ID: 985514987

View in Genome Browser
Species Human (GRCh38)
Location 5:337771-337793
Sequence GGCCTCATTGGAGGAGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985514971_985514987 26 Left 985514971 5:337722-337744 CCTAAGGAGTGCGCTTGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514969_985514987 27 Left 985514969 5:337721-337743 CCCTAAGGAGTGCGCTTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514978_985514987 -1 Left 985514978 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514983_985514987 -7 Left 985514983 5:337755-337777 CCAAAGCTGGGGCTCGGGCCTCA 0: 1
1: 0
2: 0
3: 37
4: 225
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514968_985514987 28 Left 985514968 5:337720-337742 CCCCTAAGGAGTGCGCTTGGAAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514980_985514987 -2 Left 985514980 5:337750-337772 CCTTCCCAAAGCTGGGGCTCGGG 0: 1
1: 0
2: 1
3: 22
4: 172
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227
985514982_985514987 -6 Left 985514982 5:337754-337776 CCCAAAGCTGGGGCTCGGGCCTC 0: 1
1: 0
2: 0
3: 11
4: 184
Right 985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG 0: 1
1: 0
2: 2
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985514987 Original CRISPR GGCCTCATTGGAGGAGGTGT AGG Intronic
900083941 1:877816-877838 GGCCTCATGGGAAGTGGTGCAGG + Intergenic
900100472 1:960160-960182 GGGCTCCTTGGAGGAGGAGGAGG + Intergenic
900353648 1:2249249-2249271 TGCCTCATTCGTGGAGGTGCTGG + Intronic
900951302 1:5859539-5859561 GGCCACAGTGGAGGAGATGAAGG + Intergenic
903327287 1:22576726-22576748 GTCCTCACTGGTGGAGGTGAGGG + Exonic
903648777 1:24910714-24910736 GGCCTCATTGGAGGAGAAGGTGG - Intronic
905582008 1:39089419-39089441 GGCCACAATGGAGCAGATGTTGG - Intronic
906328812 1:44867393-44867415 GACCACCTTGGAGAAGGTGTAGG - Intronic
906851163 1:49251559-49251581 GGTTGCATTGGAGGTGGTGTTGG - Intronic
907453183 1:54560267-54560289 GGGCTCCCTGGAGGAGGTGATGG + Intronic
907799543 1:57751150-57751172 GGCCTAGTGGGAGGAGGTGAAGG + Intronic
908357304 1:63335480-63335502 GCCCTCAGTGGAGGGGGTGGGGG - Intergenic
911091465 1:94020712-94020734 GGCCTACATGGAGGAGGGGTTGG - Intronic
912963520 1:114216844-114216866 GACCTGGTGGGAGGAGGTGTAGG - Intergenic
914921691 1:151851880-151851902 GGCCTCAGTGGAAGGGGTGTGGG + Intronic
915167666 1:153957712-153957734 GGCCTCCTTGGAGGAGAGGTAGG - Intronic
915564030 1:156704071-156704093 GTCCTCAGTGGATGAGGTGGTGG - Intronic
916712567 1:167424890-167424912 GGCCTCAGAGGAGAAGGGGTTGG - Exonic
922671469 1:227511174-227511196 GGCCTCATGGGAAGTGGTGCAGG + Intergenic
922980609 1:229823319-229823341 GACCTCCTGGGAGGAGGTGATGG + Intergenic
924191882 1:241562198-241562220 GACCTCATTGTAGGATGTGATGG + Exonic
924243897 1:242063129-242063151 GGCCTCATGGGAAGTGGTGCAGG + Intergenic
1062763295 10:44126-44148 GGCCTCATGGGAAGTGGTGCAGG - Intergenic
1062954095 10:1529050-1529072 GGACTGATTGGAGGATTTGTTGG - Intronic
1063362335 10:5468806-5468828 GGCCTCAGGGGATGAGGTCTTGG - Intergenic
1065813635 10:29464847-29464869 GGCTTCATTGGAGGGTGGGTGGG + Intronic
1065958015 10:30710129-30710151 GGCTTCATTGGAGGGTGGGTGGG - Intergenic
1068525753 10:58127576-58127598 GTTCTCATAAGAGGAGGTGTTGG + Intergenic
1070374465 10:75816075-75816097 GACATCATTGGAGGAGGTACCGG + Intronic
1070919613 10:80176211-80176233 AGCCTCATTGGTGGAGGTTTAGG - Intronic
1072440387 10:95448951-95448973 GGGCTCATGGGAGGATGTGAGGG - Intronic
1072511002 10:96124682-96124704 TGCCACCTTGGAGGAGGGGTTGG + Intergenic
1073069926 10:100786963-100786985 GCCCACATTAGAGGAGGTGGAGG + Intronic
1075161445 10:120028047-120028069 GGGCCCATTGGAGGAGGCCTTGG + Intergenic
1077225542 11:1437696-1437718 GGCCTCACAGGAGGAGGGGCCGG - Intronic
1077490190 11:2857519-2857541 GCCCTCAGCGGAGGAGGTGAGGG - Intergenic
1077551075 11:3200587-3200609 GGCCTTCCTGGAGGAGGTGGTGG - Intergenic
1078924109 11:15858724-15858746 GGCCTGATTGAAGGAGGGCTTGG - Intergenic
1078929585 11:15902693-15902715 GGCCTTATGGAAGGAGGTGAAGG - Intergenic
1079592626 11:22198317-22198339 GGCCTGAAAGGAGGAGGTCTAGG + Intronic
1079673816 11:23200950-23200972 TGCTTCATTGGAGGAGGGGAAGG - Intergenic
1081667042 11:44922721-44922743 GTCCTCATTGGAGGAGGGGCAGG + Intronic
1081776668 11:45680464-45680486 GGCCTCCATGGAGGAGGGATTGG - Intergenic
1084036043 11:66511000-66511022 GGCCTCATTGCTGGAAGTGGGGG - Exonic
1084621397 11:70272212-70272234 GGCCCCCCTGGAGGAGGTGGAGG + Exonic
1085013767 11:73159323-73159345 GGCCTCAGTGGGGATGGTGTGGG - Intergenic
1085523029 11:77149299-77149321 GGCATTACTGGGGGAGGTGTGGG + Intronic
1086055217 11:82638737-82638759 GACATCTTTGGAGGAGGTGGAGG + Intergenic
1086116344 11:83255046-83255068 GGACTCATTAGAAAAGGTGTGGG + Intronic
1087378005 11:97368160-97368182 GGGCACACTGGAGGTGGTGTTGG - Intergenic
1089616365 11:119696989-119697011 GGCCTCATAGGAGGCGGGGAGGG - Intronic
1091113675 11:132994418-132994440 GGCCTCACCGGAGGAGCTGCTGG + Intronic
1091221741 11:133933767-133933789 GCCCGCATTGCAAGAGGTGTGGG - Intronic
1091696829 12:2633362-2633384 GGCCTCTGTGGAGAAGGGGTAGG + Intronic
1093958548 12:25250019-25250041 GGCCACAAAGGAGGAGGTGGAGG - Intronic
1094813175 12:34161885-34161907 GGCCTCATGGGAAGTGGTGCAGG - Intergenic
1095418569 12:42001348-42001370 GGACTCATCCCAGGAGGTGTGGG + Intergenic
1095846165 12:46747240-46747262 GGCCTCATAGAATGAGTTGTGGG - Intergenic
1096195511 12:49646784-49646806 GGCCTCATGGGGGGTGGGGTGGG + Intronic
1096593723 12:52680218-52680240 CGCCGCAGTGGAGGAGGTGGTGG - Exonic
1096625167 12:52890676-52890698 GGCCTCAGAGGAGGAAGAGTAGG + Intergenic
1096767698 12:53906944-53906966 GGAGTCAATGGAGGAGGTCTGGG + Intergenic
1099286416 12:80717945-80717967 GGCCTCATTGGAGCAGGAACTGG - Intronic
1100808031 12:98308293-98308315 GGCCTCAGTGGAGTGGTTGTAGG - Intergenic
1102257651 12:111425409-111425431 GGCCTCTTGGCAGGAGGTGCCGG + Intronic
1105211713 13:18261025-18261047 GGACTTCTTGGAGGAGGTGGCGG - Intergenic
1107028011 13:35823272-35823294 TTCCTCACTGGAGGAGGTGAAGG - Intronic
1107106237 13:36645725-36645747 GGACTCATCTGAGGAGGTTTAGG - Intergenic
1107946015 13:45418314-45418336 GTCCGGGTTGGAGGAGGTGTGGG - Exonic
1108119792 13:47172344-47172366 GGCCACACTGCAGGAGGTGAGGG - Intergenic
1112319420 13:98393757-98393779 GGGCTCCGTGGAGGAAGTGTGGG - Intronic
1113522633 13:110951487-110951509 GGCCCCATGGGAGGGGGTGGGGG + Intergenic
1113658715 13:112088644-112088666 GGCCTCATTGCTGGGGCTGTAGG - Intergenic
1114192153 14:20447906-20447928 GCCCTCATTGTGGGAGGAGTGGG - Exonic
1114482570 14:23044716-23044738 AGCCTCAGGGGAGGAGATGTGGG + Intergenic
1114549017 14:23522703-23522725 GGCATCATTGGAGGAGCTGGTGG + Exonic
1114994403 14:28330286-28330308 GGCTTCAATGGAGGTGATGTTGG - Intergenic
1118874123 14:69767995-69768017 GGCCTCATTAGAGGCTCTGTTGG + Intronic
1119778787 14:77264768-77264790 GGCATGATTGGAGCAGGTTTGGG - Intergenic
1119866719 14:77980715-77980737 GGCCTCTTTGCAGGAGGTAGAGG + Intergenic
1121934051 14:98000471-98000493 GACCTCATGGGAAGAGGGGTGGG - Intergenic
1122054015 14:99080093-99080115 GGACTGATTGAAGAAGGTGTGGG - Intergenic
1123131894 14:105994062-105994084 GGTCACACTGGAGGAGGTGTTGG + Intergenic
1125745856 15:41996765-41996787 GGCCTTTTGGGTGGAGGTGTGGG + Intronic
1126198265 15:45955660-45955682 GCCCTCACTGGACCAGGTGTTGG + Intergenic
1130649061 15:85751793-85751815 GGCCTCAGTGGGAGAGTTGTGGG + Intergenic
1133310777 16:4845497-4845519 GGTCACATTGGAGCAGGGGTGGG - Intronic
1134661107 16:15985277-15985299 GGCTTCACTGGAGGTGCTGTTGG + Intronic
1136429068 16:30186518-30186540 GGCCTCTCTGAAGGAGGTGTGGG + Intronic
1136590364 16:31214712-31214734 GGCCTGGGTGGAGGAGGAGTAGG - Exonic
1137553043 16:49453490-49453512 GGCCTGCTTGGAGGAGGAGGAGG - Intergenic
1137753981 16:50887053-50887075 GGCCTCCCTGGGGGAGGTGGTGG + Intergenic
1138222239 16:55261704-55261726 TGCTTCAATGGAGGAGGAGTGGG - Intergenic
1138283626 16:55791402-55791424 GGGCTCATTGGAGGAGGGGTTGG + Intergenic
1138285376 16:55805585-55805607 GGGCTCATTGGAGGAGGGGTTGG - Intronic
