ID: 985514971

View in Genome Browser
Species Human (GRCh38)
Location 5:337722-337744
Sequence CCCTTCCAAGCGCACTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514971_985514976 -2 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514971_985514987 26 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514971_985514975 -3 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
985514971_985514979 4 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG No data
985514971_985514985 17 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514971_985514984 14 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211
985514971_985514986 20 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514971_985514981 5 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514971_985514977 -1 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514971 Original CRISPR CCCTTCCAAGCGCACTCCTT AGG (reversed) Intronic
900299243 1:1968913-1968935 CCCTCCCTAGCGCCCTCCTGGGG + Intronic
902567641 1:17323073-17323095 CACTTCCAAGCCCACTCATATGG + Intronic
917615653 1:176741277-176741299 CACTTCCAAGCTCACTCCTGTGG + Intronic
919402239 1:197133707-197133729 CCACTCCAAGCTTACTCCTTAGG + Intronic
922343932 1:224680407-224680429 CACTTCAAAGCACAGTCCTTTGG - Intronic
1065944103 10:30591554-30591576 CCCTTCCACACACTCTCCTTTGG + Intergenic
1067224368 10:44365893-44365915 CACTTCCATGAGCATTCCTTTGG - Intergenic
1069580640 10:69563763-69563785 CACTTCCAAGCCCACTCGTGTGG - Intergenic
1071064940 10:81620452-81620474 CCATTACACGTGCACTCCTTAGG + Intergenic
1071530476 10:86387500-86387522 CCCTTCAAAGCGCACACTGTGGG + Intergenic
1072630215 10:97140399-97140421 CCCCTCCCACCGCCCTCCTTGGG + Intronic
1074364898 10:112849914-112849936 CCCTTCCCAGCTCTCCCCTTAGG - Intergenic
1076442621 10:130490822-130490844 TCCTTCCAGGCGCTCACCTTTGG + Intergenic
1077197397 11:1288288-1288310 CCCTTCCAAGCTCTGCCCTTAGG - Intronic
1078543719 11:12231234-12231256 CCATTCTGAGCCCACTCCTTGGG + Intronic
1078780677 11:14436211-14436233 CCCTGCCAATTTCACTCCTTAGG + Intergenic
1079022913 11:16924084-16924106 CCCTTCCACTCCCACTCATTAGG + Intronic
1079824648 11:25175455-25175477 CCCTTACAAGCTCCCTCCCTGGG + Intergenic
1083626274 11:64073714-64073736 GCCTCCCAAACACACTCCTTGGG + Intronic
1084271369 11:68031007-68031029 CCCTAACAGGCCCACTCCTTTGG - Intronic
1086164743 11:83764452-83764474 CCCTTCCCTGCACACCCCTTTGG - Intronic
1088075464 11:105843138-105843160 CTCTTCCAAGCGCTCTGCCTTGG + Intronic
1088599768 11:111463832-111463854 CACTTCCAAGCTCACTCTTATGG + Intergenic
1089896117 11:121931881-121931903 CCCTTCTAAGTACTCTCCTTGGG - Intergenic
1093007782 12:14069033-14069055 CACTTCCAAGCTCACTCATGTGG - Intergenic
1097233118 12:57523854-57523876 CCTTTCCAAGCCCAGTCCCTAGG - Intronic
1100745955 12:97645950-97645972 TGCTTCCAAGCTCACTCCTGTGG - Intergenic
1102461884 12:113104998-113105020 CGCTTCCAAGGTCACTCATTGGG + Intronic
