ID: 985514985

View in Genome Browser
Species Human (GRCh38)
Location 5:337762-337784
Sequence TGGGGCTCGGGCCTCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514968_985514985 19 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514969_985514985 18 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514978_985514985 -10 Left 985514978 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207
985514971_985514985 17 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514985 Original CRISPR TGGGGCTCGGGCCTCATTGG AGG Intronic
901870009 1:12133008-12133030 TGGAGCAGGGGCCTCCTTGGCGG - Intronic
902116425 1:14125304-14125326 TGGGGCTTGGGGGTCAATGGTGG + Intergenic
903648779 1:24910723-24910745 CTGGTCTGGGGCCTCATTGGAGG - Intronic
905474158 1:38214055-38214077 TGGGGCTCGGAGCTCAGTGTGGG - Intergenic
906567159 1:46809298-46809320 TGGAGGTGGGGCCTCATGGGAGG - Intronic
908238903 1:62172646-62172668 TGAGGCTCTGGCCACACTGGAGG - Intergenic
908396194 1:63727871-63727893 TGGAGGTGGGGCCTGATTGGAGG + Intergenic
908948915 1:69535734-69535756 TGGAGGTGGGGCCTAATTGGAGG - Intergenic
911860196 1:102937486-102937508 TGGGGGTGGGGCCTAAATGGAGG + Intronic
915691829 1:157697982-157698004 TGTGGCTCTTGCCTCATGGGTGG - Intronic
917045799 1:170858847-170858869 TGGGGGTGGGGCCTAATGGGAGG + Intergenic
918046510 1:180944869-180944891 TGGGTCACGGGCCTCTTTGGGGG - Intronic
919804920 1:201375847-201375869 TGGTGCTGGGGCCTCACAGGAGG + Intronic
923496414 1:234529472-234529494 TGGGGCTGGGGTCTCATCTGAGG - Intergenic
924948080 1:248859078-248859100 TGGGGCGCGGGCCTCAGTTCCGG - Intronic
1064021633 10:11813808-11813830 TGGGGTTGGGGTGTCATTGGTGG + Intergenic
1067008790 10:42690969-42690991 TGGGGCACAGGCGTCATGGGGGG - Intergenic
1067432465 10:46253138-46253160 TGGGGCTCCAGCCTCACCGGCGG - Intergenic
1067573402 10:47388004-47388026 TGGGGCAAGGACCTCATTGGAGG - Intergenic
1067932883 10:50581138-50581160 TTGGTCTGGGGTCTCATTGGAGG - Intronic
1070728221 10:78807026-78807048 TGGGGACCTGGCCTCAGTGGAGG - Intergenic
1071797371 10:89021097-89021119 TGGAGGTAGGGCCTGATTGGAGG + Intergenic
1074197852 10:111205117-111205139 TGGAGGTGGGGCCTCATGGGAGG + Intergenic
1075267454 10:121014943-121014965 TGGAGGTAGGGCCTCATGGGAGG - Intergenic
1075325489 10:121528833-121528855 TGGGGCTGGGGCCTGACTTGAGG - Intronic
1076203919 10:128579936-128579958 TGGGGCTCAGGTCTAATTTGTGG - Intergenic
1076381803 10:130028628-130028650 CATGGCTGGGGCCTCATTGGAGG - Intergenic
1076457265 10:130609068-130609090 TGTGGCTCTGGCCTCATGGCTGG + Intergenic
1076594335 10:131616589-131616611 AGGGGCTCTGCCCTCATCGGGGG - Intergenic
1076696795 10:132251068-132251090 TGGGGCTCAGGGCTCCTTGGGGG - Intronic
