ID: 985514981

View in Genome Browser
Species Human (GRCh38)
Location 5:337750-337772
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514969_985514981 6 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514965_985514981 23 Left 985514965 5:337704-337726 CCGGGGCTGCGGGAGGCCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514968_985514981 7 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data
985514971_985514981 5 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514981 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr