ID: 985514969

View in Genome Browser
Species Human (GRCh38)
Location 5:337721-337743
Sequence CCTTCCAAGCGCACTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514969_985514979 5 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG No data
985514969_985514977 0 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514969_985514985 18 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514969_985514984 15 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211
985514969_985514986 21 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514969_985514981 6 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514969_985514987 27 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514969_985514976 -1 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514969_985514975 -2 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514969 Original CRISPR CCTTCCAAGCGCACTCCTTA GGG (reversed) Intronic
913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG + Exonic
920826465 1:209427971-209427993 CCTTCCAAGTGCACACCTGGAGG - Intergenic
1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG + Intergenic
1073261987 10:102197393-102197415 TCTTCCAGTAGCACTCCTTAGGG - Intergenic
1073976367 10:109106284-109106306 CATTCCAAGGGCTCTCCATAAGG + Intergenic
1077197395 11:1288287-1288309 CCTTCCAAGCTCTGCCCTTAGGG - Intronic
1078780679 11:14436212-14436234 CCTGCCAATTTCACTCCTTAGGG + Intergenic
1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG + Intronic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1097233117 12:57523853-57523875 CTTTCCAAGCCCAGTCCCTAGGG - Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1113391559 13:109902536-109902558 ACTTCTAAGTGCACACCTTAGGG + Intergenic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG + Intergenic
1124955264 15:34356118-34356140 CCTTCCCAGGGCACTGCTAAAGG - Exonic
1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG + Intronic
1138657726 16:58500629-58500651 CCATCCAAGCGCACACCAGAGGG - Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG + Intronic
1147326676 17:39672988-39673010 CCTTCCTTGCCCACTCCTTAGGG - Intronic
1153989840 18:10386411-10386433 CCTTACAAGCTCATTCCTCAGGG - Intergenic
1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG + Intergenic
930002101 2:46868546-46868568 CCTTCCTAGCGCTCTCCTGATGG + Intergenic
930362568 2:50400379-50400401 CCCCCCAATAGCACTCCTTATGG - Intronic
932624942 2:73290063-73290085 CCTTCCAAGTGAACTCTTCATGG - Intergenic
935390912 2:102551863-102551885 CCTTCCAAGCACATTCTTTTTGG - Intergenic
937580954 2:123487460-123487482 CCTTCCAAGCTCCGTCCTTGTGG + Intergenic
942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG + Intergenic
1169293349 20:4371494-4371516 CCCTCCAAGGGCATTCCTGAGGG - Intergenic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1181826386 22:25519680-25519702 CCTTGCTAGCGTACTCCTCATGG + Intergenic
1182950401 22:34369801-34369823 CCTTACAAGAGAGCTCCTTAAGG - Intergenic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
950770561 3:15307517-15307539 CCTTCTAAGAGCCCTCCCTATGG - Intronic
952929181 3:38346620-38346642 CCTTCGAAGCGCACCCCCTCTGG - Intergenic
958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG + Intergenic
958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG + Intergenic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
962482032 3:135806305-135806327 CATTCCAAGCGGACTCCCTGGGG + Intergenic
965429104 3:168564705-168564727 CTTTCCAGGGGCACTCCATAAGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
973634891 4:52852660-52852682 ACTTCAAAGGGCTCTCCTTATGG + Intergenic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
983795540 4:171857469-171857491 CCTTATCAGCCCACTCCTTATGG - Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986093294 5:4532427-4532449 CCTTCCAAGAGTTCTCCTGAGGG - Intergenic
986294301 5:6424323-6424345 CCTTCCAAACGCATTCCTGCTGG - Intergenic
988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG + Intergenic
989099749 5:37812799-37812821 CCAAACAAGTGCACTCCTTACGG + Intronic
1000104040 5:158041801-158041823 CCACCCAAGTGCACTCCATATGG - Intergenic
1010603152 6:77855494-77855516 TCTTCCAAGCATACTCATTAAGG - Intronic
1014202657 6:118622888-118622910 CCTTCCATGGGCACTTCTAAAGG - Intronic
1023248824 7:38235684-38235706 CCTACCAGGGGCTCTCCTTATGG - Intergenic
1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG + Intronic
1024221690 7:47293756-47293778 CCTTTCAACCGCACTCCCTTCGG + Exonic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1035378026 7:158419857-158419879 ACTTCAAAGCCCACTCCTGAAGG + Intronic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1049295723 8:141835441-141835463 CCTTCCAAGGTCACACCTCAAGG - Intergenic
1049555811 8:143281444-143281466 CCTGCGAAGCCCTCTCCTTAGGG - Intergenic
1050578305 9:7023150-7023172 ACTTCCAAGCTCACTCCGTGAGG - Intronic
1055317148 9:75045467-75045489 CCTTCCCAGCGTACACATTAGGG + Intergenic
1056438110 9:86592813-86592835 ACTTCCAAGCTCACTCCTATGGG + Intergenic
1059803723 9:117775992-117776014 CCTTCAAAGCCCACTCCAAATGG + Intergenic
1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG + Intronic
1193478781 X:82000377-82000399 CCTCCCAAGAGCACTCTTAAAGG - Intergenic
1197446166 X:126553572-126553594 CCTTCCACTCCCTCTCCTTAGGG - Intergenic
1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG + Intergenic