1077405318 11:2379946-2379968 ATGGGCTTGGGCCTCCTTGGTGG + Intronic
1077508180 11:2941689-2941711 GGGGGCTCTGGCCCCATGGGTGG + Intergenic
1079498717 11:21076671-21076693 TGGAGGTAGGGCCTAATTGGAGG + Intronic
1083180579 11:60982191-60982213 TGGGGCTAGGGGCTTCTTGGGGG + Intronic
1084148769 11:67278485-67278507 TGGGGCTGGGGCCTCAGGGCAGG - Intronic
1084837555 11:71813768-71813790 TGGGGCTGGGGCCTCCGGGGAGG - Intergenic
1085053786 11:73392725-73392747 TGGGGATCTGGACTCTTTGGAGG + Intronic
1090585415 11:128206682-128206704 TGGAGGTAGGGCCTAATTGGAGG + Intergenic
1090804127 11:130191896-130191918 TGGGGCTGGGCCCCCATAGGTGG + Intronic
1091260522 11:134230559-134230581 TGGGGCTGCGTCCTCACTGGGGG + Intronic
1091687746 12:2575546-2575568 TGTGGCTGGGGCTTCATGGGAGG - Intronic
1092006881 12:5077565-5077587 TGGGGCCCAGGCTTCATAGGTGG - Intergenic
1092401145 12:8180302-8180324 TGGGGCTGGGGCCTCCGGGGAGG + Intronic
1092670394 12:10854932-10854954 TGGGGGAGGGGCTTCATTGGAGG + Intronic
1093778719 12:23108733-23108755 TGGGACGCTGGCCTCAGTGGTGG - Intergenic
1095104357 12:38213639-38213661 TGTGGCTAGGGCCTCATTTTAGG - Intergenic
1096907780 12:54951134-54951156 TGGAGGTGGGGCCTCATGGGAGG + Intronic
1097118624 12:56717087-56717109 GGGGGCTGGGGGCTCCTTGGGGG + Intronic
1102366314 12:112338937-112338959 TGGGGGTTGGGCCTGATGGGAGG - Intronic
1103637435 12:122319267-122319289 TGAGACTCTGGCCTCCTTGGAGG - Exonic
1103949211 12:124542141-124542163 TGGGGCTCCAGCCTCAATGCTGG + Intronic
1104766462 12:131333336-131333358 AGGGGCAGGGGCCACATTGGGGG + Intergenic
1104920575 12:132288544-132288566 TGGGGCTCAGGCCTCAGGTGGGG + Intronic
1105858375 13:24390380-24390402 TGGGCCTGGGGCCTCTCTGGAGG - Intergenic
1106314205 13:28579003-28579025 TGGGGCTCTGCCCTCATGAGTGG + Intergenic
1106433998 13:29708034-29708056 TGGGGCCGGGGCCTCTCTGGAGG - Intergenic
1110928997 13:81192620-81192642 TGGAGGTAGGGCCTCATGGGAGG + Intergenic
1113507775 13:110828990-110829012 TGGGGGTGGGGCCTGATGGGAGG - Intergenic
1113937488 13:114002041-114002063 TGAGGCTCGGCCTTCATTGCCGG + Intronic
1116420500 14:44726841-44726863 TGGAGATGGGGCCTAATTGGGGG + Intergenic
1118301583 14:64621568-64621590 TGGAGGTGGGGCCTCATGGGAGG + Intergenic
1121917001 14:97844440-97844462 TAGGGCTCGGGTCTCATCAGTGG + Intergenic
1122837009 14:104435380-104435402 TGGGGCGTGGGCCTCATTTTAGG - Intergenic
1124477716 15:30049407-30049429 GGGGGCTCTGCCCTCATGGGTGG - Intergenic
1128622428 15:69161370-69161392 TGGGGCCGGGGCCGCCTTGGGGG + Intronic
1129560102 15:76557438-76557460 TGGAGGTGGGGCCTCATAGGAGG + Intronic
1129777779 15:78248000-78248022 TGGGGCTGTAGCATCATTGGAGG + Intergenic
