ID: 985514976

View in Genome Browser
Species Human (GRCh38)
Location 5:337743-337765
Sequence GGGGCTCCCTTCCCAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514971_985514976 -2 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514969_985514976 -1 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514968_985514976 0 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154
985514965_985514976 16 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514976 Original CRISPR GGGGCTCCCTTCCCAAAGCT GGG Intronic
900316870 1:2061352-2061374 GGGCCTCCCTTCCCTACGCAAGG - Intronic
900795111 1:4703092-4703114 GGAGCTCCCTTCCAAAAGGGAGG + Intronic
904809052 1:33151449-33151471 GGGGCTCCCTCCCCGAGGCTAGG + Intronic
911154681 1:94626148-94626170 GTGACTTCCTCCCCAAAGCTAGG + Intergenic
912367779 1:109149228-109149250 GGGGCTCCTTTCTCTCAGCTGGG + Intronic
1063024871 10:2168105-2168127 GGGTCTTCCTCCCCACAGCTTGG - Intergenic
1064135874 10:12750459-12750481 GGGGGTCCCTGCACAAAGCCAGG + Intronic
1069563918 10:69450897-69450919 GAGGAACCCTTCCCAAGGCTGGG + Intergenic
1070724771 10:78780454-78780476 TTGGTTCCCTTCCCGAAGCTGGG + Intergenic
1070742087 10:78909914-78909936 AGTGCTCCCTTCCCTAAGCTAGG + Intergenic
1071274932 10:84044845-84044867 GGGGTGCCCTCCCCAAAGATGGG - Intergenic
1074347144 10:112698218-112698240 AGGGTTCCTTTCCCACAGCTAGG - Intronic
1077297383 11:1832514-1832536 GGGTCTCCCCTCCCAGATCTGGG - Intronic
1077746575 11:4913909-4913931 GATGCTCCCTTCCCCCAGCTAGG + Intronic
1078099928 11:8323936-8323958 GAGGCTGACTTCCCAAATCTGGG + Intergenic
1079007262 11:16800784-16800806 GAGGATCCCTTCCCCAAGCCAGG - Intronic
1080312674 11:30912725-30912747 GGGGTCCCCTCCCCAAGGCTAGG - Intronic
1080690018 11:34548712-34548734 GGGGCTCCCATCCCGGAGGTGGG + Intergenic
1081324593 11:41728999-41729021 TGGGCACCCCTCCCCAAGCTGGG + Intergenic
1083305808 11:61761436-61761458 GGGGCTGCCTTCCCATAGTCTGG + Intronic
1083696670 11:64448112-64448134 AGGGCTCCGTTCCCACAGCGCGG + Intergenic
1083961333 11:66016490-66016512 GGGCCTTCCTCCCCAAAGCAGGG + Intergenic
1085282755 11:75341707-75341729 AGGGCTCCCTCCCCAGGGCTGGG - Intronic
1090636008 11:128690984-128691006 GGGGCAGCCTTCCCCAAGCTGGG + Intronic
1091293039 11:134452795-134452817 GGGGCTCCGTTCCCAGCTCTTGG + Intergenic
1091624056 12:2109226-2109248 GGGGGTCCCTTTCCAATGCCAGG + Intronic
1092532089 12:9353164-9353186 GGGGCTCCCCTGCTAAAGATGGG + Intergenic
1097043843 12:56172786-56172808 GGAGCTTCTTTCCCAAAGCCAGG + Intronic
1104806326 12:131591831-131591853 GATGCTCCCTTCCCAACACTTGG - Intergenic
1104897343 12:132170856-132170878 GGGGTTCCCTCCCCAAAACGTGG - Intergenic
1117200986 14:53389883-53389905 GGAGCTCAGTTACCAAAGCTTGG - Intergenic
1119619148 14:76118570-76118592 GGGGGTCCCTTCCCCTATCTAGG + Intergenic
1122923121 14:104888092-104888114 GAGCCTCTGTTCCCAAAGCTGGG + Intronic
1124530839 15:30504222-30504244 GGGATTCCTTTCCCCAAGCTTGG - Intergenic
1124767821 15:32503473-32503495 GGGATTCCTTTCCCCAAGCTTGG + Intergenic
1124919834 15:34015060-34015082 GTGTCTCCCTTCTAAAAGCTGGG + Intronic
1127620493 15:60729131-60729153 GGGCCTGCCTTCTCAAAGCAAGG - Intronic
