ID: 985514986

View in Genome Browser
Species Human (GRCh38)
Location 5:337765-337787
Sequence GGCTCGGGCCTCATTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514980_985514986 -8 Left 985514980 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG 0: 1
1: 0
2: 1
3: 22
4: 172
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514968_985514986 22 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514971_985514986 20 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514978_985514986 -7 Left 985514978 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139
985514969_985514986 21 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514986 Original CRISPR GGCTCGGGCCTCATTGGAGG AGG Intronic
902870548 1:19311547-19311569 GGCGGGGGCATCAATGGAGGTGG + Intronic
904264597 1:29311079-29311101 GGCTCAGGCCTCATGGGTGTGGG + Intronic
908400393 1:63767300-63767322 GGTTCAGACCTCATTGGAGAAGG - Intergenic
908842531 1:68294194-68294216 GGCTGGGGATTAATTGGAGGGGG - Intergenic
913180772 1:116318971-116318993 GGGTGGGGCAGCATTGGAGGGGG + Intergenic
919250870 1:195054569-195054591 GGCTCAGGCCACACAGGAGGGGG - Intergenic
920681108 1:208073414-208073436 GGCTGGGGCTACATTGGAAGAGG + Intronic
921277958 1:213537947-213537969 GGCAGGGACCTCATTGTAGGAGG + Intergenic
922474771 1:225899287-225899309 GGCTGGGCCCTCAGTGGGGGTGG + Intronic
923520093 1:234728643-234728665 GGCTTGGGCTTCTTTGGAGAAGG - Intergenic
924359214 1:243218364-243218386 GGCAAGGGCCCCAGTGGAGGAGG + Intronic
1063072233 10:2678173-2678195 GGCTCGTGACTCATTGCAAGTGG - Intergenic
1063362499 10:5469644-5469666 GGCTCTGGCCTCAGGGGATGTGG + Intergenic
1063602875 10:7497809-7497831 GGGTCAGGCCTAAATGGAGGGGG + Intergenic
1066781086 10:38945113-38945135 GGCCCGGGCCTTGGTGGAGGTGG - Intergenic
1067573401 10:47388001-47388023 GGCAAGGACCTCATTGGAGGTGG - Intergenic
1067774510 10:49153261-49153283 GGTTCGGGAGTCATTGGATGTGG - Intergenic
1073464685 10:103687556-103687578 GGCTCTGGCAGCAGTGGAGGGGG - Intronic
1075630103 10:123995563-123995585 GGCTCGTGCCCCAGTGGCGGGGG - Intergenic
1077413422 11:2413849-2413871 GCCTCTGGCCTCAGTGGAAGTGG - Intronic
1077476755 11:2794108-2794130 GGCTCCGGCTTCGTGGGAGGAGG + Intronic
1080615532 11:33941936-33941958 GGCTCTGGCCTTATCGGAGCAGG - Intergenic
1081667039 11:44922715-44922737 TGATGGGTCCTCATTGGAGGAGG + Intronic
1081938110 11:46918522-46918544 GGCTCTGGCAGCACTGGAGGCGG - Exonic
1084069972 11:66727921-66727943 GACTCGGGCCTCTCTGGAGCCGG - Intronic
1084148766 11:67278482-67278504 GGCTGGGGCCTCAGGGCAGGGGG - Intronic
1085782424 11:79421912-79421934 ACCTTGGGCCTCATTGAAGGGGG - Intronic
1087293262 11:96341819-96341841 GGGGCGGGGCTCCTTGGAGGGGG - Exonic
1096653850 12:53076156-53076178 GGCTCTGTCCTCAGTGGAGCTGG + Intronic
