ID: 985514975

View in Genome Browser
Species Human (GRCh38)
Location 5:337742-337764
Sequence GGGGGCTCCCTTCCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514965_985514975 15 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
985514971_985514975 -3 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
985514969_985514975 -2 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
985514968_985514975 -1 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514975 Original CRISPR GGGGGCTCCCTTCCCAAAGC TGG Intronic
900114300 1:1021892-1021914 GTGGGCCCCCTTCCCAAATTCGG + Intronic
901749640 1:11397820-11397842 GGAGGCTTCCTTCCCAGGGCTGG + Intergenic
903318597 1:22527866-22527888 CGGGGCTGCCTGCACAAAGCCGG - Exonic
903451425 1:23456108-23456130 GGAGGCTCACTTACCAAGGCCGG + Exonic
905215146 1:36401479-36401501 GGTGGCTCCTTTCCGCAAGCAGG + Intergenic
905455928 1:38087842-38087864 GGGGGCTCACATCCCAGATCCGG - Intergenic
905730958 1:40299433-40299455 GGGTTCTCCCTTCCCTAGGCTGG - Intergenic
908316059 1:62933764-62933786 GGAGGCTCCATTGCAAAAGCAGG + Intergenic
912601149 1:110934441-110934463 GGGGGCTCCCTTCCGACACAGGG - Intergenic
913960850 1:143337143-143337165 GGGGTCCACCTTCCCAGAGCTGG - Intergenic
914055204 1:144162715-144162737 GGGGTCCACCTTCCCAGAGCTGG - Intergenic
914123942 1:144803646-144803668 GGGGTCCACCTTCCCAGAGCTGG + Intergenic
914813849 1:151048615-151048637 GGGGGCACTCTTCCCGAAGTCGG - Exonic
914908922 1:151769210-151769232 AGGGGCTCACTTCCCAAAAGGGG + Intronic
916256118 1:162789749-162789771 TGGTGCTGGCTTCCCAAAGCTGG - Intergenic
919299106 1:195738471-195738493 GAGGGCCCCCTTCCCCAACCAGG + Intergenic
920053588 1:203177711-203177733 GGGGCCACCCTTCCCCCAGCCGG - Intergenic
921949976 1:220919395-220919417 GGAGGTTCCCTTGCCCAAGCAGG + Intergenic
922764680 1:228150741-228150763 GGGGGCCCCCATCCCAGAGCTGG + Intronic
1066722581 10:38355403-38355425 TGGTGCTGGCTTCCCAAAGCTGG - Intergenic
1067029289 10:42869398-42869420 GGGGTCCACCTTCCCAGAGCTGG - Intergenic
1069563917 10:69450896-69450918 GGAGGAACCCTTCCCAAGGCTGG + Intergenic
1070226712 10:74515734-74515756 CTGGGCTCCCTTCTCTAAGCAGG - Intronic
1073318641 10:102600253-102600275 GGGGGCTGGCAGCCCAAAGCAGG + Intronic
1074866245 10:117545853-117545875 GTGCGCCCCCTCCCCAAAGCTGG + Intronic
1075957109 10:126533590-126533612 GGGGGCTCCCGTCCCCAAGAGGG - Intronic
1076705703 10:132300374-132300396 GGGGGCTCCCTCCTCACAGGTGG + Intronic
1077167708 11:1151266-1151288 GGTGCCTCCCCTTCCAAAGCCGG + Intergenic
1078099927 11:8323935-8323957 GGAGGCTGACTTCCCAAATCTGG + Intergenic
1080690017 11:34548711-34548733 GGGGGCTCCCATCCCGGAGGTGG + Intergenic
1081324592 11:41728998-41729020 GTGGGCACCCCTCCCCAAGCTGG + Intergenic
1082820779 11:57543415-57543437 GGGGGCTTGCTTCCAGAAGCAGG - Intronic