1129932336 15:79422135-79422157 GAGGGCTGGGGCCTCACTGGAGG - Intronic
1130191401 15:81739620-81739642 TAGGGCTCGGGTCTCATCAGAGG + Intergenic
1132025810 15:98403653-98403675 AGGGGCCCGGGCCGCAGTGGTGG + Intergenic
1132028431 15:98421524-98421546 AGGGGCTTGGGCTTCAGTGGGGG + Intergenic
1132732709 16:1370624-1370646 TGGGTGTCCGGCCTCTTTGGGGG - Intronic
1132945540 16:2529843-2529865 TGGGCCTTGGGCCCCAGTGGGGG + Intronic
1132977282 16:2717048-2717070 TGGGGCTCGGGCCTCAGCCTCGG - Intronic
1134208574 16:12257458-12257480 TGGGGCATGGGCATCTTTGGGGG + Intronic
1134562047 16:15219267-15219289 TGGAGCTGGGGCCGCCTTGGAGG + Intergenic
1134874870 16:17688964-17688986 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
1134922585 16:18130896-18130918 TGGAGCTGGGGCCGCCTTGGAGG + Intergenic
1137069923 16:35895350-35895372 TGGAGATGGGGCCTCATGGGAGG + Intergenic
1137910501 16:52373316-52373338 TGGAGATGGGGCCTCATGGGAGG - Intergenic
1138590320 16:57996069-57996091 TGGGGCTGGGGCCCCAGAGGTGG - Exonic
1141606849 16:85158779-85158801 CCGAGCTGGGGCCTCATTGGGGG - Intergenic
1143322867 17:6079431-6079453 TGGGTTTCGGTTCTCATTGGCGG - Intronic
1144680181 17:17188101-17188123 TGGGGCTGGGGCACCATGGGTGG - Exonic
1145978867 17:28999702-28999724 TGGGGGCTGGGCCTCAGTGGAGG + Intronic
1147442144 17:40453816-40453838 TGGGGCTCAGGCCTCCTTTCGGG + Intronic
1147656602 17:42094753-42094775 TGGGGGTCGAGCCCCACTGGGGG + Intergenic
1148235777 17:45968057-45968079 TGGCTCTGGGGCCTCAGTGGGGG - Intronic
1148737745 17:49874348-49874370 AGGGGCTCGGGCTTCCTTTGGGG + Intergenic
1151067356 17:71166588-71166610 TGGGGCTTGGGGTTCATTTGGGG - Intergenic
1151540818 17:74763805-74763827 GGGGGCTTGGGCCTCCTTTGGGG - Intronic
1151555716 17:74845800-74845822 AGGGGCTCAGGCCTCATGGTGGG - Intronic
1152170787 17:78746444-78746466 TGGAGCTCGGGTCTCCTTGTGGG - Intronic
1152294026 17:79456335-79456357 TGGGGCTGGGTCCTTCTTGGTGG + Intronic
1156731329 18:40196821-40196843 TGGAGGTAGGGCCTCATTGAAGG - Intergenic
1157929066 18:51800473-51800495 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
1158839062 18:61364210-61364232 TGGGGGTGGGGCCTAATGGGAGG + Intronic
1161343091 19:3753273-3753295 GGGGCCTGGGGCCTCATGGGTGG + Intronic
1161950525 19:7465197-7465219 AGGGGCTGGGGCCTCCTGGGAGG - Intronic
1163007691 19:14406783-14406805 TGGCGCTCGGGCTTCGGTGGAGG - Intronic
1163262283 19:16198350-16198372 GGGGGCTCGGGCCTCGGTGGAGG + Intronic
1163532708 19:17860010-17860032 TGGGGCACGGGCCCCATCAGGGG + Intronic
1165049518 19:33132553-33132575 TGGGCCTAGGGCCTCGCTGGGGG - Intronic
1166930669 19:46299283-46299305 TGGGGCAGGGGCCTCTTGGGTGG + Intronic
