ID: 985514977

View in Genome Browser
Species Human (GRCh38)
Location 5:337744-337766
Sequence GGGCTCCCTTCCCAAAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514971_985514977 -1 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514965_985514977 17 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514968_985514977 1 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242
985514969_985514977 0 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514977 Original CRISPR GGGCTCCCTTCCCAAAGCTG GGG Intronic
900116857 1:1032792-1032814 GGGGTCCCTTCCAAAGGCTGCGG + Intronic
900228378 1:1543480-1543502 GGCCTCCTGTGCCAAAGCTGTGG + Intronic
900756145 1:4436345-4436367 AGGCTCCCTCCCCATGGCTGTGG + Intergenic
901743177 1:11355696-11355718 GGGCTCCACTCCCACAGATGGGG - Intergenic
903493942 1:23751760-23751782 GGGCTCCCTCCCTAAAGTTGAGG + Exonic
904809053 1:33151450-33151472 GGGCTCCCTCCCCGAGGCTAGGG + Intronic
905212652 1:36385469-36385491 GTGCCCACTTCCCAGAGCTGCGG + Intronic
905826132 1:41027446-41027468 GGACTCCCTTCCCACAGATGAGG + Exonic
906214417 1:44030632-44030654 GCAGTCCCTTCCCAAAGCCGCGG + Intronic
907404952 1:54248302-54248324 GGGCTCCCTCCCACAAGCTCAGG + Intronic
908801337 1:67883888-67883910 GGACCCACTTCCAAAAGCTGGGG - Intergenic
910342490 1:86203531-86203553 TGGCACCCTTCCCAAGACTGTGG - Intergenic
913139379 1:115925562-115925584 GGGCTCCCTCCCCAGCCCTGTGG + Intergenic
915250110 1:154581915-154581937 TGGCTCCTTTCCAAAGGCTGAGG + Intergenic
915442087 1:155951561-155951583 GTTCTCCCATCCTAAAGCTGGGG - Intronic
917616057 1:176745716-176745738 AGGCTCCCAACCCAAAGCTGAGG + Intronic
919916598 1:202143450-202143472 TGGCCCCAGTCCCAAAGCTGAGG - Intronic
920585670 1:207157747-207157769 GGTGCCCCTTCCCAAGGCTGGGG + Intergenic
922235839 1:223721840-223721862 AGGATCCCTTCCCAGGGCTGTGG + Intronic
922462451 1:225823950-225823972 GGGCTCCCTCGCCAGGGCTGCGG - Intronic
923736366 1:236611924-236611946 GGGAACACTACCCAAAGCTGAGG + Intergenic
924772003 1:247087393-247087415 CAGCTTCCTCCCCAAAGCTGGGG - Intergenic
1062810221 10:457912-457934 GGCCTCTCCTCCCACAGCTGCGG + Intronic
1063169998 10:3500478-3500500 TGGCCCCTGTCCCAAAGCTGTGG + Intergenic
1065125420 10:22569166-22569188 TGGCTCCCTTCCCCAATGTGAGG - Intronic
1072745891 10:97939036-97939058 GTGCTCCCTGCCCCAGGCTGTGG + Intronic
1072888737 10:99302689-99302711 GGAGTCCCATCCCAAAGGTGAGG - Intergenic
1072959265 10:99914486-99914508 GGGGTCCCTTGGCTAAGCTGTGG - Intronic
1075955487 10:126519841-126519863 GTGCCCTCTTCCCAAACCTGAGG + Intronic
1076727725 10:132421279-132421301 GTGCACCCTTCCCATGGCTGGGG - Intergenic
1079014190 11:16854948-16854970 GGTCTCTCTTCCCAAAGCTGTGG + Exonic
1081907813 11:46680426-46680448 CGGCTCCCTTCAGGAAGCTGGGG - Intronic
1083696671 11:64448113-64448135 GGGCTCCGTTCCCACAGCGCGGG + Intergenic
1083869168 11:65476643-65476665 GAACTCCTTTCCCAAAACTGAGG - Intergenic