1083625621 11:64070595-64070617 AGGGGCCCCCTTCCCAGAGGAGG + Intronic
1083961332 11:66016489-66016511 TGGGCCTTCCTCCCCAAAGCAGG + Intergenic
1085032704 11:73282324-73282346 GGGAGATCCCTTTCTAAAGCAGG - Intronic
1085282756 11:75341708-75341730 GAGGGCTCCCTCCCCAGGGCTGG - Intronic
1085644524 11:78214392-78214414 GGGGGCTAGCTTCTCACAGCAGG + Exonic
1090395107 11:126413841-126413863 GGGAGCTCCCTTCCCCAGGCTGG - Intronic
1090636007 11:128690983-128691005 AGGGGCAGCCTTCCCCAAGCTGG + Intronic
1091856567 12:3745429-3745451 AGGGGCTTTCTTCCCAAGGCAGG - Intronic
1092532088 12:9353163-9353185 GGGGGCTCCCCTGCTAAAGATGG + Intergenic
1103728921 12:123013218-123013240 TGGGGCTCCCTTCCCCACGCTGG - Intronic
1103918199 12:124386606-124386628 GGAGGGTCTCTTCCCACAGCAGG - Intronic
1104797133 12:131527781-131527803 GGGAGATCCCATCCCAGAGCAGG + Intergenic
1111108197 13:83673476-83673498 GCAGGGTACCTTCCCAAAGCTGG - Intergenic
1113064443 13:106359067-106359089 GGGGGCTCCCCACCCAGTGCAGG + Intergenic
1113668941 13:112162164-112162186 GGAGGCTCCCTGCCCACAGAAGG - Intergenic
1117407336 14:55417045-55417067 GGGGGCGCCCTTTCCCAAGAGGG + Intronic
1122414877 14:101544595-101544617 GGGAACCCCATTCCCAAAGCAGG + Intergenic
1122833942 14:104421810-104421832 GGGGGGTCCCTTCATAGAGCAGG + Intergenic
1122923120 14:104888091-104888113 GGAGCCTCTGTTCCCAAAGCTGG + Intronic
1123114942 14:105890394-105890416 GGTGGCTGCATTCCCAGAGCAGG + Intergenic
1123121419 14:105918704-105918726 GGTGGCTGCATTCCCACAGCCGG + Intronic
1123184680 14:106505518-106505540 GAGGGCTCACTTCCCCATGCAGG - Intergenic
1123205902 14:106713191-106713213 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1123210982 14:106760596-106760618 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1123398685 15:19962933-19962955 GAGGGCTCCCTCCCCGATGCAGG - Intergenic
1123481578 15:20637641-20637663 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1127884686 15:63189278-63189300 GGGGCCTCCCTTCCCAGCTCGGG + Intergenic
1129267204 15:74400114-74400136 GGGGGCTGCTCTCCCACAGCAGG - Intergenic
1132313061 15:100871063-100871085 GGGGCCTCACATCCCAAAGTGGG + Intergenic
1134351288 16:13440210-13440232 GGGGGCTCCCTTTCCTCAGAAGG + Intergenic
1136188001 16:28599439-28599461 GGGCACCCTCTTCCCAAAGCTGG + Intergenic
1136190473 16:28612433-28612455 GGGCACCCTCTTCCCAAAGCTGG + Intronic
1136355824 16:29744468-29744490 GGGGCCTCCCCTCCCAGGGCTGG + Exonic
1139589777 16:67927175-67927197 GGGGCCTCCCCGCCCAACGCTGG - Intronic
1139848940 16:69939284-69939306 GAGACGTCCCTTCCCAAAGCAGG - Intronic
1140094235 16:71861292-71861314 GGAGCCTCCATTCCCACAGCAGG - Intronic
1141176178 16:81720767-81720789 GGGGCAGCCCTTCCCAAGGCAGG + Intergenic
1142525329 17:536207-536229 GGGAGCTCCCTGGCCAAGGCAGG - Intronic
1145234043 17:21196228-21196250 TGGGGCTCCCTTTCCAAACCTGG + Intergenic
