ID: 985514984

View in Genome Browser
Species Human (GRCh38)
Location 5:337759-337781
Sequence AGCTGGGGCTCGGGCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514969_985514984 15 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211
985514968_985514984 16 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211
985514971_985514984 14 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514984 Original CRISPR AGCTGGGGCTCGGGCCTCAT TGG Intronic
900116496 1:1031444-1031466 GGCTGGGCCTGGGGCCTCAATGG + Intronic
900571848 1:3362503-3362525 GGGTGGGGCTCGGGTGTCATCGG + Intronic
901754804 1:11435029-11435051 AGGTAGGGCCCGGGCCTCACAGG + Intergenic
902043556 1:13509558-13509580 CACTGGGGCTCTGGGCTCATGGG - Intronic
902870777 1:19312393-19312415 GGCTGGGGGTCGGGGCTCCTGGG + Exonic
903295686 1:22341936-22341958 CTCTGGGGCTTGGGCCTGATGGG + Intergenic
905232385 1:36522256-36522278 CTCAGGGGCTCGGGCCTCACAGG - Intergenic
906676135 1:47694753-47694775 GGCTGGGCCCCAGGCCTCATTGG - Intergenic
907266935 1:53267785-53267807 AGCTGGTGCTAGGCCCTCAGAGG - Intronic
907329727 1:53663169-53663191 AGATGGGGCTGGGGCCACACAGG - Intronic
908511942 1:64856700-64856722 AGCTGGGCCTCGGGGCTCCGTGG - Intronic
908772465 1:67609424-67609446 AGCTGGGGCTGGGGCCTGCTTGG - Intergenic
912525597 1:110280519-110280541 AGCTGGGCCTCTGTCCTCAGGGG - Intronic
915691830 1:157697985-157698007 AACTGTGGCTCTTGCCTCATGGG - Intronic
915896990 1:159819809-159819831 AGCTGGAGCCAGGGCCTCATAGG - Intergenic
920849819 1:209621165-209621187 AGCCAGGGCTCTGGCCTCAGTGG - Intronic
921196577 1:212763007-212763029 AGCTGGGCGTCCGGCCTTATGGG + Intronic
1063122789 10:3116292-3116314 AGCTGGGGTTCGAGCCCCACGGG + Intronic
1064016754 10:11778894-11778916 AGCTGGGGCTCCATCCTGATGGG - Intergenic
1065285583 10:24184584-24184606 AAATGGGGCTTTGGCCTCATGGG - Intronic
1066205741 10:33187718-33187740 ATCTGCTGCTCGGGCCTCAGTGG + Intronic
1067508444 10:46876031-46876053 AGATGGGGATGGGTCCTCATTGG + Intergenic
1067653805 10:48175818-48175840 AGATGGGGATGGGTCCTCATTGG - Intronic
1067691477 10:48504758-48504780 AGCAGAGGCTGGGGCCACATGGG + Intronic
1071875409 10:89838054-89838076 CGCTGGGCCTGGGGCCTCCTGGG - Intergenic
1072277238 10:93835142-93835164 AGTTGGAGGTGGGGCCTCATAGG - Intergenic
1073185467 10:101612921-101612943 ATCTGGGGCTCAAACCTCATTGG + Intronic
1073328984 10:102658716-102658738 AGCTGGGCCTTGGACCCCATAGG + Intergenic
1077594923 11:3523560-3523582 AGTTGGAGCTGGGGTCTCATTGG + Intergenic
1081549100 11:44095894-44095916 AGCGAGGGCTCGGGCCTCCGGGG + Intronic
1081969538 11:47188016-47188038 AGCTGGGGCTCATGGCTCAGCGG - Intergenic
1083999374 11:66288020-66288042 GGCTAGGGCTGGGGCATCATGGG - Intronic
1084213642 11:67635144-67635166 AGCTGGTGCAAGGGCCTGATGGG + Exonic