1167712212 19:51119338-51119360 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
1167722873 19:51190821-51190843 AGAGACTCGGGCCTGATTGGGGG + Intergenic
1168278985 19:55293959-55293981 TGGGGCCTGGGCCTCCTGGGAGG + Intronic
925427644 2:3763543-3763565 TGGGACTAGGGCCACCTTGGCGG - Intronic
926109152 2:10171004-10171026 CGGGGCTCAGGCCTCATCAGGGG + Intronic
926139438 2:10359578-10359600 CAGGGCTCTGGCCTCATTGAGGG + Intronic
926322861 2:11760815-11760837 TGGGGTTGGGGCCTCACTGCTGG + Intronic
929394787 2:41510343-41510365 TGGGGCATGGGCCTCACAGGAGG - Intergenic
930537691 2:52665090-52665112 TGGAGGTAGGGCCTGATTGGAGG + Intergenic
931534283 2:63255406-63255428 TGGAGGTAGGGCCTCATGGGAGG + Intronic
933500794 2:83108663-83108685 TGGAGCTCCAGCCTCTTTGGTGG + Intergenic
934764157 2:96870855-96870877 TGTAGCTCTGGCCTCATGGGCGG + Intergenic
934852680 2:97711378-97711400 TGGGGCGCTGGCCTCCTTCGGGG + Intergenic
934942176 2:98510629-98510651 GAGGGCTCTGGCCTCATAGGTGG - Intronic
936694240 2:114928043-114928065 TGGAGGTGGGGCCTCATGGGAGG - Intronic
936847148 2:116850696-116850718 TGAGGTTGGGGCCTCATTAGGGG + Intergenic
937616206 2:123924740-123924762 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
943428656 2:187769949-187769971 TGGGGCTGGGGCCAGGTTGGAGG + Intergenic
943453320 2:188072792-188072814 TTGGGCTCTGGCCCCAATGGTGG - Intergenic
944142294 2:196469829-196469851 TGGGGCGGGGGACTAATTGGAGG + Intronic
945836646 2:214842171-214842193 TGGAGCTGGGGCCTGATAGGAGG - Intergenic
946382592 2:219358938-219358960 TGGGGCTCGGGGCCCAGCGGGGG - Intergenic
948386503 2:237584088-237584110 AGGGCCTCGCGCCTCATTGTCGG + Intronic
1170091143 20:12590843-12590865 TGGAGGTCGGGCCTGGTTGGGGG - Intergenic
1173295412 20:41750982-41751004 GGGGGCTCAGGCCTCATGGGAGG + Intergenic
1174065618 20:47862796-47862818 TGGGGCTGGGGTCTCATTTGAGG + Intergenic
1176239163 20:64067937-64067959 TGGGGCTGGGGCCGTGTTGGTGG + Intronic
1179187734 21:39097524-39097546 AGGAGCTCTGGCCTCAATGGAGG - Intergenic
1179420500 21:41232500-41232522 TGGACCTGGGGCCTCAGTGGAGG + Intronic
1179971941 21:44840945-44840967 TGGGGCTCAGTCCTCACAGGAGG - Intergenic
1180219654 21:46350487-46350509 TGTGGCCAGGTCCTCATTGGAGG + Intronic
1182995528 22:34808620-34808642 TGGGGCATGGGCATCTTTGGTGG - Intergenic
1184200941 22:42968911-42968933 TGGGGCTCAGTCCACATTTGAGG - Intronic
1184265420 22:43343500-43343522 GGGGGCTCGGGCGTCGTCGGGGG + Intergenic
1184361189 22:44019795-44019817 TGGGAGTCGGGCCTGATGGGGGG - Intronic
1185030753 22:48441705-48441727 TGGGGCTGGGGCCTCCATGCCGG - Intergenic
1185278718 22:49960913-49960935 TGGGGCTCGGGGCTCCGGGGAGG + Exonic
949597475 3:5563176-5563198 GAGGGCTCTGGTCTCATTGGTGG + Intergenic