1145794508 17:27647756-27647778 GGGTGCTTCCTGCGCAAAGCAGG - Intronic
1146482893 17:33219272-33219294 GGGGGCTGCCTTCTGAATGCTGG - Intronic
1146798101 17:35797031-35797053 CAGAGCTCCCTGCCCAAAGCAGG + Intronic
1148588668 17:48799222-48799244 GAGGGCTCCCTCCCCACAGTGGG + Intronic
1149060988 17:52421563-52421585 AGGGGCTTCCTTACCAAAGTGGG + Intergenic
1149328289 17:55555674-55555696 GGGGGCACCCTCCTCAAATCTGG + Intergenic
1150251339 17:63706413-63706435 CCGGGCTCCCCTCCCCAAGCTGG + Intronic
1151884825 17:76917337-76917359 CGGGGGTGCCTTCCCACAGCAGG + Intronic
1151977462 17:77490669-77490691 GGGGGCACCCACCCCCAAGCAGG - Intronic
1152559025 17:81068660-81068682 GGGGGCACCCTCCCCAGGGCAGG - Intronic
1152714148 17:81890582-81890604 GAGGGCTCCCTTCGCTAAGGCGG + Intronic
1152849641 17:82625306-82625328 GGGCACTCCCTTCTCCAAGCAGG - Intronic
1152938456 17:83153724-83153746 GGGGGCTCCCTCCCCCCAGCGGG - Intergenic
1153697627 18:7660460-7660482 GGGGAACCCCTTCCCAAAGTAGG + Intronic
1156361616 18:36388937-36388959 GGGAGCTGGCTTCCCAAAGCTGG - Intronic
1157447077 18:47754143-47754165 GGGGGCTCCCCGCCCACAGGTGG + Intergenic
1157993964 18:52532747-52532769 GAGGGCCACCTTCCCAAACCTGG + Intronic
1158505124 18:58040846-58040868 GGGGTCTCCCTTGCCCAGGCTGG - Intergenic
1158527165 18:58225395-58225417 GGCTGCTCCCTGCCCAAGGCGGG - Intronic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1162794150 19:13078111-13078133 GTGTGCTCCCTTCCCTAAACGGG + Intronic
1163618069 19:18341208-18341230 GGGGGCTACTCTCCCAAGGCAGG + Intronic
1163619230 19:18348236-18348258 GGGGTGTCTCTTGCCAAAGCTGG + Intronic
1164507082 19:28869669-28869691 GGGGGCTCCCCTCACAGAGAAGG - Intergenic
1164578997 19:29422817-29422839 GGGGGGTCCCTTACCAAGGCTGG - Intergenic
1165690852 19:37862172-37862194 AAGGGCTCCCTCCCCAAAGCTGG + Intergenic
1165709869 19:38003475-38003497 TGGGGATCCCTGCCCACAGCCGG - Intronic
1165976166 19:39678732-39678754 GGGGGCTCCCTTCCCCTATTTGG + Intergenic
1166924953 19:46260915-46260937 GGAGCCCCCCTTCCCCAAGCTGG - Intergenic
1202694686 1_KI270712v1_random:115392-115414 GGGGTCCACCTTCCCAGAGCTGG - Intergenic
926576793 2:14591276-14591298 GTGGGCTCCTTTCCCAAGGAGGG + Intergenic
927574825 2:24192219-24192241 TCGAGCTGCCTTCCCAAAGCTGG - Intronic
929155469 2:38784886-38784908 GGGAGATTCCTCCCCAAAGCTGG + Exonic
932788117 2:74626119-74626141 GGGGACTCCCTTCCCGAGGCTGG - Intronic
932966180 2:76477783-76477805 GGGGGGTCTCTTGCCCAAGCTGG - Intergenic
934275858 2:91572438-91572460 GGGGTCCACCTTCCCAGAGCTGG - Intergenic
934937799 2:98477845-98477867 TGTGGCTCTCTTCCCACAGCAGG - Intronic
935090477 2:99890855-99890877 GGGGCCTGCCTTCCCCAGGCTGG + Intronic
939535804 2:143426697-143426719 GGGGACTCGCTACCCAAAGTTGG - Intronic
940877359 2:158911290-158911312 AGGGTCTCCCTTGCCCAAGCTGG + Intergenic