1097119199 12:56718761-56718783 TGCTCGGGCCTTTTTGGGGGAGG + Intronic
1101723882 12:107373941-107373963 AGCTCGGGACACGTTGGAGGCGG + Intronic
1103742179 12:123098270-123098292 GGGTTGGGGCTCATGGGAGGAGG + Intronic
1104620725 12:130310764-130310786 GGCTCAGACCTCATTGGAGAAGG + Intergenic
1104748680 12:131224829-131224851 GGGCGGGGCCACATTGGAGGGGG + Intergenic
1104784444 12:131440735-131440757 GGGCGGGGCCACATTGGAGGGGG - Intergenic
1107617230 13:42182121-42182143 GGTGCAGGTCTCATTGGAGGTGG + Intronic
1115344975 14:32333120-32333142 AGCTTGGGCCTCTTTGGAGCAGG - Intronic
1115640402 14:35332174-35332196 GGCTCTGGCCTTACTGCAGGGGG + Intergenic
1117334306 14:54743791-54743813 GTCTTGGGCCTCGTTGGAGCTGG - Intronic
1122233376 14:100318433-100318455 GGCTCGGGCGCCGGTGGAGGAGG + Intergenic
1124068806 15:26371787-26371809 AGGACGGGCCTCATTGGAAGGGG - Intergenic
1124453622 15:29821792-29821814 GGCGCGGGCCGCACTGGGGGCGG - Intronic
1128814588 15:70598514-70598536 GCCTCAGGCCCCATGGGAGGAGG - Intergenic
1129192287 15:73944514-73944536 GGCTGAGGCCTCAGAGGAGGTGG + Intronic
1129389562 15:75213834-75213856 TGCTCGGGTCTCCTTGGGGGTGG - Intergenic
1132308341 15:100835194-100835216 CGCTCGGGCCTCCTTGAGGGTGG - Intergenic
1132715511 16:1288249-1288271 GGCTGGGGTGTCATTGGACGTGG - Intergenic
1132816753 16:1832672-1832694 GACACGGGGCTCAGTGGAGGGGG + Intronic
1135643607 16:24142518-24142540 GGCCTGGCCCTCACTGGAGGAGG - Intronic
1145250209 17:21293320-21293342 GGCACGGGCCTCGCTGGAGAGGG - Intronic
1145971779 17:28960475-28960497 TGCTGGGGCCTCACTGGGGGTGG - Intronic
1147339613 17:39745770-39745792 GGCACGAGCCTCAGTGCAGGTGG + Exonic
1154517927 18:15195228-15195250 GGCTCGGGCCTTGGTGGGGGTGG + Intergenic
1156450688 18:37264685-37264707 TGCTGGGGGATCATTGGAGGCGG + Exonic
1157397703 18:47356363-47356385 GCCACCGGCCTCTTTGGAGGAGG + Intergenic
1158436901 18:57440449-57440471 GGATCCGGGCTCACTGGAGGCGG - Intronic
1160534182 18:79583623-79583645 GGCTCGGGGCTCAGGGGTGGCGG - Intergenic
1160667802 19:341249-341271 GACTGGGGCCTCATTTGATGTGG - Intronic
1161560161 19:4968839-4968861 GGCTCTGTTCTCATTGGAGGGGG - Intergenic
1164812032 19:31164966-31164988 GCCTCGGGCCTCAGTGGTGGTGG + Intergenic
1166069344 19:40378161-40378183 GGATCGGGCCTCAGAGCAGGCGG - Exonic
1167757405 19:51421422-51421444 GGCTCTGGCCTCGCTGGAGAAGG - Intergenic
1168468248 19:56621156-56621178 GCCTTGGGCCTCATTGGGGTCGG + Intronic
927197647 2:20559292-20559314 AGATCGGGCCTCATGGGAGCTGG - Intergenic
927198344 2:20563415-20563437 GGCTGGGCCCTCATTGCTGGGGG - Intronic
931657771 2:64525037-64525059 GCCTCGGGCCTCGGTGAAGGAGG - Intronic
932166249 2:69510205-69510227 CGCTGGGGCCTCCTTGAAGGTGG - Intronic