1084250837 11:67897548-67897570 AGTTGGAGCTGGGGTCTCATCGG + Intergenic
1084441932 11:69179515-69179537 AACTGGTGCTGGGGCCTCAGGGG - Intergenic
1084822010 11:71698503-71698525 AGTTGGAGCTGGGGTCTCATGGG - Intergenic
1089780057 11:120867399-120867421 AGCTGCAGCTCCAGCCTCATGGG + Intronic
1090375098 11:126282935-126282957 GGCAGGGGCTCGGGCCGCAGTGG + Intergenic
1090804126 11:130191893-130191915 AGGTGGGGCTGGGCCCCCATAGG + Intronic
1091632538 12:2172878-2172900 AGCCTTGGCTGGGGCCTCATGGG + Intronic
1092006882 12:5077568-5077590 AGTTGGGGCCCAGGCTTCATAGG - Intergenic
1092421092 12:8332332-8332354 AGTTGGAGCTGGGGTCTCATCGG + Intergenic
1094481491 12:30885796-30885818 AGCTGTGGCTTGGGCCCCAGGGG - Intergenic
1095256408 12:40041760-40041782 AACTGGGGCTCTCGCCTCTTGGG - Intronic
1095864430 12:46956069-46956091 AGCTGAGGCTGGGGTCTCACTGG + Intergenic
1095965583 12:47864906-47864928 ATCTGGGGCCAGGGCCTCAGTGG - Intronic
1095970759 12:47900689-47900711 AGCAAAGCCTCGGGCCTCATGGG + Intronic
1101930097 12:109006753-109006775 ACCTGAGGCTCTGGCCTGATTGG + Intronic
1102001098 12:109558558-109558580 AGGTGTGGCTCCAGCCTCATGGG + Intronic
1103939655 12:124494889-124494911 AGCTGGGGCTCTGCCCTCTCTGG - Intronic
1105858376 13:24390383-24390405 AGCTGGGCCTGGGGCCTCTCTGG - Intergenic
1113479696 13:110611463-110611485 GGCTGGGGCTGGGGTCTCAGTGG + Intergenic
1117285612 14:54283105-54283127 AGCTGGGGCTGGGCCCTCCATGG - Intergenic
1120712767 14:87809959-87809981 GGCTGGGGCTGGGGTCTCACTGG - Intergenic
1121423736 14:93833558-93833580 AGCTGGGGCTTGTGACTCAGGGG + Intergenic
1123683033 15:22776039-22776061 AGGTGGGGTTGGGGCCACATTGG + Intronic
1126032277 15:44511032-44511054 GGCTGGGGTTAGGGCCACATGGG - Intronic
1128349992 15:66882116-66882138 AGCTGGGGCTCGTGCCTCCAGGG + Intergenic
1129002526 15:72346395-72346417 AGCTGGGGTGAGGGCCACATTGG - Intronic
1129191685 15:73941335-73941357 CCCTGGGGCCTGGGCCTCATGGG - Intronic
1129301543 15:74628465-74628487 AGCTGGGGCTGCCGCTTCATTGG + Intronic
1129560101 15:76557435-76557457 TGCTGGAGGTGGGGCCTCATAGG + Intronic
1129778841 15:78255685-78255707 AGCTGTTCCTCGGTCCTCATTGG + Intergenic
1130912623 15:88281522-88281544 AGCTGGGGCTTGGCTCTCCTGGG + Intergenic
1131995035 15:98125334-98125356 GGCTGGTGTTCAGGCCTCATAGG + Intergenic
1132786301 16:1658651-1658673 CTCTGGGGCTCGGGCCTTTTGGG - Intronic
1133359816 16:5165397-5165419 AGCTGGAGCTGGGGTCTCATTGG + Intergenic
1133532006 16:6663897-6663919 AGCTGGGGCTCAGGCAGCAGTGG + Intronic
1134562046 16:15219264-15219286 AGCTGGAGCTGGGGCCGCCTTGG + Intergenic
1134922584 16:18130893-18130915 AGCTGGAGCTGGGGCCGCCTTGG + Intergenic
1136394884 16:29987369-29987391 AGCTGGCGCCGAGGCCTCATGGG + Exonic