1127643165 15:60934214-60934236 GGGAGACCTTTCCCAAAGCTTGG + Intronic
1127854346 15:62942432-62942454 TGGGCTGGCTTGCCAAAGCTTGG - Intergenic
1128732970 15:70033593-70033615 TGGGCTCCCTTCCCCCAGCATGG - Intergenic
1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG + Intergenic
1129585672 15:76861946-76861968 GGGGCTCTTTCCCCTAAGCTCGG - Intronic
1132074673 15:98810083-98810105 GGGCCCCACCTCCCAAAGCTGGG - Intronic
1133382115 16:5339900-5339922 GGAGGCCCGTTCCCAAAGCTTGG + Intergenic
1136355825 16:29744469-29744491 GGGCCTCCCCTCCCAGGGCTGGG + Exonic
1137928959 16:52568215-52568237 GGGCCTCCCATCCAAAAGCAAGG + Intergenic
1138645358 16:58420656-58420678 GGGGCTCCCAGCCCAGAGCCTGG - Intergenic
1139955801 16:70692434-70692456 GGGGCCCCCATCTCTAAGCTGGG + Intronic
1140042537 16:71418037-71418059 GGGGCTCCCTTCCAACAGAGAGG - Intergenic
1142871392 17:2823334-2823356 GGGGCTCCCCTGACAAAGGTTGG - Intronic
1145234044 17:21196229-21196251 GGGGCTCCCTTTCCAAACCTGGG + Intergenic
1145867500 17:28250441-28250463 GGGGCTTCCTTCTCCAGGCTGGG - Intergenic
1145980006 17:29005745-29005767 GGGTCTCCCTTCCCACCCCTGGG + Intronic
1146312484 17:31779893-31779915 GGGGCTCCCTTTTCAAAAATTGG - Intergenic
1146798102 17:35797032-35797054 AGAGCTCCCTGCCCAAAGCAGGG + Intronic
1147572704 17:41581174-41581196 GGGGCTCATTGCCCCAAGCTAGG - Intergenic
1147590287 17:41678725-41678747 TGGTTTCCCTTCCCAGAGCTTGG - Intergenic
1148651383 17:49252490-49252512 GGTGCTCCCTTTCCAAGGCTAGG + Intergenic
1148907151 17:50918904-50918926 GGGGGCCCCTAGCCAAAGCTGGG + Intergenic
1150459105 17:65332398-65332420 GGGGCTGCTTTCCCAAAAGTAGG - Intergenic
1150481738 17:65516528-65516550 GGGCCTCCCTTCCTAGGGCTGGG + Intergenic
1151744934 17:76006939-76006961 TGGGCTCCCTCCCCTAACCTTGG - Exonic
1151878705 17:76881754-76881776 GGGGCTTCTTTCCCAGTGCTGGG + Intronic
1152575774 17:81140393-81140415 GGTGCCCCCTTACCAAATCTGGG - Intronic
1152904252 17:82961662-82961684 GGGGCTGCCTCCCCACTGCTGGG - Intronic
1152938455 17:83153723-83153745 GGGGCTCCCTCCCCCCAGCGGGG - Intergenic
1157444673 18:47735683-47735705 GGAGGTCCCTTCTCAAACCTAGG - Intergenic
1160232819 18:77061056-77061078 TGGGGTCCCTTCCCAGAGCCAGG - Intronic
1160945908 19:1644028-1644050 TGGGATCCCTTCCCAAACCTCGG - Intronic
1161117218 19:2504409-2504431 GGGGCTCACATCCCTCAGCTCGG - Intergenic
1163223101 19:15935614-15935636 GGGGCTCACTACCCACAGTTAGG - Intergenic
1163619231 19:18348237-18348259 GGGTGTCTCTTGCCAAAGCTGGG + Intronic
1164866897 19:31612023-31612045 GAGGCTCCCGTCTCAAGGCTGGG - Intergenic
1165358002 19:35315797-35315819 GGGTTTCCCTTCCCACAGCCCGG - Intergenic
1166924952 19:46260914-46260936 GAGCCCCCCTTCCCCAAGCTGGG - Intergenic
927574824 2:24192218-24192240 CGAGCTGCCTTCCCAAAGCTGGG - Intronic
932788116 2:74626118-74626140 GGGACTCCCTTCCCGAGGCTGGG - Intronic
934937798 2:98477844-98477866 GTGGCTCTCTTCCCACAGCAGGG - Intronic
935743964 2:106174868-106174890 GGGCCACCCTTCCAAAAGTTAGG + Intronic
937046958 2:118856986-118857008 GGGGCTGCCGTCCCCACGCTTGG - Intergenic
937125802 2:119474370-119474392 GTGGCTCCCTTCCGCAGGCTGGG - Intronic
937289709 2:120774914-120774936 GTGGCCCCCTGCCCAAAGCCCGG + Intronic