941357346 2:164510711-164510733 GTGGGCTCCCTTCTAAAACCAGG - Intronic
942133955 2:172906984-172907006 AGGGGCTCCCTGCCCCAGGCAGG + Intronic
946246843 2:218392785-218392807 GGGAGCTCCCATCCCATAGCTGG - Intronic
947867946 2:233414347-233414369 AGGGGCTCCCTTATCAAAGCTGG + Intronic
948427110 2:237895212-237895234 TGGGGCTCCCATCCAAAGGCAGG + Intronic
948638685 2:239359556-239359578 TGGGGACCCCTTCCCAGAGCTGG + Intronic
1170155212 20:13262969-13262991 GCAGGCTCCATTCCCAAACCAGG + Intronic
1172839321 20:37892711-37892733 GGCGCCTCCCTTTGCAAAGCTGG - Intergenic
1173621837 20:44442772-44442794 TGGGGAGCCCTTCCCAAGGCCGG - Intergenic
1174452488 20:50628842-50628864 GGGGGCTCCCTTCCCATGGGTGG - Intronic
1175271164 20:57735080-57735102 GGGGGCCCCCAGCCCAGAGCAGG - Intergenic
1175791936 20:61745340-61745362 GGTCCCTCCCTTCCCAAAGTGGG - Intronic
1175986244 20:62765450-62765472 GGAGGCTCCCTACACACAGCTGG - Intergenic
1176745376 21:10647676-10647698 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1178454171 21:32731784-32731806 GGGGGCTAGAGTCCCAAAGCAGG + Intergenic
1184331316 22:43829629-43829651 GCGGGCTCCCTGCCCAGTGCAGG - Intronic
950450098 3:13060586-13060608 GGGGGCCACCTGCCCAAGGCTGG + Intronic
950518088 3:13480322-13480344 GGGGCCGGCCCTCCCAAAGCTGG - Exonic
950644553 3:14369324-14369346 GGGGGCTCACTTTCCAAGGAAGG + Intergenic
954633069 3:52057246-52057268 TCGCGATCCCTTCCCAAAGCTGG - Intergenic
955840742 3:63110173-63110195 GGGGGCCACCTTCCCAAGGCTGG - Intergenic
959472753 3:106773109-106773131 GGGGGCTTCCTTCCCAAGGCTGG + Intergenic
961507382 3:127379029-127379051 GGGGGGTCCCTTCCGGAAGTTGG + Intergenic
964094253 3:152913060-152913082 GGGGGCTCCTTTCTGGAAGCTGG + Intergenic
965615027 3:170585225-170585247 GGAAGCTCCCTGCCCAGAGCCGG - Intronic
966200027 3:177352533-177352555 GAGGGCTTCCTTCCCAACGTCGG + Intergenic
969408416 4:7011186-7011208 GTGGGCACACTTCACAAAGCAGG - Intronic
969487415 4:7480073-7480095 GGGGGCTTCCTGCCCAAAGGAGG - Intronic
972987865 4:44786957-44786979 GGGGGCTTCCTCTCCAGAGCTGG + Intergenic
976142862 4:82010756-82010778 GGTGGTTCTCTTCCCAAAGTGGG - Intronic
976318584 4:83685867-83685889 AGGGGCTTTCTTCCCAAACCTGG - Intergenic
978587662 4:110291568-110291590 GGGTGGTGCCTTCCCAGAGCCGG + Intergenic
978739809 4:112123861-112123883 GGGGGCCCCCTCCCCAGACCTGG + Intergenic
981858797 4:149329078-149329100 GGTAGCTCTCTTCCCAAAGAGGG - Intergenic
985274756 4:188227140-188227162 TGGGGCCGACTTCCCAAAGCAGG - Intergenic
985514975 5:337742-337764 GGGGGCTCCCTTCCCAAAGCTGG + Intronic
985543675 5:498766-498788 AGGGGCACTCTTCCCAAAGCGGG - Intronic
985673629 5:1219147-1219169 GGGGGCTGCCATCCCACAGGTGG - Intronic
987654949 5:20795633-20795655 GAGGGCTCCCTCCCCCAACCAGG + Intergenic
988740697 5:34066304-34066326 GAGGGCTCCCTCCCCCAACCAGG - Intronic
990386129 5:55264626-55264648 GGGCTCTCACTTCCCAAAGAGGG + Intronic