1085532713 11:77201467-77201489 GGTCTCCCTTGGCAAAGCTGAGG - Exonic
1085758353 11:79220134-79220156 GGGCTGCCTTCCCTAAACAGGGG - Intronic
1086081196 11:82903753-82903775 AGCCACCCTTCCCATAGCTGAGG + Intronic
1087042879 11:93819044-93819066 GAGATCCCTTCCCAAAACTCTGG + Exonic
1088987688 11:114924544-114924566 GGTCTCCCCTTCCCAAGCTGGGG + Intergenic
1090752616 11:129760505-129760527 GGCCTCCCTCCCGACAGCTGAGG + Intergenic
1091732021 12:2888133-2888155 GTGCTCAGTCCCCAAAGCTGTGG + Exonic
1092054059 12:5494394-5494416 GAGCACCCTGCCCAAAGCTGAGG + Exonic
1093711323 12:22333493-22333515 GGGCACACTGCGCAAAGCTGCGG + Intronic
1096220908 12:49827874-49827896 GGGCTCTCTCCCCAAAGCGCAGG - Intronic
1096532741 12:52252232-52252254 GGACACCCTCCCCACAGCTGTGG + Intronic
1097317503 12:58187696-58187718 GGCCTCTCTTCACAAAGCTGTGG - Intergenic
1097578772 12:61428233-61428255 GGGGCCCCTTCCCAAGGCTGCGG + Intergenic
1100101274 12:91108562-91108584 GGGCCCACTTCCCAAATCTCTGG - Exonic
1102289243 12:111685637-111685659 GGCTTCCCTTCCCAAAGCACTGG - Intronic
1103021458 12:117538057-117538079 GGGCTCACTTCCCCCAGGTGTGG + Intronic
1103923585 12:124411879-124411901 GCCCTCCCTTGCCAAAGCTCAGG + Intronic
1105531911 13:21228387-21228409 GGGGTCCCCTCCCCATGCTGTGG + Intergenic
1105971090 13:25429793-25429815 GCGCTCCCTGCCCAATGCTGTGG - Intronic
1107908386 13:45082843-45082865 CAGGTCCCTTCCCAAAGCTGTGG + Intergenic
1109995274 13:70115370-70115392 AGGCTCACTTCCCAACACTGTGG + Intergenic
1112334103 13:98499749-98499771 GGTCTTGCTGCCCAAAGCTGAGG + Intronic
1116801065 14:49443610-49443632 GTGCTGCCTTCCCAGAACTGTGG - Intergenic
1116900515 14:50358039-50358061 GGGGTCCCTTCCTGAAGTTGAGG - Intronic
1117006017 14:51421833-51421855 GGGCTGCCTTCCTCATGCTGTGG - Intergenic
1120015413 14:79467633-79467655 AGGCTCCCTTCCCAACTGTGTGG + Intronic
1120741281 14:88111336-88111358 GGACTCATTTCCCAGAGCTGTGG + Intergenic
1122770675 14:104096288-104096310 GGGATCCTTTCCCACGGCTGAGG + Intronic
1122923122 14:104888093-104888115 AGCCTCTGTTCCCAAAGCTGGGG + Intronic
1123141978 14:106088635-106088657 GGGCTCCTCTCCCAGAGCTGCGG + Intergenic
1123200445 14:106658240-106658262 GGGCTCCTCTCCCAGAGCTGCGG + Intergenic
1202899335 14_GL000194v1_random:26528-26550 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1123439007 15:20276577-20276599 TCTCTCACTTCCCAAAGCTGGGG + Intergenic
1124471019 15:29985810-29985832 GGGCTCCCTCTCCAAAACTGTGG - Intergenic
1125645623 15:41270129-41270151 AGGCTCTATTCCCAAAGCTGTGG + Intronic
1125692491 15:41607690-41607712 TGTCTCCATTCCCACAGCTGAGG - Intergenic
1126263302 15:46720380-46720402 GTGTGCCCCTCCCAAAGCTGAGG - Intergenic
1126581926 15:50250029-50250051 GGGCTCCCTTGCCAAGGCTAAGG + Intronic
1128754456 15:70172001-70172023 AGGCTTTCTTCCCAAAGCGGAGG + Intergenic
1131255209 15:90857573-90857595 GGGCTCCCCACCCAGTGCTGAGG + Intergenic