1103037952 12:117671725-117671747 CGCTCTTAAGCGCACTCCTTGGG - Intronic
1104477630 12:129083614-129083636 TCCTTGCAAGCTCATTCCTTTGG - Intronic
1106758170 13:32842918-32842940 CACTTCCAAGCCCACTCATATGG - Intergenic
1109391336 13:61697549-61697571 CTCTTCCAAGCACACTCCCAAGG + Intergenic
1113391558 13:109902535-109902557 CACTTCTAAGTGCACACCTTAGG + Intergenic
1114650989 14:24284527-24284549 CCCCACCAAGCGCACTCCCCTGG - Intergenic
1119623097 14:76147820-76147842 CCCTTGCTTGCCCACTCCTTTGG - Intergenic
1119924977 14:78484962-78484984 ACCTTGCCAGCACACTCCTTTGG + Intronic
1121994925 14:98594251-98594273 CCCTTCTAAGCACATTTCTTTGG - Intergenic
1128459991 15:67859794-67859816 CCCTGCCAAGGCCCCTCCTTTGG - Intergenic
1129017711 15:72483199-72483221 CCCTTCCGAGCTCACTCATTTGG + Intronic
1129703467 15:77781346-77781368 CACTTCCAAGCAGCCTCCTTCGG - Intronic
1132247210 15:100306869-100306891 CCCTTCTAAGAGCAATTCTTTGG - Intronic
1136172913 16:28499083-28499105 CCCTCCCAACCGCCTTCCTTTGG - Intergenic
1144022474 17:11249598-11249620 CCCTTCCAAGCAGTCACCTTGGG + Intronic
1145023931 17:19453456-19453478 TCCTTCCAAGCACATTCCCTTGG - Intergenic
1145902562 17:28498055-28498077 CCGTTCCCAGAGCACTCCCTGGG + Intronic
1147326678 17:39672989-39673011 CCCTTCCTTGCCCACTCCTTAGG - Intronic
1149696645 17:58621509-58621531 TCTTTCCAAGCACACCCCTTTGG + Intronic
1150343098 17:64384622-64384644 TGCTTCCAAGCTCACTCCTGTGG - Intronic
1151838847 17:76602897-76602919 TCATTGCAAGGGCACTCCTTGGG + Intergenic
1153006044 18:499880-499902 CCCTTCCACGTGCCCGCCTTGGG - Intronic
1155685894 18:28550213-28550235 TACTTCCAAGCTCACTCATTTGG + Intergenic
1158499494 18:57987328-57987350 CCCTCCCAGTCTCACTCCTTAGG + Intergenic
1159587044 18:70290878-70290900 CCCACCCAAGCGCACACCCTCGG + Intronic
929608715 2:43253928-43253950 ACCTTCCATTCGCCCTCCTTTGG + Intronic
932522329 2:72427330-72427352 CCCTCCCAAGCGCAGGACTTGGG + Intronic
936859303 2:116997406-116997428 CCCTACCAAGCGCTCTTCTGGGG + Intergenic
937757451 2:125557282-125557304 CTCTTCCCAGCTCACTCCTATGG - Intergenic
939414204 2:141872092-141872114 TCCTTCCAAGCTCTCTCTTTAGG - Intronic
942801628 2:179882760-179882782 TCCTTCCTAGCTAACTCCTTTGG - Intergenic
943791156 2:191933875-191933897 CACTTCCAAGCTCACTCCTGTGG + Intergenic
944675261 2:202030149-202030171 CACTTCCAAGCTCACTCATGTGG - Intergenic
1169293351 20:4371495-4371517 CCCCTCCAAGGGCATTCCTGAGG - Intergenic
1174313075 20:49674568-49674590 CCCTTCCATGAGCAGTCCTGCGG - Intronic
1174682064 20:52418061-52418083 CCCTTCCAAGCTCAGTCCCATGG + Intergenic
1176143120 20:63553821-63553843 CCAGTCCGAGCGCACTCCTCGGG - Exonic
1178585167 21:33865508-33865530 CCTCTCCAAGCCCACCCCTTTGG - Intronic
1178937944 21:36880823-36880845 CCCCTCCCAGAGCACTCCTTAGG + Intronic
1181855061 22:25775403-25775425 CCCTCCCTAGCGCAGTCCTTTGG - Intronic
1184552205 22:45210436-45210458 CCCTGCCAAGGGCACTCATATGG + Intronic
