGAGCCTCGG + Intronic
1124080641 15:26491745-26491767 TTAGGGGACTGCAGCAACCCGGG - Intergenic
1125883764 15:43213704-43213726 CAAAGGGCCTCCCCCAGCCCAGG + Intronic
1127953529 15:63833581-63833603 CTAGAGGCCTCCTGCCGCCCGGG - Intronic
1129673790 15:77621615-77621637 CTAGGGCCTTCCCTCAGCCCTGG - Intronic
1132797822 16:1733972-1733994 GTAGGGGCCTTCCCCAGCCACGG + Intronic
1132995519 16:2820495-2820517 TTAGGGACCCCCAGCACCCCTGG - Intronic
1133395048 16:5440203-5440225 ATTTGGGCCTCCCACAGCCCTGG + Intergenic
1138150272 16:54650405-54650427 TTAGGGGCCCCCTGCTGCCATGG - Intergenic
1138213137 16:55179964-55179986 TTGGAGGCCTCCCGCCTCCCTGG - Intergenic
1138594270 16:58021370-58021392 AGAGGGGCCTTCCACAGCCCGGG + Exonic
1139593198 16:67944312-67944334 TTCTGGGCCTCCTGCTGCCCCGG - Exonic
1140111913 16:72012010-72012032 TTAGGGGGGTCCCCCAGGCCAGG - Intronic
1141597474 16:85106263-85106285 TTAGCGGCATCCAGCATCCCTGG + Intronic
1141832263 16:86516329-86516351 TTTGCGGCGTCCCGCAGCCGTGG - Intergenic
1143480968 17:7227203-7227225 TTGCGGGCCTCCCGCCGCTCAGG + Exonic
1143697078 17:8629523-8629545 CTGGGGGCCTCCCGCTTCCCAGG + Intronic
1149049143 17:52284117-52284139 GTTGGGGCCTCACTCAGCCCAGG + Intergenic
1149079229 17:52633440-52633462 TTAGGGCCCTCCCCCAACACTGG - Intergenic
1151326996 17:73385746-73385768 TTGGGGGCTCCACGCAGCCCTGG + Intronic
1151464576 17:74276253-74276275 TCAGGCGTCTCCCGCATCCCCGG - Intronic
1152297141 17:79474700-79474722 TCATGGGTCTCCCCCAGCCCTGG + Intronic
1153075186 18:1155200-1155222 TTAGGGGGCACCCAAAGCCCAGG + Intergenic
1156171724 18:34493935-34493957 TGAGGCGCCGCCCGCCGCCCGGG - Intronic
1156285826 18:35695003-35695025 TTAGGCCCTTCCCTCAGCCCTGG - Intronic
1156609805 18:38712763-38712785 TTTGGGTCCTCCCCAAGCCCTGG + Intergenic
1160716660 19:579843-579865 GCAGGGGGCTCCAGCAGCCCTGG + Intronic
1162013516 19:7831453-7831475 TGAGGTGCCTGCCGCACCCCAGG + Intronic
1162417181 19:10544885-10544907 GGAGAGGCCTCCCCCAGCCCTGG - Intronic
1162791058 19:13063177-13063199 TTAGGGACCTTCCCCTGCCCTGG + Intronic
1163424210 19:17232258-17232280 CGAGGGGCCTCCCGGGGCCCAGG - Exonic
1163598248 19:18232914-18232936 GCAGGGGCCTCCTGCAGCGCGGG - Intronic
1165522467 19:36325594-36325616 TAAGGGGCCTGACCCAGCCCTGG + Intergenic
1168144904 19:54415498-54415520 TCCGGAGGCTCCCGCAGCCCCGG + Intronic
928118814 2:28566932-28566954 TTAGCGGGCTCCTGCAGCCGGGG - Intronic
930946685 2:57084420-57084442 TCAAGGGCCACCTGCAGCCCAGG + Intergenic
933393407 2:81701437-81701459 TTAGGAGCCTCTCTCAGGCCCGG - Intergenic
934487123 2:94725705-94725727 TCAGGGGCCTCCCCTGGCCCCGG + Intergenic
934488316 2:94738195-94738217 TAAGGGGCCTCCCCTGGCCCTGG - Intergenic
938248743 2:129797852-129797874 TCCGGGGCCTCCAGCAGCTCGGG + Intergenic
1168971678 20:1935544-1935566 ATGGGGTCCCCCCGCAGCCCCGG + Intronic
1169081547 20:2800474-2800496 TGCTGGGCCTCGCGCAGCCCGGG - Exonic
1169285536 20:4304262-4304284 TGAGGGACCTCCCCCAGCACAGG - Intergenic
1172093828 20:32451075-32451097 TGAGGGGTCTCCTGCAGCCAAGG + Intronic