1131827913 15:96334635-96334657 GGGCTCCTAGCCCAGAGCTGGGG + Intronic
1132804201 16:1768212-1768234 GGGCGCCCTCCCCAGAGGTGGGG - Exonic
1132956732 16:2598254-2598276 CGGCTCCCTCCACAAAGCTGCGG - Exonic
1133040225 16:3056742-3056764 GTGCTCCCTTCCCAGAGGAGGGG + Intronic
1134610169 16:15601639-15601661 GGGCCCACTTCCCAAGCCTGGGG - Intronic
1135976333 16:27110826-27110848 GAGCTCCCTGCCCACAGCTGAGG - Intergenic
1136075134 16:27812026-27812048 GGCCCCACTTCCCAAGGCTGAGG - Intronic
1136276447 16:29181805-29181827 GGGGTCCCTTCCATAGGCTGTGG - Intergenic
1136355826 16:29744470-29744492 GGCCTCCCCTCCCAGGGCTGGGG + Exonic
1136911488 16:34147740-34147762 GGGCACCCTTTACAATGCTGGGG - Intergenic
1137395722 16:48115115-48115137 GGGCACCCTTCCCCAAGTTCTGG - Intronic
1139955802 16:70692435-70692457 GGGCCCCCATCTCTAAGCTGGGG + Intronic
1140198856 16:72878415-72878437 GGGCTGCCCTCCCCATGCTGTGG + Intronic
1141702708 16:85649884-85649906 TGGCTCCCTTCCCACACCTCTGG - Intronic
1142080828 16:88147865-88147887 GGGGTCCCTTCCATAGGCTGTGG - Intergenic
1142110700 16:88329550-88329572 GGGCTCCCTTCTCAGAGGCGAGG + Intergenic
1142229857 16:88895103-88895125 GGGCTGCGTCCCCACAGCTGGGG + Intronic
1143037779 17:4009575-4009597 GGGCTCCCTGCCCAGACCTCAGG + Intronic
1145867499 17:28250440-28250462 GGGCTTCCTTCTCCAGGCTGGGG - Intergenic
1145980007 17:29005746-29005768 GGTCTCCCTTCCCACCCCTGGGG + Intronic
1146373861 17:32281420-32281442 GGGCTCCCTTCTCTAGGCCGAGG + Intronic
1146759479 17:35464146-35464168 GGGCTCCCTCTCCAACACTGAGG + Intergenic
1147427657 17:40353793-40353815 GGGCTCCCATCCCCATGCCGTGG + Intronic
1147590286 17:41678724-41678746 GGTTTCCCTTCCCAGAGCTTGGG - Intergenic
1147966371 17:44196324-44196346 GGACTCCCTGCCCAAAGGGGAGG + Intronic
1148904655 17:50904713-50904735 GGGCACCCTGCCCAGAGCTGAGG - Intergenic
1149132806 17:53326930-53326952 GAACTCTCTTTCCAAAGCTGAGG + Intergenic
1149434271 17:56619881-56619903 CCGCTGCCATCCCAAAGCTGGGG - Intergenic
1149848580 17:60021787-60021809 GGGCTCCCTTCCTCACCCTGAGG - Intergenic
1149861589 17:60124737-60124759 GGGCTCCCTTCCTCACCCTGAGG + Intergenic
1150136467 17:62698078-62698100 GGCCTCCCTTCCCAAAGCAGTGG + Intergenic
1150149975 17:62801051-62801073 GGGCTCCATGCCGAAAACTGAGG + Intronic
1150481739 17:65516529-65516551 GGCCTCCCTTCCTAGGGCTGGGG + Intergenic
1151444475 17:74154101-74154123 AGGCTCCCATCCCCAAGCAGAGG - Intergenic
1151493141 17:74444337-74444359 GGGCCCCCTTGGCACAGCTGTGG - Intronic
1152228537 17:79103591-79103613 GGGCCCCCTACCCCAAGGTGGGG - Intronic
1152463071 17:80451396-80451418 GGGCTTCCTGCCCAAGGCAGGGG - Intergenic
1152575773 17:81140392-81140414 GTGCCCCCTTACCAAATCTGGGG - Intronic
1154134387 18:11762690-11762712 GGGCTTCCTCCTCAAGGCTGGGG + Intronic
1159552745 18:69912895-69912917 TGGTTCCTTTCCTAAAGCTGAGG - Intronic
1159643346 18:70888671-70888693 GTGCTCACTTCCCAAAGGTAAGG - Intergenic