937334063 2:121050046-121050068 GGAGCTCCTTTCTCTAAGCTGGG - Intergenic
939262554 2:139829278-139829300 GTGGCCCCCTACCCAAAGGTGGG + Intergenic
947867947 2:233414348-233414370 GGGGCTCCCTTATCAAAGCTGGG + Intronic
948427111 2:237895213-237895235 GGGGCTCCCATCCAAAGGCAGGG + Intronic
948638686 2:239359557-239359579 GGGGACCCCTTCCCAGAGCTGGG + Intronic
1169038797 20:2475954-2475976 AGGGTTCCCTCCCCAAGGCTAGG + Intronic
1169211349 20:3767737-3767759 GGGGCTCCCTTCCTCGTGCTCGG - Intronic
1170520181 20:17177274-17177296 GGGGATCCCTTCCCATTGCAAGG + Intergenic
1171345673 20:24464364-24464386 GTGTCTCCCTTCCCAAAACCAGG - Intergenic
1172568383 20:35949662-35949684 GGGGCTCCATTCCCAATTCCTGG + Exonic
1173621836 20:44442771-44442793 GGGGAGCCCTTCCCAAGGCCGGG - Intergenic
1175986243 20:62765449-62765471 GAGGCTCCCTACACACAGCTGGG - Intergenic
1176264768 20:64203448-64203470 GGGGCTCCCTTTCCAAACTGAGG - Intronic
1180961213 22:19763192-19763214 GGGGCTGCCTTCCACCAGCTAGG + Intronic
1181309599 22:21937471-21937493 GGAGCTGCCTTCCCTGAGCTGGG - Intronic
1184643697 22:45885225-45885247 GGGACACCCCTCCCAAAGCCTGG + Intergenic
950143470 3:10631561-10631583 AGATCTCCCTTCCCAAAGCCTGG - Intronic
950529879 3:13547101-13547123 GAGGCTCCCTTCCCCAGGCCTGG - Intergenic
951594303 3:24300548-24300570 TGGGCTAGCTTCCAAAAGCTGGG + Intronic
952828761 3:37545693-37545715 GGGGCCCCATCCCCAAAACTGGG - Intronic
953411277 3:42691732-42691754 GGGTCTCCTTTCCCAGAGCCTGG + Intronic
955840741 3:63110172-63110194 GGGGCCACCTTCCCAAGGCTGGG - Intergenic
957510950 3:81186798-81186820 GCAGCCCCCTTCCCACAGCTTGG - Intergenic
958448978 3:94249738-94249760 GGGGCTCCATTCCCCATGTTAGG - Intergenic
961507383 3:127379030-127379052 GGGGGTCCCTTCCGGAAGTTGGG + Intergenic
967759223 3:193204914-193204936 GGGGCTGCCTTCCAGAAACTAGG + Intergenic
967999869 3:195197886-195197908 GAGGCTTCCTTCCCAAGGCTAGG + Intronic
969700757 4:8766362-8766384 GGTGCTCCCTGCCCACAGGTGGG + Intergenic
974727798 4:65818149-65818171 GCAGCTCCCATCCTAAAGCTTGG + Intergenic
978739810 4:112123862-112123884 GGGGCCCCCTCCCCAGACCTGGG + Intergenic
980942990 4:139292784-139292806 AGGGCTCCCTTCTCAAATTTAGG - Intronic
985514976 5:337743-337765 GGGGCTCCCTTCCCAAAGCTGGG + Intronic
985543674 5:498765-498787 GGGGCACTCTTCCCAAAGCGGGG - Intronic
986189717 5:5484016-5484038 GGGGCTCCCTTGACAGTGCTGGG + Intronic
990098193 5:52146203-52146225 GGGGCTCTCCTCCCAAAGATAGG - Intergenic
990235860 5:53766529-53766551 GTGGCTCCATTACCAAATCTTGG + Intergenic
995610135 5:113900732-113900754 TGGGCTCCCTTCCCAGACATTGG - Intergenic
996940522 5:128999831-128999853 TGGGCTCCCTACCCAAAGTTTGG + Intronic
999252246 5:150189902-150189924 GGGACTCCCTTTCCACAGTTGGG - Intergenic
1000121196 5:158199291-158199313 AGGGCTCTGTTCCCGAAGCTGGG - Intergenic
1001018390 5:168162361-168162383 GAGGCAACCTTCCCAAAGCGGGG - Intronic
1002194878 5:177496389-177496411 GGAGCCCCCTCCCCAAACCTAGG + Intronic
1002535457 5:179873294-179873316 GGAGCCTCCTTCCCACAGCTGGG + Intronic
1003277450 6:4664669-4664691 AGGCTTCCCTTCCCAAAGCACGG - Intergenic
1003320391 6:5046006-5046028 GGGGCACTCTGCCCAGAGCTTGG + Intergenic
