ID: 985514968

View in Genome Browser
Species Human (GRCh38)
Location 5:337720-337742
Sequence CTTCCAAGCGCACTCCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514968_985514976 0 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514968_985514986 22 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514968_985514977 1 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514968_985514984 16 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211
985514968_985514985 19 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514968_985514981 7 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514968_985514979 6 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG No data
985514968_985514987 28 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514968_985514975 -1 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514968 Original CRISPR CTTCCAAGCGCACTCCTTAG GGG (reversed) Intronic
900198636 1:1391424-1391446 CTTCCAAGTGGACTCCTTCAAGG - Intronic
913222071 1:116667666-116667688 CATCCAGGCGCACGCCTCAGGGG + Exonic
921760311 1:218906098-218906120 CTTATAAGTGCACTTCTTAGTGG - Intergenic
1071558286 10:86623928-86623950 CTTACAGGAGCACTCCTAAGAGG + Intergenic
1076204523 10:128586088-128586110 CTTCCAAGCTCACTCATGTGTGG - Intergenic
1078017753 11:7629817-7629839 CTTCCCAGGACACGCCTTAGAGG + Intronic
1080466861 11:32505700-32505722 CTTTCAGGCTGACTCCTTAGTGG + Intergenic
1094812384 12:34151245-34151267 CTTCCAAGCACACTCATTGTGGG - Intergenic
1095723780 12:45429994-45430016 CTTCCAGGAGCACTCCTAGGAGG + Exonic
1101674241 12:106903265-106903287 CTTCTATGCCCACTCCTTGGAGG - Intergenic
1112283024 13:98079420-98079442 TTTCCAAGCCCACTCTTGAGGGG - Intergenic
1112318680 13:98387867-98387889 CTTCCAAGCACACGCCTTCCTGG - Intronic
1115479775 14:33849992-33850014 TTTCCAATCTCACTCCTTATTGG - Intergenic
1121446479 14:93982146-93982168 TTACCAAGCGCACTCCCAAGCGG - Intergenic
1122344467 14:101049996-101050018 CCTCCATGCGGACTCCTTTGAGG + Intergenic
1127901386 15:63343622-63343644 CTTCCAAGGTCCTTCCTTAGAGG + Intronic
1135688199 16:24515206-24515228 CTTCCAATCTCACTCCTTCAAGG - Intergenic
1139480437 16:67227521-67227543 CTTCCAAGGGTACTCCTGAGCGG - Intronic
1140987578 16:80173259-80173281 CTTCCAAGCACATTCATTACAGG + Intergenic
1146481516 17:33208554-33208576 CTTCAAAGTGACCTCCTTAGAGG + Intronic
1147326675 17:39672987-39673009 CTTCCTTGCCCACTCCTTAGGGG - Intronic
1149439423 17:56662450-56662472 CTTCCAACAGCACTCCTTCCAGG + Intergenic
1150443546 17:65210835-65210857 CTCCCAAGCCCACTCATCAGGGG + Intronic
1151084064 17:71360787-71360809 CTACCAACCACACTCCTCAGTGG + Intergenic
1153823954 18:8857167-8857189 CCTCCATGCGGACTCCTCAGCGG + Intergenic
1159966111 18:74597797-74597819 CTTCCAAGGCGACTCCGTAGTGG - Intergenic
1164825620 19:31282896-31282918 CTTTCAAGCGCACACCCTCGTGG + Intronic
926269323 2:11353377-11353399 CTTCCATGCTCACTTCTTGGAGG - Intergenic
930002102 2:46868547-46868569 CTTCCTAGCGCTCTCCTGATGGG + Intergenic
932445246 2:71776950-71776972 CTTCCAAGCTAACTCCCAAGTGG + Intergenic
942073523 2:172336417-172336439 CTTCCAAGACCACTCTTTAAAGG + Intergenic
947106155 2:226669907-226669929 CTTCCAAGCTCACTGATTAACGG + Intergenic
1169293347 20:4371493-4371515 CCTCCAAGGGCATTCCTGAGGGG - Intergenic
1169902789 20:10570334-10570356 CTACCAAGGCCACTCCTGAGTGG - Intronic
1171100387 20:22377764-22377786 CTTCCAAGCTCACTTTTTACTGG + Intergenic
1171330765 20:24337041-24337063 CTTCCAAGGGCACTCATGGGAGG + Intergenic