1159964481 18:74581791-74581813 GGGGGCTCTTCCCAAAGCAGGGG + Intronic
1160879644 19:1313550-1313572 TGGCTCCCATCCCAGAGCTGTGG - Intergenic
1162162665 19:8730344-8730366 GGGGTCCTTAACCAAAGCTGAGG - Intergenic
1163579660 19:18130839-18130861 GGGCTCCCTACCCCAGACTGGGG - Intronic
1164866896 19:31612022-31612044 AGGCTCCCGTCTCAAGGCTGGGG - Intergenic
1165147061 19:33737585-33737607 GGGGACCCTTCTCAAGGCTGTGG + Intronic
1165855859 19:38879011-38879033 CAGCTCCCTCCCCAAAACTGGGG - Exonic
1166942458 19:46375084-46375106 GGGCTCCCCTGCCAGGGCTGTGG - Intronic
1167468430 19:49662468-49662490 CCACTCCCTTCCCAAACCTGGGG - Exonic
1202648120 1_KI270706v1_random:159146-159168 GGCCCCGCTTCTCAAAGCTGCGG - Intergenic
928398515 2:30961473-30961495 GAGCTCCTTTCACACAGCTGAGG - Intronic
928459345 2:31456346-31456368 GGGCTCCCTTCCCTTAGCTGTGG + Intergenic
929993775 2:46812173-46812195 GGGGGTCCTTTCCAAAGCTGGGG + Intergenic
932451282 2:71812284-71812306 GGGGACCATTCCCAAGGCTGTGG + Intergenic
932606049 2:73166369-73166391 GGGGTCCCTTTCCCCAGCTGAGG - Intergenic
932732503 2:74231230-74231252 TGGCTCCCATCCTAAAGGTGAGG - Exonic
932788115 2:74626117-74626139 GGACTCCCTTCCCGAGGCTGGGG - Intronic
933321239 2:80778063-80778085 GGGCTTCCTTCTCAGAGCTATGG + Intergenic
933926378 2:87094082-87094104 GGGGTCCCTTTCCCCAGCTGAGG + Intergenic
936285666 2:111179213-111179235 GGGCTCCTTTCCCATTGCTTAGG - Intergenic
937374333 2:121325276-121325298 GAGCTCCCTTGATAAAGCTGTGG + Intergenic
940032730 2:149281524-149281546 TGTCTCCCTTCCCAGAGCGGTGG + Intergenic
941775311 2:169387052-169387074 GTGCTGCTTTGCCAAAGCTGGGG + Intergenic
945523354 2:210857778-210857800 GAGCTTCCTTCAGAAAGCTGAGG - Intergenic
946411648 2:219518133-219518155 GGGCTCCCTGCTCAGAGCTGTGG + Intronic
948027221 2:234787655-234787677 GGGATCCTTTACCAAAGCAGGGG + Intergenic
948638687 2:239359558-239359580 GGGACCCCTTCCCAGAGCTGGGG + Intronic
948861116 2:240752995-240753017 CAGCTGCCTTCCCAAAGCTTAGG + Intronic
1168858599 20:1028640-1028662 GTGCTCGCTTCTCAGAGCTGGGG - Intergenic
1169038798 20:2475955-2475977 GGGTTCCCTCCCCAAGGCTAGGG + Intronic
1170750563 20:19141028-19141050 GGCCTCCCATCCCAACACTGTGG - Intergenic
1171512351 20:25696186-25696208 GTGCTCCCAACCCAAAGCAGCGG + Intronic
1171812464 20:29756650-29756672 GGGCACCCTTTACAATGCTGGGG + Intergenic
1171906814 20:30906017-30906039 GGGCACCCTTTACAATGCTGGGG - Intergenic
1172624620 20:36340143-36340165 GGGCTCTGTTCCCAGAGGTGAGG - Intronic
1173136356 20:40442620-40442642 GGGCTTCTTCCCCAATGCTGGGG - Intergenic
1173621835 20:44442770-44442792 GGGAGCCCTTCCCAAGGCCGGGG - Intergenic
1173733800 20:45345879-45345901 GGGTTCCCTTCCAAAATATGGGG + Intronic
1174265073 20:49325452-49325474 GGGCCCCCTTCCCCAAAATGGGG + Intergenic
1175168146 20:57060962-57060984 AGGCTTCCTGCCCAAACCTGTGG + Intergenic
1175279348 20:57792991-57793013 GAGCTCCCTTCTCGATGCTGGGG - Intergenic