995797916 5:115961709-115961731 GGGGTTTCCCTTCCTGAAGCCGG - Intergenic
998787497 5:145728477-145728499 GTGTTCTCCCCTCCCAAAGCAGG + Intronic
999656082 5:153811840-153811862 GTGGGCTGCCTTCCCCAAGTGGG + Exonic
1001018391 5:168162362-168162384 AGAGGCAACCTTCCCAAAGCGGG - Intronic
1001486060 5:172120380-172120402 GGGGCCTGGCTTCCCAGAGCAGG - Intronic
1002535456 5:179873293-179873315 GGGAGCCTCCTTCCCACAGCTGG + Intronic
1003816904 6:9851554-9851576 TGGTGCTCCCTTCACAAAACTGG + Intronic
1006381040 6:33697345-33697367 GGGGGCTCCCGTGGCAATGCAGG + Exonic
1006737471 6:36284733-36284755 GGGGGCTACCTTCCTAAGGTGGG + Intronic
1007531595 6:42547743-42547765 GGGGGCGCCCTTGCCCAGGCTGG - Intergenic
1007702071 6:43771394-43771416 GGGGGCTCCGTGCCCCACGCGGG + Intronic
1019733790 7:2640823-2640845 GGGCCCTCCCTTCTCCAAGCAGG + Intronic
1020093181 7:5352763-5352785 GCAGGCTCCCCTCCCAAAGCTGG - Intronic
1022386171 7:29901208-29901230 ATGGGCTCCCTTCCCACAGAAGG - Intronic
1022798129 7:33749079-33749101 GGGTGTCCCCTTCCCAAAGATGG - Intergenic
1023841669 7:44101777-44101799 GGGGGCACCCTCCCCAGCGCAGG + Intergenic
1025019239 7:55467731-55467753 GGGGTCTCCTTTCCCATAGGTGG + Intronic
1026740752 7:72976719-72976741 GGGGGCTGTCCTCCCAGAGCGGG + Intergenic
1027102981 7:75388352-75388374 GGGGGCTGTCCTCCCAGAGCGGG - Intergenic
1028530880 7:91837480-91837502 GAGGGCTGCCTCCCCAAGGCTGG + Intronic
1033686085 7:143642685-143642707 GGGGGCTCCCTTTCCCAGGTGGG + Intronic
1033689653 7:143724630-143724652 GGGGGCTCCCTTTCCCAGGTGGG - Exonic
1033698528 7:143814936-143814958 GGGGGCTCCCTTTCCCAGGTGGG - Intergenic
1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG + Intronic
1040322989 8:46327890-46327912 GGTGGCTCAGTTCCGAAAGCAGG - Intergenic
1044837986 8:96314436-96314458 GGGGGGTCCCTTCCCAGCACAGG + Intronic
1049224196 8:141441837-141441859 GTGGGCACCCTTCCCAGGGCAGG - Intergenic
1049233130 8:141494531-141494553 GGGGGCCCTCTCCCCAAAGGAGG - Intergenic
1052623543 9:30944509-30944531 TGGGGCTCCTTTCCCCAGGCAGG - Intergenic
1058280162 9:103103790-103103812 GGGAGCTCCTTTCCCCAGGCAGG - Intergenic
1060478295 9:124000909-124000931 GGGGACTCCTCACCCAAAGCAGG + Intergenic
1060894493 9:127209008-127209030 GGAGTCCCCCTTCCCAGAGCAGG - Intronic
1062275471 9:135728423-135728445 GGGGTCTCACTTCCCAAGGAGGG - Intronic
1062628452 9:137453362-137453384 AGGGTCTCCCTTCCCACATCAGG - Intronic
1188085417 X:25896503-25896525 AGGGGCTCCCTTCCCCCCGCAGG + Intergenic
1189307849 X:40000574-40000596 AGGGGTTCCCTTCCCAAATAAGG - Intergenic
1190582674 X:51903756-51903778 GGGGACTCCATTACCCAAGCTGG - Intergenic
1194419047 X:93649823-93649845 GAGGGCCCCTTTCCCAAAGCAGG - Intergenic
1195201479 X:102554329-102554351 GGGGGCTCAGTTCCCAAGACTGG + Intergenic
1199035905 X:143050735-143050757 GGGAGCTCCATCCCCCAAGCAGG - Intergenic