932468732 2:71940181-71940203 GGCTGGGGCGTCAAGGGAGGGGG - Intergenic
934555663 2:95285813-95285835 GCCTCAGGCCTCACTGGTGGGGG - Intronic
936521170 2:113212917-113212939 GGCTCAGGCCTCCTGGAAGGTGG - Intergenic
937134041 2:119537013-119537035 GGCTCTGCCCTCCTTGGAGTTGG + Intergenic
942246376 2:174012727-174012749 GGCCCGGGGCTCCCTGGAGGCGG + Intergenic
942302011 2:174571852-174571874 GGCCCGGGCCTGCTGGGAGGTGG + Exonic
943820440 2:192314841-192314863 GGCTGGGGCCTCAGCCGAGGTGG - Intergenic
944836229 2:203582665-203582687 GGCTTGGTCCTCATTGGCTGAGG + Intergenic
947654009 2:231810787-231810809 GACTCGGCCCCCTTTGGAGGTGG + Intergenic
948561849 2:238859380-238859402 TTCTCGGGCTTCATGGGAGGGGG + Intronic
948838344 2:240636957-240636979 GGCTCGGGCCCCTGAGGAGGGGG - Intergenic
1171148235 20:22804247-22804269 TGCCCGGGCCTCATGGGGGGAGG - Intergenic
1171984047 20:31647007-31647029 GGCTCAGACCTCACTGGAGAAGG + Intergenic
1172073677 20:32277752-32277774 GGCTCGGGCCTCAGGTGAGTCGG + Exonic
1174110437 20:48194557-48194579 GGGTCGGCTCTGATTGGAGGGGG - Intergenic
1174487924 20:50872820-50872842 GGCTTGGGCCTGAGTGGATGTGG + Intronic
1174768242 20:53273705-53273727 GGTTGGAGCCTCAGTGGAGGCGG + Intronic
1180842910 22:18967592-18967614 GCCCCTGGCCTCACTGGAGGGGG + Intergenic
1180914998 22:19479802-19479824 TGATTGGGCCACATTGGAGGCGG - Intronic
1181514983 22:23405188-23405210 GCCTCTGGCCTCATTGGAGGGGG - Intergenic
1183193207 22:36335184-36335206 GGCTGGGGCCTGCCTGGAGGAGG - Intronic
1184109768 22:42387844-42387866 GACTCGGGCTTCCTGGGAGGAGG - Intronic
1184787417 22:46678521-46678543 GGCTTGGGCCTCCTGGAAGGAGG + Exonic
1185003923 22:48264067-48264089 GGCACAGGCATCCTTGGAGGAGG - Intergenic
952177550 3:30881843-30881865 GGCTCCAGCCTCATGGGTGGGGG + Intronic
961818083 3:129561517-129561539 GGCTGAGGCCTCCTTGGTGGGGG - Intronic
967100343 3:186210693-186210715 GGCCTGGGCCTCCCTGGAGGAGG - Intronic
968434668 4:578328-578350 CGCTCCGCCCTCACTGGAGGGGG - Intergenic
968494471 4:907702-907724 GGTTCAGGGCTCACTGGAGGAGG - Intronic
968521726 4:1037318-1037340 GGCTGAGGCCCCACTGGAGGGGG - Intergenic
968812072 4:2804637-2804659 GGCCCTGGCCTCTGTGGAGGGGG - Intronic
969569676 4:8001211-8001233 GGCCCAGGCAGCATTGGAGGAGG + Intronic
978739821 4:112123884-112123906 GGTTCAGACCTCATTGGAGAAGG + Intergenic
980151612 4:129055241-129055263 GGTTAGGGACTCACTGGAGGAGG + Intronic
982288253 4:153756900-153756922 GGCAAGGGCCTCAGAGGAGGGGG - Intronic
985514986 5:337765-337787 GGCTCGGGCCTCATTGGAGGAGG + Intronic
986962682 5:13234748-13234770 GGCTCAGGCCTTGTTGGAGAGGG + Intergenic
987658572 5:20841475-20841497 CGCTCGGGCCTAGTTGCAGGAGG + Intergenic
988765111 5:34364458-34364480 CGCTCGGGCCTAGTTGCAGGAGG - Intergenic
990284362 5:54285737-54285759 AGCTAGGGCCTCATTCGAAGGGG - Intronic