1172240212 20:33408154-33408176 TTAGGGGCCTCGAGGAGGCCCGG + Exonic
1173750393 20:45470923-45470945 CTGGGGGCCTCCCCCAGCCCTGG + Intronic
1175428573 20:58887714-58887736 TCAGGGGTCTGCAGCAGCCCAGG + Intronic
1176717658 21:10367092-10367114 TTAGGGTCCTCAGGCTGCCCAGG - Intergenic
1178089325 21:29144564-29144586 TAAGGGGTGTCCCCCAGCCCTGG - Intronic
1178352195 21:31880181-31880203 TTAGATGCCTGCAGCAGCCCTGG + Intronic
1178790200 21:35692973-35692995 TTAGGGACCCCCCTCTGCCCCGG + Intronic
1179821394 21:43939328-43939350 TCGGGGGCCTCCCGCGCCCCAGG + Intronic
1179997378 21:44980268-44980290 TGGGGGGTCTCCCTCAGCCCCGG + Intergenic
1180022272 21:45135964-45135986 TTAGAGGCCGCCAGCAGCCACGG + Intronic
1180298885 22:11020012-11020034 TTAGGGTCCTCAGGCTGCCCAGG - Intergenic
1180559233 22:16602002-16602024 TTGGGGGGCTCCCGCCGCCGCGG - Intergenic
1180790708 22:18574100-18574122 TCAGAGCCCTCCCCCAGCCCAGG + Intergenic
1181231029 22:21421214-21421236 TCAGAGCCCTCCCCCAGCCCAGG - Intronic
1181247619 22:21513654-21513676 TCAGAGCCCTCCCCCAGCCCAGG + Intergenic
1182092977 22:27608660-27608682 TTAGGTGCCTCCCCTACCCCAGG - Intergenic
1182506852 22:30789659-30789681 TTAGGGTCCTCCAACAGCCTTGG - Intronic
1183586585 22:38756207-38756229 GTCGCGTCCTCCCGCAGCCCGGG - Intronic
1183930630 22:41234133-41234155 TAAGGGGTCTCCCTCATCCCAGG - Intronic
1184086640 22:42269927-42269949 TTCGGGGCCCCTGGCAGCCCCGG - Intronic
1184110063 22:42389251-42389273 TTGGGGGCCTGCAGCATCCCAGG - Intronic
1184640441 22:45867421-45867443 CCAGGGGTGTCCCGCAGCCCCGG + Intergenic
1184645464 22:45892481-45892503 TGAGGCGGCCCCCGCAGCCCAGG - Intergenic
1184676028 22:46044087-46044109 TCAGTTGCCTCCCCCAGCCCAGG + Intergenic
1184727517 22:46355512-46355534 GGAGGAGCCTCCCGCAGCACTGG + Exonic
1185317984 22:50186947-50186969 TGCGGGGACTCCCGCAGCCTCGG + Intronic
950006953 3:9697618-9697640 CTAGGGGACTAGCGCAGCCCTGG - Intronic
952845579 3:37685357-37685379 TTTGTGGCCTCCCTCAACCCTGG - Intronic
953017039 3:39087289-39087311 TTAGAGGCCTCCCAAAGCACTGG - Intronic
953741387 3:45541993-45542015 TTAGGGGCCACCAGCAGGGCAGG - Intronic
954519167 3:51207870-51207892 TTAGGGAGTTCCCACAGCCCTGG - Intronic
954717523 3:52533904-52533926 TCCGGGGCCTCCCGCCCCCCGGG - Intronic
960123371 3:113970407-113970429 ATAGTGGCCTCCCAAAGCCCTGG + Intronic
965996716 3:174892010-174892032 TTAGGGGGCACCCCAAGCCCAGG - Intronic
966904724 3:184513852-184513874 TTCGGGCTCTCCAGCAGCCCAGG - Intronic
968088622 3:195886017-195886039 TCCGGTGCCTCCTGCAGCCCCGG + Intronic
968579243 4:1382161-1382183 TCAGGGCCCTCCCGCCGCCCAGG - Intronic
969660849 4:8526597-8526619 GCAAGGCCCTCCCGCAGCCCAGG + Intergenic
969694604 4:8727616-8727638 TCAGGGCCCTCCACCAGCCCAGG + Intergenic
974977387 4:68907017-68907039 TTAAGGGTCTCCCACAGCCGAGG + Intergenic
985514965 5:337704-337726 TTAGGGGCCTCCCGCAGCCCCGG - Intronic
987101261 5:14593128-14593150 TTAAGCTCCTCCCGCAGGCCAGG - Intronic
995268516 5:110194149-110194171 TTAGGGGGCACCCCAAGCCCAGG + Intergenic
1002461088 5:179374196-179374218 TGATGGGCCTGCCGCAGCCCTGG - Intergenic