950829251 3:15859043-15859065 TGAGGCTCGGGCCTAACAGGTGG - Intronic
952068323 3:29600261-29600283 TGGAGCTGGGGCCTAGTTGGAGG + Intronic
953473102 3:43183272-43183294 TGGGCCTCTGGTCTCATTGAGGG + Intergenic
954440093 3:50516991-50517013 TGGGGCTGGGGCCTTGTAGGAGG + Intergenic
954445928 3:50546884-50546906 TGGGGCTGGGGCCACAGTGTGGG + Intergenic
956772901 3:72541618-72541640 TGGGGCTGTGGTCTCATTAGAGG + Intergenic
960014415 3:112870896-112870918 TGGAGATCGGGCCACATGGGTGG - Intergenic
961367819 3:126412409-126412431 TAGGGCACGGGCATCTTTGGGGG + Intronic
961815348 3:129547410-129547432 TGTGGCTCGGGCCTCCTGGTGGG - Exonic
964623974 3:158741222-158741244 AGGTGCTTGGGACTCATTGGGGG + Intronic
965047163 3:163593965-163593987 TGGGGCTATGGGCTCAATGGGGG - Intergenic
965990265 3:174809813-174809835 TGGAGGTGGGGCCTCATGGGAGG + Intronic
966624580 3:182002247-182002269 TGGAGCTTGTTCCTCATTGGAGG - Intergenic
966689947 3:182731807-182731829 TGGAGGTGGGGCCTCATGGGAGG + Intergenic
967100344 3:186210696-186210718 TGGGGCCTGGGCCTCCCTGGAGG - Intronic
968156974 3:196389532-196389554 TGGGGGTGGGGCCTCGTAGGTGG + Intronic
969475541 4:7420667-7420689 TGGGGCACGGGGCTCAGGGGAGG - Intronic
969778969 4:9381279-9381301 TGGGGCTGGGGCCTCCGGGGAGG - Intergenic
971856909 4:32055480-32055502 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
976727122 4:88225564-88225586 TGGGGCTGGGGCTCCATAGGAGG + Intronic
982866470 4:160518888-160518910 TGGAGGTGGGGCCTAATTGGAGG + Intergenic
983490191 4:168380313-168380335 TGGAGGTGGGGCCTGATTGGAGG + Intronic
984419492 4:179501878-179501900 TGCGGATGGGGCCTAATTGGAGG - Intergenic
985514985 5:337762-337784 TGGGGCTCGGGCCTCATTGGAGG + Intronic
994313705 5:98307512-98307534 GGGAGCTGGGGCCTCATGGGTGG + Intergenic
996049699 5:118918044-118918066 TGGGGGTGGGACCTCATTGGAGG - Intronic
996250165 5:121319283-121319305 TGGTGCTTTGCCCTCATTGGTGG + Intergenic
999533813 5:152494018-152494040 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
1001306962 5:170582088-170582110 TGGGGGTGGGGCCTCATGGGAGG - Intronic
1001799920 5:174534239-174534261 AGGGGCTGGGGCCTCACTGAGGG + Intergenic
1002333561 5:178462247-178462269 TGGGGATTGGGCCTGATTGCTGG - Intronic
1002478834 5:179485988-179486010 TGGGGCTCGGCCCTCAGGGTGGG - Intergenic
1002494129 5:179600249-179600271 TGGAGCTCGGGCCCGAGTGGCGG - Intronic
1003255816 6:4474139-4474161 TGGGGCTGGGGTCTCATGTGAGG - Intergenic
1003770809 6:9297463-9297485 TGAGGCTCCAACCTCATTGGAGG - Intergenic
1005254532 6:23986587-23986609 TAGGGCTCTGCCCTCATTAGTGG - Intergenic
1007816965 6:44531485-44531507 TGGGGCTCGGCCTTCATCAGAGG + Intergenic