990330485 5:54720522-54720544 AGCTCTGGCCTCAGAGGAGGTGG - Intergenic
991044788 5:62211311-62211333 GGTTCAGACCTCATTGGAGAAGG + Intergenic
995628978 5:114112313-114112335 GACTGGGGCCTGTTTGGAGGTGG + Intergenic
996395236 5:123006799-123006821 GGATTGGGCCTCATCAGAGGAGG - Intronic
999040538 5:148405396-148405418 GCCTTGGGCCACATTGGAAGAGG - Intronic
999234197 5:150080730-150080752 GGGTCAGGCCTCTTGGGAGGAGG + Intronic
1001473016 5:172028905-172028927 GTCTATGGCCTCATTGAAGGAGG - Intergenic
1002897981 6:1390129-1390151 GGCGCTGGCCGAATTGGAGGAGG - Exonic
1003114492 6:3274342-3274364 TTCTGGGGCCTCATTGAAGGAGG + Intronic
1003245443 6:4378477-4378499 GGCTCTGGCCGCACTGGGGGCGG + Intergenic
1004375491 6:15087388-15087410 GACTGAGGCCTAATTGGAGGGGG - Intergenic
1005819312 6:29584359-29584381 TGCCCGGGACTCACTGGAGGTGG + Intronic
1013024000 6:106251315-106251337 GGCTCAGACTTCACTGGAGGAGG - Intronic
1015724280 6:136284815-136284837 GGCAAGTGCCACATTGGAGGGGG + Intronic
1018705490 6:166460905-166460927 CCGTCGGGCCTCATCGGAGGAGG - Intronic
1018860607 6:167708481-167708503 GGCTGGGGTCTCAGTGGAGCGGG - Intergenic
1019420379 7:948027-948049 TGCTGGGTCCTCAGTGGAGGAGG - Intronic
1019626523 7:2018712-2018734 GGCTGCTGCTTCATTGGAGGGGG - Intronic
1020034726 7:4958130-4958152 CGCGGGGGCCTCTTTGGAGGGGG - Intronic
1024258618 7:47558039-47558061 TGCTCAGGCCTCCTTGGTGGGGG - Intronic
1033614909 7:143004727-143004749 TGCTGGGGTCTCATTTGAGGAGG - Intergenic
1034905899 7:154945624-154945646 AGCTCCAGCCTCATTGCAGGAGG + Intronic
1036561393 8:9903035-9903057 GGCTCAGGACTCATTGTATGTGG - Intergenic
1036948900 8:13122103-13122125 GGCTCGGGGATCCTTGAAGGAGG - Intronic
1037917036 8:22778988-22779010 GGCACGGGCTGCATGGGAGGCGG + Intronic
1041453824 8:58035991-58036013 AGCCCGGGCCTCTATGGAGGAGG + Intronic
1047739358 8:127794467-127794489 CGCTCGGGCCTCGGGGGAGGGGG - Intergenic
1048878241 8:138853243-138853265 GGCGAGGGCCCCATTGGAGCAGG + Intronic
1049542412 8:143214592-143214614 GGCTTGGGGCTCCTGGGAGGGGG - Intergenic
1049998490 9:1052162-1052184 GTCTCAGGCCACAGTGGAGGTGG + Intronic
1056135205 9:83623665-83623687 GTCCAGGGCCTCATAGGAGGAGG - Intronic
1056259418 9:84833079-84833101 TTCTTGGGCCTCATTGGTGGTGG + Intronic
1062106105 9:134755905-134755927 GGCAAGGGCCTCATATGAGGAGG + Intronic
1062461900 9:136665771-136665793 GGCTCGGGCGGCAGTGGCGGCGG + Intronic
1062630429 9:137460837-137460859 GCCCCGGGCCACCTTGGAGGCGG - Intronic
1187273646 X:17800823-17800845 GGCTGGGGCCTCATGGGACGTGG + Exonic
1191700241 X:64034072-64034094 GGCTTGGGCCTCAGTGGGAGGGG - Intergenic
1195493950 X:105507995-105508017 GGCTGGGGCCTAATAGGATGGGG - Intronic
1200235719 X:154466883-154466905 GCCTAGGCCCTCATTGGTGGAGG + Intronic