1004234190 6:13860014-13860036 GCAAGCGCCTCCCGCAGCCCCGG - Intergenic
1004234233 6:13860154-13860176 GCAAGCGCCTCCCGCAGCCCCGG - Intergenic
1007112483 6:39320884-39320906 TCAGGGGCCTCCCAAAACCCTGG - Intronic
1007600358 6:43077154-43077176 TTAGGGGCCGCCCCCATCCATGG + Intronic
1008109581 6:47477978-47478000 GTAGGGCCCTCCCGCCGCCGTGG + Exonic
1015654166 6:135497942-135497964 TTAGGGGGCTCCCGCCTCCCCGG + Intergenic
1018818850 6:167357543-167357565 ATCGTGGCCTCTCGCAGCCCGGG - Intronic
1018974876 6:168556557-168556579 TTGGGGGCCTCAAACAGCCCTGG - Intronic
1019496367 7:1342277-1342299 TCAGAGGACTCCCCCAGCCCAGG - Intergenic
1022495454 7:30850311-30850333 AGAGGGGCCACCTGCAGCCCAGG - Intronic
1024709827 7:52002971-52002993 TTAGGGGCCTGCCTCACCCCTGG - Intergenic
1025824492 7:64999255-64999277 TCACGGGTCTCCCCCAGCCCGGG + Intronic
1028762712 7:94512326-94512348 TCCTGGGCCTCCAGCAGCCCAGG + Intronic
1029234693 7:99104830-99104852 ATAGGGGCTTCACGCAGACCAGG + Intronic
1029582623 7:101447568-101447590 ATGGGGGCCTCCCGGAGCCCTGG + Intronic
1031292293 7:119951851-119951873 GCAAGGGCCTCACGCAGCCCCGG + Intergenic
1032871175 7:135987610-135987632 TTATGGGCCACATGCAGCCCAGG + Intergenic
1033658891 7:143390574-143390596 ACAGGGGCTTCCCGCAGTCCTGG - Exonic
1034217795 7:149421488-149421510 TTAGGGGGCCACCGCAGCCTGGG + Intergenic
1035337609 7:158140014-158140036 TTTGGCTCCTCCCGCAGCTCTGG - Intronic
1047927170 8:129693224-129693246 TCAGGGGCCCCCAGCAGCTCAGG + Intergenic
1048967514 8:139625265-139625287 CTAGGTGCCTCTCCCAGCCCCGG + Intronic
1049248616 8:141576269-141576291 TTAGGGGTCCCCAGCATCCCAGG - Intergenic
1049775163 8:144400658-144400680 TTAGGGGGCTCACCCAGGCCAGG + Exonic
1053669472 9:40346169-40346191 TAAGGGGCCTCCCCTGGCCCTGG + Intergenic
1053919268 9:42972411-42972433 TAAGGGGCCTCCCCTGGCCCTGG + Intergenic
1053920471 9:42984997-42985019 TCAGGGGCCTCCCCTGGCCCCGG - Intergenic
1054380604 9:64486189-64486211 TAAGGGGCCTCCCCTGGCCCTGG + Intergenic
1054515142 9:66030122-66030144 TAAGGGGCCTCCCCTGGCCCTGG - Intergenic
1056584509 9:87919596-87919618 TGAGGGGCCTCCCGCTCCCTGGG + Intergenic
1056612357 9:88133324-88133346 TGAGGGGCCTCCCGCTCCCTGGG - Intergenic
1056799458 9:89681313-89681335 TTAGCTGCCTCCCGCAGGGCAGG + Intergenic
1056936705 9:90920093-90920115 TCTTGGGCCTCCCACAGCCCTGG + Intergenic
1057303733 9:93900835-93900857 CTAGTGGCCTCCCCCAGCCCTGG + Intergenic
1060729972 9:126031014-126031036 TGAGGGGGCTACCGCAGCCTGGG - Intergenic
1061825575 9:133256404-133256426 GGACGGGCCTCCTGCAGCCCAGG - Intronic
1061974647 9:134062101-134062123 TTGGGGGCCCCCTGTAGCCCTGG + Intronic
1062252739 9:135606440-135606462 TAAGGGGCCTTCTGCAGGCCAGG - Intergenic
1186780144 X:12903914-12903936 CTTGGGGCCTTCCCCAGCCCTGG - Intergenic
1187390549 X:18883995-18884017 CTAGGGGCATCCCCCATCCCCGG + Intergenic
1194301117 X:92187243-92187265 TTAGAGGCTACCCGCAGTCCTGG + Intronic
1199175500 X:144783652-144783674 ACAGGGGCCACACGCAGCCCTGG - Intergenic
1200951283 Y:8902237-8902259 ATAAGGGCCTCCTGCAGCTCAGG - Intergenic