1136551538 16:30984935-30984957 AGCTGGACCTCCGGCCTCCTGGG + Exonic
1138285948 16:55810403-55810425 AGCTGAGGGTCAGGCCTCAAAGG - Intronic
1142030326 16:87835315-87835337 AGCGGGGGCTCAGCCCCCATGGG - Intronic
1145897068 17:28465302-28465324 AGCTGGGGCTTGGCCCACAGTGG + Intronic
1146157423 17:30535750-30535772 AGCTGTGGCTCTGGCCTGGTTGG - Intergenic
1147636229 17:41966192-41966214 AGCTGAGGATCTGGCCTCAGAGG + Intergenic
1147761109 17:42798085-42798107 AGCTCGGGCTCGGGCAGCTTTGG + Exonic
1149994418 17:61399393-61399415 GGCTGGGGCTCGGGCCAGAGCGG + Intergenic
1152378550 17:79930640-79930662 AGGTGGGGTTCGGGCCTACTTGG - Intergenic
1152484145 17:80578768-80578790 AGCTGGGGCTTGGGCCACTGAGG + Intronic
1152487683 17:80605154-80605176 CCCTGGGGCTCGGGGCTTATGGG + Intronic
1152635573 17:81429306-81429328 AGCTGGAGCACGGGCCTCGCAGG - Intronic
1160726445 19:619829-619851 GGCTGGGGCGGGGGCTTCATGGG - Intronic
1160748484 19:722657-722679 AGCGAGGGCCCGGGCCTCAAGGG + Intronic
1162399036 19:10433571-10433593 AGCAGGGGCTGGGTGCTCATGGG - Intronic
1163534185 19:17867530-17867552 AACTGGGGCTGGGGTCTCTTGGG - Intergenic
1163784220 19:19266367-19266389 GCCTGGGGCTGGGGCCTCTTGGG + Intronic
1166504357 19:43361861-43361883 AGCTGAGGCTCTGGACTCCTGGG + Intronic
1166504397 19:43361971-43361993 AGCTGGGGGTCTGGGCTCCTCGG + Intronic
1166523968 19:43499422-43499444 AGCTGGGGGTCTGGACTCCTGGG + Intronic
1167314368 19:48755240-48755262 GGCTGGGGCTCTGGACTCCTGGG - Intronic
1167630916 19:50625773-50625795 AGCTGGGGATCTGGACTCCTGGG - Intronic
1167752785 19:51390755-51390777 AGCTGGGGATCTGGACTCCTGGG - Intergenic
1167752794 19:51390792-51390814 AGCTGGGGATCTGGACTCCTGGG - Intergenic
1167752804 19:51390829-51390851 AGCTGGGGATCTGGACTCCTGGG - Intergenic
1168059519 19:53883200-53883222 AGCTGGGGACCGGGGCTCCTGGG + Intronic
1168174024 19:54609678-54609700 TGGCGGGGCTCCGGCCTCATGGG - Intronic
1168200644 19:54812988-54813010 AGCTGGGTCTCCCGCCTCGTGGG + Intronic
1168527410 19:57100054-57100076 AGCTGGGGCTCGTGTATCATTGG + Intergenic
925046532 2:777148-777170 AGCTGGGCCTCGGGCCACCACGG + Intergenic
925108196 2:1310746-1310768 AGCCGGGCTTGGGGCCTCATGGG + Intronic
925144951 2:1575072-1575094 ATCTGGGGCTTTGGTCTCATGGG + Intergenic
925438964 2:3867555-3867577 GGCTGGGGCTAGGGTCTCACTGG - Intergenic
926241608 2:11093175-11093197 AGCAGGGGCTCAGGCCTGCTGGG - Intergenic
927482517 2:23465544-23465566 AGCTGGGGCTCTGTCCTGCTGGG - Intronic
929012163 2:37455989-37456011 AGATGGGGCTCTGGTCACATAGG - Intergenic
929394788 2:41510346-41510368 AGCTGGGGCATGGGCCTCACAGG - Intergenic
929598712 2:43191796-43191818 AGCAGGGGCTGTGGCCTCACAGG + Intergenic
931286584 2:60836897-60836919 AGCTGGGGCTCAGACTTTATTGG + Intergenic
931309571 2:61065775-61065797 GGCAGGGGCTCGGCGCTCATTGG + Intergenic