1010266392 6:73872982-73873004 TGGAGCTGGGGCCCAATTGGAGG + Intergenic
1010623530 6:78106850-78106872 AGGGGCTCTGCCCTCATGGGTGG + Intergenic
1011665476 6:89628878-89628900 TGGAGGTGGGGCCTCATGGGAGG - Intronic
1015519287 6:134114874-134114896 TGGGGCTTGGGCCTCTTTTATGG + Intergenic
1018916504 6:168135587-168135609 GGGGGCTCTGCCCTCATGGGTGG - Intergenic
1019885783 7:3903770-3903792 TGGAGGTGGGGCCTCATGGGAGG + Intronic
1021485272 7:21160990-21161012 TGGGGCTCTGAAATCATTGGAGG - Intergenic
1021759318 7:23887960-23887982 TGGAGATAGGGCCTCTTTGGAGG - Intergenic
1022814928 7:33904951-33904973 TGGGGCCCTGGCCTCCCTGGAGG + Exonic
1033528505 7:142240856-142240878 TGGTGCTGGGGCCTCCCTGGAGG + Intergenic
1034164300 7:149013928-149013950 TGGGGCCCTGGCCTGATGGGTGG - Intronic
1035147051 7:156829342-156829364 TGGAGGTGGGGCCTCATGGGAGG + Intronic
1036344931 8:7955107-7955129 TGGGGCTGGGGCCTCCGGGGAGG + Intergenic
1036640503 8:10580475-10580497 TGGAGGTCGGGCCTGATGGGAGG + Intergenic
1036840270 8:12115874-12115896 TGGGGCTGGGGCCTCCGGGGAGG + Intergenic
1036862060 8:12362111-12362133 TGGGGCTGGGGCCTCCGGGGAGG + Intergenic
1038920492 8:32078159-32078181 TGGAGGTGGGGCCTCACTGGAGG + Intronic
1047435645 8:124833602-124833624 TGGAGGTGGGGCCTCATGGGAGG + Intergenic
1049402253 8:142433653-142433675 AGGGGCTTGGGCTTCATGGGAGG + Intergenic
1055591831 9:77823786-77823808 TGGGGGAAGGGCCTCATGGGAGG - Intronic
1056143511 9:83707466-83707488 TGGGGCTCGGGCCGGGATGGGGG - Intronic
1057795031 9:98149699-98149721 TGGAGGTGGGGCCTCATGGGAGG - Intronic
1060167018 9:121425794-121425816 TGGGGATGGGGCCTAATTGGGGG - Intergenic
1061821942 9:133233818-133233840 TGGGGTTCCGTCCTCCTTGGTGG + Intergenic
1061962623 9:133995753-133995775 CGGGGCTCCCGCCTCACTGGAGG + Intergenic
1062045142 9:134421539-134421561 TGGGGCCTGGGCATCTTTGGGGG + Intronic
1062401079 9:136372923-136372945 TGGGGGCCGGGCCTCATCTGGGG - Intronic
1186261865 X:7788797-7788819 TGGAGGTGGGGCCTCATGGGAGG + Intergenic
1187532061 X:20106070-20106092 TGGGGCTCTGCCCTCATGAGTGG - Intronic
1187802798 X:23082783-23082805 GGGGGCTCTGGCCTCATTTATGG - Intergenic
1188967943 X:36578134-36578156 TGGAGTTCGGGCCTGATGGGAGG - Intergenic
1189851140 X:45177349-45177371 TGGAGGTGGGGCCTCATGGGAGG + Intronic
1192090632 X:68152125-68152147 TGGAGGTGGGGCCTCATGGGAGG - Intronic
1192137423 X:68616777-68616799 TGGGGGTGGGGCCTAATGGGAGG - Intergenic
1192491486 X:71579798-71579820 TGGGGTTGAGGCCTGATTGGTGG + Intronic
1193282382 X:79668718-79668740 TGGAGGTGGGGCCTCATGGGAGG - Intergenic
1196496313 X:116328555-116328577 TGGAGCTGGGGCCTGGTTGGAGG + Intergenic
1197001416 X:121443813-121443835 TGGAGGTGGGGCCTTATTGGGGG - Intergenic