1176603730 21:8813548-8813570 GGCCCCACTTCTCAAAGCTGCGG + Intergenic
1176618716 21:9041291-9041313 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1180340228 22:11612091-11612113 GGGCACCCTTTACAATGCTGGGG - Intergenic
1180346013 22:11705099-11705121 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1180353785 22:11823356-11823378 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1180384460 22:12169003-12169025 GGCCCCGCTTCTCAAAGCTGCGG - Intergenic
1181179144 22:21055104-21055126 GGGCTCCCATCGCAGAGATGCGG - Exonic
1181804327 22:25365965-25365987 AGGCTGCCTTCCCATAGCGGCGG - Intronic
1182940109 22:34268943-34268965 GGGCTCCCCTCCCAAAACCGAGG - Intergenic
1183492994 22:38126672-38126694 GGGAGCCCTTCCCAGAGCAGTGG - Intronic
1183828161 22:40404540-40404562 CGGCTCCCTTCCCTCAGCTGTGG + Exonic
1184114311 22:42413339-42413361 GGACCCCCTTCCCAGAGCTCTGG - Intronic
1185383081 22:50519084-50519106 GGGCTCCGTGACTAAAGCTGAGG + Intronic
950074860 3:10180221-10180243 TGGCTCCCTGCCCTACGCTGAGG - Intronic
950436508 3:12983556-12983578 GGGCACCCTGCTCAAGGCTGGGG - Intronic
951289445 3:20856859-20856881 TGGCTACTTTCTCAAAGCTGGGG + Intergenic
951674130 3:25217808-25217830 GAGCTCCCTTTGCAAAGCTCTGG + Intronic
951796197 3:26541244-26541266 GGGCTGCCTTCCACAATCTGAGG - Intergenic
952644216 3:35636716-35636738 GAGCTCATTTCCCCAAGCTGGGG + Intergenic
952882803 3:37995733-37995755 GGCCTCCCTTCCTGTAGCTGAGG - Exonic
953043844 3:39278215-39278237 GTGCTCCCATCCCAGAGGTGTGG + Intronic
954672230 3:52297301-52297323 GGGCTTTCTCCCCAAGGCTGTGG + Intergenic
955689434 3:61576502-61576524 GGTCCCCATTCCCATAGCTGTGG + Intronic
963919674 3:150893507-150893529 GGTGTCCCTTCACAAAGCTCTGG - Intronic
967999870 3:195197887-195197909 AGGCTTCCTTCCCAAGGCTAGGG + Intronic
968516891 4:1019229-1019251 GGGCTCCCTCCCCAGATGTGGGG + Intronic
968633530 4:1665738-1665760 GGGCTCCTGTCCCAAGGCCGAGG + Intronic
969259467 4:6024331-6024353 GGCCTCCCTTCAGAAATCTGGGG + Intergenic
969700758 4:8766363-8766385 GTGCTCCCTGCCCACAGGTGGGG + Intergenic
970187948 4:13483222-13483244 GGGCTCCTACCCCAAGGCTGTGG - Intronic
973374392 4:49277296-49277318 GGCCCCGCTTCTCAAAGCTGCGG - Intergenic
973383019 4:49332945-49332967 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
973386640 4:49517988-49518010 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
973894331 4:55396488-55396510 GGGCTCCCCTCCCCCAGCCGAGG - Intronic
974384267 4:61184405-61184427 GGGTCTCCATCCCAAAGCTGTGG + Intergenic
978545917 4:109872760-109872782 GAGCTCCTCTCCCACAGCTGAGG - Intergenic
978739811 4:112123863-112123885 GGGCCCCCTCCCCAGACCTGGGG + Intergenic
980448542 4:132942813-132942835 GGCCACCCTGCCCAAGGCTGTGG - Intergenic
982590650 4:157304990-157305012 GCACTCCCTTCTCAAAGCAGGGG - Intronic
985275519 4:188234072-188234094 GGACCCCCATCCCACAGCTGTGG + Intergenic