931721753 2:65072018-65072040 AGCTGAGGCCCGGGCCTCAGTGG - Exonic
935210353 2:100934729-100934751 AGCTGGGGCTCAGGCCACCAGGG - Intronic
937116137 2:119406357-119406379 CGCTTGGGCTCTGTCCTCATGGG - Intergenic
938163698 2:129008638-129008660 AGCTGTGGGTCTGGCCCCATGGG + Intergenic
939016884 2:136913654-136913676 AGCTTGGGCTGGGGCTTCAGAGG + Intronic
940854882 2:158722310-158722332 AGCTGGGATTTGGGCCTCAGGGG + Intergenic
944447346 2:199804986-199805008 AGCTGGGGCTCAGGCGTCTGAGG + Intronic
946075891 2:217073308-217073330 ATCTGGGGCTGGCGCCTCCTTGG + Intergenic
946861468 2:224003766-224003788 AGCAGGAGCTTGGGCCTCTTGGG - Intronic
947635584 2:231679287-231679309 TCATGGGGCTCGGGGCTCATGGG + Intergenic
947671873 2:231942032-231942054 AGCTAGGGCTGGGGCCACCTTGG + Intergenic
948395803 2:237644151-237644173 TGATGGGGCTTTGGCCTCATTGG + Intronic
948488224 2:238294745-238294767 AGCTGGTTCTCAGGCTTCATAGG - Intergenic
948543149 2:238704074-238704096 AGCTGGGGCTAGGGCTTGGTTGG + Intergenic
948699875 2:239752852-239752874 AGCTGGGGAACCGGCTTCATGGG - Intergenic
1170732236 20:18985342-18985364 AGCTGGGGCTCTGTCCTGCTGGG + Intergenic
1172020954 20:31913697-31913719 GGCTGGGGCTCTGGCCTGGTAGG - Intronic
1173884176 20:46442190-46442212 AGCTGGAGCTGGGGCCTTACTGG + Intergenic
1174303745 20:49600623-49600645 AGCTGGGGCTCCGTCCTGCTGGG - Intergenic
1175898839 20:62352102-62352124 AGCAGGGGCTAGGGCCACACTGG - Intronic
1175946088 20:62559412-62559434 AGCTGGTGCTCGGGCCTGCAAGG - Intronic
1178489021 21:33036282-33036304 GGCTGGGGCTTGGGCTTCACAGG - Intergenic
1179187735 21:39097527-39097549 AGCAGGAGCTCTGGCCTCAATGG - Intergenic
1179644748 21:42768615-42768637 TGCTGGGTCTCGGCCCTCCTGGG - Intronic
1179959337 21:44759368-44759390 AGGTGGGGCTTCGGCCTCAGCGG - Intergenic
1183082104 22:35463267-35463289 GGCTGGGTCTGGGGCCTCAGGGG - Intergenic
1183405795 22:37630008-37630030 AGCAGGGGCTGGGGGCTCAGTGG - Exonic
1183512658 22:38245134-38245156 GGCTGGGGCTCTGTCCCCATGGG - Intronic
1183700098 22:39446266-39446288 AGCTGGGCCTCGAGCCTCCTGGG - Intergenic
1183998804 22:41656788-41656810 TGCTGGGGCTGGGGCCCCGTAGG - Intronic
950065430 3:10108126-10108148 AGAAGGGGCTTGGGCCTCCTGGG + Exonic
950109034 3:10406893-10406915 AGCAGGGGCTCGGGACCCAGTGG - Intronic
950829252 3:15859046-15859068 AGGTGAGGCTCGGGCCTAACAGG - Intronic
953638985 3:44687964-44687986 AGCTGGAGCTAGGGTCTCACTGG - Intergenic
953675984 3:45002897-45002919 AGCTGGTGCTCGGGCCCTGTTGG + Intronic
953679683 3:45029992-45030014 AGCTGGGGCTCTGCCATCCTCGG + Intronic
954411516 3:50373335-50373357 GGCTGGGGCTCCGGCCCCACCGG - Intronic
954440092 3:50516988-50517010 AGCTGGGGCTGGGGCCTTGTAGG + Intergenic
954556239 3:51519780-51519802 AGATGGGGCCAGGGCCACATGGG - Intergenic