1172306873 20:33886969-33886991 CATCCAAGCACACTCCTGACAGG - Intergenic
1175710349 20:61215624-61215646 CTTCCCAGTGCACCCCTTAGAGG + Intergenic
1180896325 22:19336208-19336230 CTTCCAAGCTCAGTCGTTATTGG - Intronic
949250243 3:1974758-1974780 CTTCCAAACTCACTCCTATGAGG + Intergenic
949489073 3:4570371-4570393 CTTCCAAAAGCATTACTTAGAGG - Intronic
949506401 3:4732111-4732133 CTTTCACCCGCACTCCTAAGGGG - Intronic
949522820 3:4872353-4872375 CTTCCAAGCTCAGGCCATAGAGG + Intronic
951544151 3:23808506-23808528 CTTCCAGGCTCACTACTCAGTGG - Intronic
958860626 3:99441157-99441179 CTTCCATAAGCACTCCCTAGGGG + Intergenic
961456662 3:127027932-127027954 CTCCCCAGCGCACTCCTGCGGGG - Exonic
969529653 4:7723653-7723675 CTTCAAGGCCCACTCCTGAGTGG + Intronic
973634892 4:52852661-52852683 CTTCAAAGGGCTCTCCTTATGGG + Intergenic
975734917 4:77371750-77371772 CTTCCAAGCTCACTTCTTGTTGG - Intronic
976194248 4:82517949-82517971 CTTGCAAGCTCACTGCTAAGAGG + Intronic
979566166 4:122156370-122156392 CTTCCCTGCCCACTCCTTTGAGG - Intronic
979963278 4:127046911-127046933 ATTCCAAGGGCACTCCTTGTTGG - Intergenic
984480655 4:180297242-180297264 CTTCCAAGCACCCTCATCAGAGG + Intergenic
985514968 5:337720-337742 CTTCCAAGCGCACTCCTTAGGGG - Intronic
986093293 5:4532426-4532448 CTTCCAAGAGTTCTCCTGAGGGG - Intergenic
991421887 5:66450602-66450624 CTTCCATGAGCACTCTTTTGGGG - Intergenic
991776796 5:70093142-70093164 CTTCCAGGCCCACTTCCTAGAGG + Intergenic
991856083 5:70968587-70968609 CTTCCAGGCCCACTTCCTAGAGG + Exonic
991870097 5:71101360-71101382 CTTCCAGGCCCACTTCCTAGAGG + Intergenic
994986246 5:106937362-106937384 ATTTCCAGCACACTCCTTAGAGG + Intergenic
999739010 5:154535063-154535085 CTTCCAGGAGCACTCCTAAGTGG - Intergenic
1002891990 6:1341572-1341594 CTTCCAAGCTCCCTACATAGTGG - Intergenic
1006790814 6:36699878-36699900 ATACCAAGCGCACTCCTAAGTGG + Intronic
1007613328 6:43165087-43165109 CTTCCTTGAGCACTCCATAGTGG + Intergenic
1008728284 6:54448496-54448518 CTTCCAAGAGCATTCATTATAGG - Intergenic
1009478139 6:64120917-64120939 CTTCCAAGCTCACTGATTATTGG + Intronic
1013013664 6:106142422-106142444 CTTCCAAAGTCACTCCTCAGGGG + Intergenic
1013795166 6:113879733-113879755 CTGCCAAGGACACTCCTTAGTGG + Intergenic
1018982192 6:168609963-168609985 CTGCCACGTGCACTCCTGAGAGG - Intronic
1024546669 7:50528265-50528287 TTTCCAGGCACACTCCTCAGTGG - Exonic
1032616137 7:133473372-133473394 TTTCCAAGTGCAATCCTTATTGG + Intronic
1036215621 8:6877583-6877605 CTGCCAGGCTCACTCCTTGGCGG + Intronic
1043056995 8:75451916-75451938 CTTCCATGCTCACTCCTTCCTGG - Intronic
1049555810 8:143281443-143281465 CTGCGAAGCCCTCTCCTTAGGGG - Intergenic
1052489000 9:29139188-29139210 CTTCCAAGCGCACTGGTTGTTGG - Intergenic
1053481291 9:38418351-38418373 CTTCCCAGCCCACTCCTCAAAGG + Intronic
1055317149 9:75045468-75045490 CTTCCCAGCGTACACATTAGGGG + Intergenic
1057215451 9:93225479-93225501 CTTCCAAGCCCACCTCTAAGAGG + Intronic
1060683743 9:125589053-125589075 CTCCCAAGGGCACACATTAGAGG - Intronic
1186768487 X:12794409-12794431 CTTGCAAGCCCAGTCCTTAATGG - Intronic
1187372037 X:18717484-18717506 CCTTCAAGCTCGCTCCTTAGGGG + Intronic
1190115180 X:47621716-47621738 CTTCCTACCCCTCTCCTTAGAGG - Intergenic
1195165041 X:102211162-102211184 CTTCCAAGTGTTCTCCATAGTGG + Intergenic
1195193817 X:102475929-102475951 CTTCCAAGTGTTCTCCATAGTGG - Intergenic
1196756980 X:119166598-119166620 CTTCTCAGCGGACTCCTTAAAGG + Intergenic
1198199254 X:134398964-134398986 CTTCTGAACGCTCTCCTTAGGGG - Intronic
1200045920 X:153401009-153401031 CTTCCAACCGCCCTCCCGAGGGG + Intergenic