985514977 5:337744-337766 GGGCTCCCTTCCCAAAGCTGGGG + Intronic
986189718 5:5484017-5484039 GGGCTCCCTTGACAGTGCTGGGG + Intronic
986219195 5:5752248-5752270 GTGCTCACTTCCCAAGGCTAAGG + Intergenic
988487570 5:31679338-31679360 AGGTTCCCTCTCCAAAGCTGAGG + Intronic
991673963 5:69074601-69074623 TGGCTCCCTTCCCAAAGCCTCGG - Intergenic
992713122 5:79481431-79481453 TGGCTCCCTTCCCTGTGCTGTGG - Intronic
995313250 5:110738193-110738215 AGGCTCCCTCCCCAGATCTGAGG - Intronic
995320279 5:110825657-110825679 GGGTTCCCTTCCCCAGGCTGTGG - Intergenic
996579704 5:125017844-125017866 CTGCTCCCTTCCCAAAGCCAAGG + Intergenic
996940523 5:128999832-128999854 GGGCTCCCTACCCAAAGTTTGGG + Intronic
1000121195 5:158199290-158199312 GGGCTCTGTTCCCGAAGCTGGGG - Intergenic
1001434807 5:171691921-171691943 GTGCCCCCTTCCCAAGCCTGAGG - Intergenic
1003196802 6:3921758-3921780 GTGCTCCCTCACCCAAGCTGTGG - Intergenic
1003853167 6:10245506-10245528 GGGCTCCCTTCACACACCTGTGG - Intergenic
1004189685 6:13452831-13452853 GTGCTCCAGTCCCAAAGCTTGGG - Intronic
1006898247 6:37484275-37484297 GGGCTCCCTGCTAAAGGCTGGGG - Intronic
1013555152 6:111249272-111249294 TGCCTCACTTCCCAAAGCTCTGG + Intergenic
1014322536 6:119948420-119948442 AGGCTAGCTTCCCTAAGCTGAGG + Intergenic
1016914422 6:149231930-149231952 GGGCTCCCTACCCAGAGCAACGG + Intronic
1018237132 6:161737330-161737352 GGGCGCCCTTGCGAAGGCTGAGG + Intronic
1018258873 6:161949806-161949828 GTGCTGCCCTCCAAAAGCTGTGG - Intronic
1018743073 6:166744840-166744862 GCCCTCCCTTCCTAAAGCTTAGG + Intronic
1019431191 7:1000632-1000654 GGGCTCCCTCTCCTAAGATGAGG - Intronic
1019451815 7:1102748-1102770 GTGCTCACTTCCCAAGGGTGAGG - Intronic
1020076862 7:5263932-5263954 CTGAGCCCTTCCCAAAGCTGAGG + Intergenic
1024044105 7:45575635-45575657 GGGCTCGCCTCCCAACCCTGCGG + Intronic
1024261604 7:47577813-47577835 GGGCTTCCTGCCCAGCGCTGGGG + Intronic
1024564258 7:50668520-50668542 GGCCTCCCTTCCCTCAACTGTGG + Intronic
1025202238 7:56969662-56969684 CTGAGCCCTTCCCAAAGCTGAGG - Intergenic
1025669709 7:63607265-63607287 CTGAGCCCTTCCCAAAGCTGAGG + Intergenic
1026478600 7:70759694-70759716 GGGCTCGCTTCCCAAGGCCCCGG - Intronic
1030301550 7:107979410-107979432 GGGTTCCTTCCCCTAAGCTGTGG - Intronic
1031870654 7:127086957-127086979 GGGCTCGATGCCAAAAGCTGGGG + Intronic
1032791051 7:135242692-135242714 GGAATCCCTTCCCAGGGCTGAGG - Intronic
1033305521 7:140222789-140222811 GTGCTCCCTTCCCAGCTCTGGGG - Intergenic
1033586587 7:142779055-142779077 GGGCTCCATTCCCAAGTCTTTGG + Intergenic
1034105115 7:148483457-148483479 GTGTTCCCTTCCGACAGCTGAGG - Intergenic
1035281475 7:157781094-157781116 GGGCTCCCTTCGCCTGGCTGTGG + Intronic
1035321295 7:158030831-158030853 GGGCTCCGTTGCCAAAGCCTTGG + Intronic
1035704385 8:1664084-1664106 GGGCTGCCTTTCTAGAGCTGAGG + Intronic
1036041552 8:5087860-5087882 GGGATCCCTTTCCTAAGCTTTGG - Intergenic