1003852848 6:10242555-10242577 GGGACCACCTGCCCAAAGCTGGG + Intergenic
1004189686 6:13452832-13452854 TGTGCTCCAGTCCCAAAGCTTGG - Intronic
1006813923 6:36838453-36838475 GGGGCAGCCTTCCCCTAGCTAGG + Intronic
1012328798 6:97958521-97958543 GGGTAGCCCTACCCAAAGCTGGG + Intergenic
1015499815 6:133920610-133920632 GAGGGCCCCTTCCCAAAGGTAGG + Intergenic
1016996954 6:149967459-149967481 GTGGCTCAGTTCTCAAAGCTGGG + Intronic
1017011573 6:150067212-150067234 GTGGCTCAGTTCTCAAAGCTGGG - Intronic
1019330170 7:457389-457411 GGGCCTCCCATCCCAATGCCAGG + Intergenic
1019330225 7:457519-457541 GGGCCTCCCATCCCAATGCCAGG + Intergenic
1022386170 7:29901207-29901229 TGGGCTCCCTTCCCACAGAAGGG - Intronic
1028980455 7:96962400-96962422 TGGGCTCCCTCAACAAAGCTGGG + Intergenic
1029205717 7:98868369-98868391 GGGGCACTCACCCCAAAGCTTGG + Intronic
1029736569 7:102468769-102468791 GGGGCTCCCTCCCCCAGGCCCGG + Intronic
1030065471 7:105655820-105655842 GGGGCTCCTCTCCAAATGCTTGG - Intronic
1030319361 7:108147421-108147443 GTGCCTCCTTTCCCAAAGCCTGG - Intergenic
1031259459 7:119499557-119499579 GGGCCTCCATTCTCAAGGCTAGG + Intergenic
1032698426 7:134357909-134357931 GAGGCTCCCTTCCAGGAGCTGGG - Intergenic
1035229889 7:157458565-157458587 GGTGCTGCCTTCCCAACACTAGG - Intergenic
1035334140 7:158114737-158114759 GGGGCTCCCTTACCCCAGCCTGG - Intronic
1036476942 8:9102112-9102134 TGAGCTCCCTTCACCAAGCTGGG + Intronic
1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG + Intronic
1037386336 8:18346478-18346500 TGAGCTCCCTTCCTAAAGTTAGG + Intergenic
1042572915 8:70186107-70186129 TGGGCTCCTTTCCCCAAGATGGG - Intronic
1045415044 8:101957839-101957861 GGGGCTCCATTCCAACAGCCTGG - Intronic
1047423264 8:124724762-124724784 AGCCCTCCCTTCCCAGAGCTTGG + Intronic
1049281901 8:141753652-141753674 GGGGCTCTCCTCCCAGTGCTGGG + Intergenic
1050828728 9:9984367-9984389 GAGACTCCCTTCTCAAGGCTGGG + Intronic
1050828835 9:9985190-9985212 GAGACTCCCTTCTCAAGGCTGGG - Intronic
1051174893 9:14350987-14351009 GAGTCTCCTTTGCCAAAGCTTGG - Intronic
1056285075 9:85079406-85079428 GTGGCTGCCTTCCAAAAGCCAGG - Intergenic
1060231315 9:121827454-121827476 TGGGCTCCAGTCCCAGAGCTGGG - Intronic
1060553666 9:124497618-124497640 GGGGCTCCCCTGACAGAGCTTGG - Intronic
1062190041 9:135243303-135243325 GGGGCTCCCTTATCAGAGGTGGG - Intergenic
1062199830 9:135296676-135296698 GGGGCCACCTTCCCAAAGCAAGG + Intergenic
1187319283 X:18226022-18226044 GAGGCTCCCTTCTGAAAACTTGG - Intergenic
1188085418 X:25896504-25896526 GGGGCTCCCTTCCCCCCGCAGGG + Intergenic
1188513203 X:30958633-30958655 GCAGCTCCCTTCCCCATGCTAGG - Intronic
1189187396 X:39065926-39065948 GTGGCTCACTTCCCACTGCTAGG + Intergenic
1189446302 X:41084961-41084983 GGGCCTCCCTTCCCCAACTTCGG + Intergenic
1189548797 X:42071987-42072009 GAGACTCCCTCCCTAAAGCTTGG - Intergenic
1190058829 X:47198092-47198114 GGTTTTCCCCTCCCAAAGCTGGG + Intronic
1192203773 X:69082976-69082998 GGGGCCCCCTTCACAAAGCCCGG + Intergenic
1194252010 X:91587522-91587544 GGGGCTCCCTCCCCAAGCCAAGG + Intergenic
1194718665 X:97315281-97315303 GGGTCTCACTTGCCAAGGCTAGG - Intronic
1200570941 Y:4828760-4828782 GGGGCTCCCTCCCCAAGCCAAGG + Intergenic