959342553 3:105149295-105149317 AGCTTGGGCTGGGGCTTCAGAGG - Intergenic
961898770 3:130191542-130191564 AGTTGGAGCTGGGGTCTCATCGG + Intergenic
962713527 3:138107734-138107756 AGCTTGGGCTGGGCCCACATAGG - Intronic
966417820 3:179707499-179707521 GACTGGGGCTCAGGCCACATGGG - Intronic
967155659 3:186689718-186689740 AACTGAGACTCGGGCATCATAGG + Intergenic
967156948 3:186701883-186701905 AACTGAGACTCGGGCATCATAGG + Intergenic
968617437 4:1584590-1584612 AGCTGGGGCTAGAGCCACCTGGG + Intergenic
969475542 4:7420670-7420692 AGATGGGGCACGGGGCTCAGGGG - Intronic
972875369 4:43352271-43352293 TGCTGGAGCTTGGTCCTCATGGG - Intergenic
975445180 4:74455814-74455836 AGCTGAGGCTGGGAGCTCATTGG - Intergenic
975855646 4:78621718-78621740 AGCTGGGGCTCAGACTTCCTGGG - Intergenic
976727121 4:88225561-88225583 AGCTGGGGCTGGGGCTCCATAGG + Intronic
977330807 4:95635036-95635058 AGCTGGGGCTCAGTCCTGATGGG - Intergenic
977996530 4:103502543-103502565 AGCTTGGGCTCTGGCTTCAGAGG + Intergenic
978739819 4:112123878-112123900 ACCTGGGGTTCAGACCTCATTGG + Intergenic
979602978 4:122606518-122606540 AGCTGGGGGTGGGGCCTGGTGGG + Intergenic
984714882 4:182916837-182916859 AGCTGGGCCTCAGTCCTCACAGG - Intronic
985514984 5:337759-337781 AGCTGGGGCTCGGGCCTCATTGG + Intronic
986457502 5:7933968-7933990 AGCCAGGGGTCTGGCCTCATCGG + Intergenic
989128521 5:38080241-38080263 AGCTTGTGCTCTGGCCTCAGTGG - Intergenic
990093402 5:52083158-52083180 GGCTGGGGCAGGGCCCTCATGGG - Intergenic
992115062 5:73531835-73531857 GGCTGGGGCTGGGGCCTCACTGG + Intergenic
992778737 5:80109766-80109788 AGCTGGCTCTCGGGCCAGATAGG - Intergenic
993334993 5:86645997-86646019 TGCTGGAGGTGGGGCCTCATGGG + Intergenic
996522995 5:124448200-124448222 TGCTGGGGAGTGGGCCTCATCGG - Intergenic
997822993 5:137082720-137082742 AGCTGGGCCTCGGCCCACAGAGG + Intronic
999533814 5:152494021-152494043 TGCTGGAGGTGGGGCCTCATGGG - Intergenic
1001306963 5:170582091-170582113 TGTTGGGGGTGGGGCCTCATGGG - Intronic
1002069437 5:176670619-176670641 AGCTGGTGCTGAGGCCTCAGGGG - Intergenic
1003488155 6:6597304-6597326 ACCTGGAGCTCCTGCCTCATGGG - Intronic
1003567194 6:7231229-7231251 AGCGGGGGCTTGGGCCGCAGTGG - Exonic
1003770810 6:9297466-9297488 AGCTGAGGCTCCAACCTCATTGG - Intergenic
1004756568 6:18617199-18617221 AGCTGGAGTTGGGGCCTAATGGG + Intergenic
1005638905 6:27776190-27776212 GGCTGGGGCTGGGGTCTCACTGG + Intergenic
1006552508 6:34836353-34836375 AGCCCAGGCTCAGGCCTCATGGG - Intronic
1006840513 6:37025567-37025589 AGCTCGGGCTCGGGGCTCTTAGG - Intronic
1008872456 6:56288682-56288704 AGCTGGCCCTCGGGCTTCCTTGG - Intronic
1010002838 6:70965432-70965454 AGTTGGGGGTGGGACCTCATGGG - Intergenic
1011170936 6:84503808-84503830 AGCTGGGGCCCTGGCTTCAGAGG + Intergenic