1036476943 8:9102113-9102135 GAGCTCCCTTCACCAAGCTGGGG + Intronic
1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG + Intronic
1041794875 8:61736876-61736898 GGGCTCCCTTGGCCAAGATGGGG + Intergenic
1044248437 8:89977812-89977834 AAGCTCCATTCCCAAAGCTATGG + Intronic
1048996965 8:139800490-139800512 GGTCGCCTGTCCCAAAGCTGAGG + Intronic
1049224194 8:141441835-141441857 GGGCACCCTTCCCAGGGCAGGGG - Intergenic
1049281902 8:141753653-141753675 GGGCTCTCCTCCCAGTGCTGGGG + Intergenic
1050828729 9:9984368-9984390 AGACTCCCTTCTCAAGGCTGGGG + Intronic
1050828834 9:9985189-9985211 AGACTCCCTTCTCAAGGCTGGGG - Intronic
1052894172 9:33731780-33731802 GGCCTCCCTCCCGACAGCTGAGG + Intergenic
1053073582 9:35115144-35115166 GGGGTTTCTTCCCTAAGCTGAGG - Intronic
1053130495 9:35611998-35612020 CAGCCCCCTTGCCAAAGCTGAGG - Intronic
1053385524 9:37684161-37684183 TGGCTGCCATCCCAAGGCTGGGG + Intronic
1053418658 9:37963030-37963052 GGGCTGCAGTCCCAAAGCAGAGG - Intronic
1056261582 9:84854197-84854219 GTTATCCCATCCCAAAGCTGAGG - Intronic
1056263893 9:84877030-84877052 TGTCTCCCTCCCCAAAGCTCAGG - Intronic
1056826996 9:89883468-89883490 GGACTCCCTTCCCACATCTGTGG - Intergenic
1060231314 9:121827453-121827475 GGGCTCCAGTCCCAGAGCTGGGG - Intronic
1060321785 9:122568641-122568663 GTCCTCCCTTCCCAAATCTATGG + Intergenic
1060984784 9:127813724-127813746 GGCCTCCCATCCCAAAGCCCTGG - Exonic
1061120823 9:128641254-128641276 GGGCTCCCTTTCTGAAGATGCGG + Intronic
1061584749 9:131558453-131558475 GGGCTCCTGTCCCACGGCTGGGG - Intergenic
1062412561 9:136432366-136432388 GCCCTCGCTTCCCAAAGCTCAGG + Intronic
1062494677 9:136826175-136826197 CGGCCCCCTGCCCATAGCTGAGG + Intronic
1203551145 Un_KI270743v1:165777-165799 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1186621034 X:11240441-11240463 TGGCTCCCTTCCTAAATCTCTGG - Intronic
1189649883 X:43177561-43177583 GGCCTCCCCTCCCCTAGCTGAGG + Intergenic
1190058830 X:47198093-47198115 GTTTTCCCCTCCCAAAGCTGGGG + Intronic
1192584163 X:72306783-72306805 GCGCTCCCTTCCCGGCGCTGGGG + Intronic
1194399112 X:93421183-93421205 GTGCTCACTTCCCAAAGATAAGG - Intergenic
1195705329 X:107734178-107734200 GGCTTCCCTTCCCAGAACTGAGG + Intronic
1197147105 X:123183448-123183470 GGACACGCCTCCCAAAGCTGCGG + Intergenic
1197723439 X:129760309-129760331 GGAGGGCCTTCCCAAAGCTGGGG - Intronic
1197819563 X:130530474-130530496 GGGACCACTTCCCAAGGCTGTGG - Intergenic
1201074863 Y:10179171-10179193 GGGCACCCTTTACAATGCTGGGG - Intergenic
1201152416 Y:11101380-11101402 GGCCCCGCTTCTCAAAGCTGCGG + Intergenic
1202110224 Y:21409709-21409731 GGGCTCCCTTCCCTGCCCTGAGG + Intergenic
1202161795 Y:21941806-21941828 TGGCTCCCTTCCCCACCCTGAGG + Intergenic
1202229561 Y:22644567-22644589 TGGCTCCCTTCCCCACCCTGAGG - Intergenic
1202313595 Y:23551598-23551620 TGGCTCCCTTCCCCACCCTGAGG + Intergenic
1202557208 Y:26118997-26119019 TGGCTCCCTTCCCCACCCTGAGG - Intergenic