1184835145 22:47016523-47016545 CCCTTCCCAGCCCAGTCCTCAGG - Intronic
954886899 3:53882515-53882537 CTTTTCCAGGCACACTCCTTGGG + Intergenic
955386968 3:58488004-58488026 CCCTTCCAAACTCACTCATGTGG - Intergenic
962482031 3:135806304-135806326 CCATTCCAAGCGGACTCCCTGGG + Intergenic
962735811 3:138324181-138324203 CACTTCCAAGCTCACTCATGAGG - Intronic
962982558 3:140503876-140503898 TCCTTCCAAGGGGGCTCCTTAGG + Intronic
963042899 3:141082267-141082289 TCCTGCCAGGCGCACTCCCTGGG - Intronic
967630772 3:191741133-191741155 GCCTCCCAATAGCACTCCTTAGG - Intergenic
969856500 4:10003980-10004002 CCCTCCCAAGCTCACACCATTGG + Intronic
979026115 4:115578487-115578509 GCCTACCAAGTGCACTACTTTGG + Intergenic
979292248 4:118991008-118991030 CCCTTCCAAGTCAACTCCTTTGG + Intronic
981136898 4:141220817-141220839 CCCTTCCCCGCCCACTCCTGCGG - Intergenic
983274961 4:165605688-165605710 CACTTCCAAGCTCACTCATTAGG + Intergenic
985514971 5:337722-337744 CCCTTCCAAGCGCACTCCTTAGG - Intronic
986411887 5:7489077-7489099 CCCTGCCCAGAGCACTCCTGAGG + Intronic
1002345790 5:178546814-178546836 GCCTGCCAAGCCCACACCTTTGG - Intronic
1003393818 6:5736113-5736135 CCCTTCCAAGCTCAGTCAGTCGG + Intronic
1007796923 6:44356574-44356596 CACTTCCAAGCTCACTCATATGG + Intronic
1012420877 6:99063868-99063890 CACTACCTAGAGCACTCCTTGGG + Intergenic
1014802431 6:125791285-125791307 CCCTTCCCCGCCCACCCCTTGGG + Intronic
1017856468 6:158354091-158354113 TCCTTCCAAAGGCACTCCTCAGG - Intronic
1018369637 6:163156032-163156054 CCCTTCGCAGCGCTCTCCTGAGG + Intronic
1019046992 6:169156876-169156898 GGCTTCCAAGCACACTCCTGCGG - Intergenic
1019601380 7:1885496-1885518 CCCTTCCGACCGCACCCCTGTGG - Intronic
1023385285 7:39650607-39650629 CCCTTCCAAGAACCCGCCTTAGG - Intronic
1028818241 7:95174965-95174987 CGCTTCCCAGCGAACTCATTTGG + Intronic
1030120222 7:106102533-106102555 CCCTTCCAAGCTCAGTCATGTGG - Intronic
1035947243 8:3978843-3978865 CCCTTCCCAGCGCTCCCATTAGG + Intronic
1048300953 8:133250785-133250807 CCCTTCCAAACTCATTACTTTGG + Intronic
1049539518 8:143201595-143201617 GCCTTCCATGAGCACTCTTTAGG - Intergenic
1049920035 9:354646-354668 CACTTCCAAGCTCACTCATGTGG + Intronic
1050522134 9:6511921-6511943 CACTTCCAAGCTCACTTCTGTGG - Intergenic
1053505906 9:38642983-38643005 CCTTCCCAAGCTGACTCCTTAGG - Intergenic
1055317146 9:75045466-75045488 CCCTTCCCAGCGTACACATTAGG + Intergenic
1056437939 9:86591048-86591070 GACTTCCAAGCTCACTCCTGTGG + Intergenic
1056438109 9:86592812-86592834 AACTTCCAAGCTCACTCCTATGG + Intergenic
1058071558 9:100605769-100605791 CCCTTCCATGCCCAATCCTTTGG - Intergenic
1186595517 X:10977162-10977184 CCTTTCCAAGCGAATTCATTGGG + Intergenic
1187372033 X:18717482-18717504 CCCCTTCAAGCTCGCTCCTTAGG + Intronic
1187426592 X:19182855-19182877 CCCTTCCAAGCATACTCATGTGG + Intergenic
1189274014 X:39771722-39771744 CCTTTCCAAGCCTTCTCCTTGGG - Intergenic
1196813026 X:119643632-119643654 CATTTCCCAGCGCTCTCCTTTGG + Intronic