1017783332 6:157733592-157733614 AGCTGAAGCTGGGGCCTCCTAGG - Intronic
1018420031 6:163633204-163633226 AGCTGGGGCTGCAGTCTCATCGG + Intergenic
1018643787 6:165929556-165929578 AGCTGGGGCATGGGACACATAGG - Intronic
1019577415 7:1744194-1744216 AGCAGGGACTCAGGCCACATTGG + Intronic
1021989995 7:26131911-26131933 AGCTGGGGCTGGTGGCACATGGG + Intergenic
1022479545 7:30733979-30734001 AGCTGGGGCACAGGCTTCATGGG - Intronic
1023300793 7:38768912-38768934 AGCTGGGGCTATGGCATCCTGGG - Intronic
1023513020 7:40973183-40973205 AACAGGGGCTTAGGCCTCATGGG - Intergenic
1029123749 7:98284079-98284101 ATCTTGGGCTCGGCCCTCAGAGG + Intronic
1029437302 7:100570434-100570456 GCCCGGGGCTCGGGCCTCACCGG - Intergenic
1029445777 7:100612282-100612304 AGCTCGGACACGGGCCCCATCGG - Intronic
1031238666 7:119210836-119210858 AGCTGGGGCTATGGCTTCAGAGG + Intergenic
1032075492 7:128833928-128833950 GGCTGGGGCTCTGGCCGCCTGGG - Intronic
1032756641 7:134897224-134897246 AGCTCAGGCTCTGGCCTCAAGGG + Intronic
1034191969 7:149219996-149220018 AGCTGGGGCACGGGCCACATGGG + Intronic
1034223077 7:149460424-149460446 AGCTGGGCCCCGGCCCTCAACGG + Intronic
1036251030 8:7162731-7162753 AGTTGGAGCTGGGGTCTCATGGG + Intergenic
1036366458 8:8124729-8124751 AGTTGGAGCTGGGGTCTCATGGG - Intergenic
1036640502 8:10580472-10580494 TGCTGGAGGTCGGGCCTGATGGG + Intergenic
1036749681 8:11435964-11435986 AGCTGGGGCAAGCGCCACATGGG - Intronic
1037227793 8:16615205-16615227 AGCCGGGGCTCTGTCCTCAGGGG + Intergenic
1037787880 8:21913110-21913132 AGCTTGGGCTGGGGCCTCTGGGG - Intronic
1043254597 8:78118394-78118416 TGCTGGGGCTCTGGCATCAGAGG + Intergenic
1045379119 8:101605358-101605380 AGCATGGGCTCTGGACTCATAGG - Intronic
1049318310 8:141981411-141981433 AGCTGGGGTGTGGGCCTTATGGG + Intergenic
1051957438 9:22713161-22713183 AGCTTGGGCTGTGGCCTCAGAGG + Intergenic
1055206225 9:73733869-73733891 AGCTGGTGCTCAGACCTCTTGGG + Intergenic
1056617052 9:88177823-88177845 GGCTGGGGCTGGGGTCTCACTGG - Intergenic
1056961324 9:91126582-91126604 ACCTGTGGCTCAGGCCCCATGGG + Intergenic
1057277964 9:93686314-93686336 AGCTGGCGCTGGGGCCACAGTGG + Intergenic
1057999283 9:99848809-99848831 AGCTGGGGCAAGGGCCTCCATGG - Intronic
1059307684 9:113367609-113367631 AGCTGGGGCTAAGACCTCCTGGG - Intronic
1060489004 9:124068231-124068253 ACCTGGGCCTAGGGCCTCGTTGG + Intergenic
1061848069 9:133399318-133399340 TGCAGTGGCTCGGGCCTCAGAGG + Intronic
1203790961 EBV:151274-151296 AGCTGGGGCACGGGCCGCCGAGG - Intergenic
1190274408 X:48891200-48891222 AGCTGGGGCTGGGGCGCCCTGGG - Intergenic
1192043069 X:67643632-67643654 AGCTGGGGCTTGGGGCTCAGTGG + Intronic
1192163656 X:68808878-68808900 AGCAGGGGCTTGGGCCTCTCTGG + Intergenic
1199785806 X:151103829-151103851 AGCTGGGACTCAGACCTCAGAGG + Intergenic