1140712254 16:77689395-77689417 AGCCTCATGGGAGGTGGGGTGGG - Intergenic
1142611250 17:1110039-1110061 GGGCTGCTTGGAGGAGGTGGGGG - Intronic
1143015095 17:3887463-3887485 GGCCTCCCTGGAGGAGGTGAAGG + Intronic
1143903916 17:10195206-10195228 GGCCAGCTTGGAGGAGGTCTTGG - Intronic
1144758252 17:17693270-17693292 GGCCTGATCAGAGGAGGTGGAGG - Intronic
1144876812 17:18401342-18401364 GGCAACCTTGGAGGAGGTGCAGG - Intergenic
1144968538 17:19092928-19092950 GCCCTCATTTGAGAGGGTGTGGG + Intergenic
1144979379 17:19159135-19159157 GCCCTCATTTGAGAGGGTGTGGG - Exonic
1144988843 17:19219097-19219119 GCCCTCATTTGAGAGGGTGTGGG + Intronic
1145155418 17:20543076-20543098 GGCAACCTTGGAGGAGGTGCAGG + Intergenic
1146017989 17:29249090-29249112 GGCCTCTTGGGAGGAGGGGGAGG - Intronic
1146247765 17:31305250-31305272 GGCTTGCTGGGAGGAGGTGTTGG + Exonic
1146263673 17:31437539-31437561 GGCATGATTTGAGGAGGTGTGGG + Intronic
1146731104 17:35194376-35194398 GACCTCATTGGAGTGGGGGTGGG + Exonic
1151673805 17:75588111-75588133 GGCCTCAGGGGAGCAGGAGTCGG + Intergenic
1152244338 17:79177323-79177345 GCCGTCCTTGGAGGAGGTGGAGG - Intronic
1152956205 18:44457-44479 GGCCTCATGGGAAGTGGTGCAGG - Intergenic
1154115398 18:11609505-11609527 GACCTCATTGGAGTTGGGGTGGG - Intergenic
1154131804 18:11743199-11743221 GGCCACATGAGATGAGGTGTTGG + Intronic
1154936355 18:21061694-21061716 GCCCTCATTGAAGGTGGTGAGGG + Intronic
1155231461 18:23778986-23779008 GGCCTCACTGAAGCAGGTATAGG + Intronic
1156489339 18:37487052-37487074 GGCCTCATGAGAGGAGGGCTTGG - Intronic
1158964283 18:62609813-62609835 GGCTTCATTGTAGAAGTTGTGGG + Intergenic
1159962656 18:74567563-74567585 GGCCTCAGGGGAGGTGGGGTGGG + Intronic
1160841825 19:1149800-1149822 GGCCCCATTCTAGGAGGTGGAGG + Intronic
1160919174 19:1511899-1511921 GGCCTCATCGGCGGAGGGGGTGG + Intronic
1161032073 19:2062156-2062178 GGCCACAGAGGAAGAGGTGTTGG - Intergenic
1161297546 19:3527385-3527407 GGGCTGCCTGGAGGAGGTGTGGG + Intronic
1161499181 19:4603943-4603965 AGCCCCATTGGAGCAGGTTTAGG + Intergenic
1161755603 19:6131293-6131315 GTCCTCAGGGGAGGGGGTGTGGG + Intronic
1162015950 19:7846565-7846587 GGCCTCCTGGGATGAGGAGTCGG - Exonic
1162432283 19:10636324-10636346 GGACTCATTGGAGGAGGGGAAGG - Exonic
1162466996 19:10848431-10848453 GGCCTCACAGGAGGAGTTGGCGG + Exonic
1162740349 19:12770391-12770413 GGAGTCATTGGGGGAGGTATGGG + Intronic
1163809412 19:19421273-19421295 GGCCTCCTTGGAGGAAGAGAAGG + Intronic
1165073565 19:33268965-33268987 GGCTCCATCGGAGGAGCTGTGGG - Intergenic
1165363887 19:35352267-35352289 GGCCACGTTGGAGGCGTTGTAGG - Exonic
1166092867 19:40521641-40521663 GGCCGCATAGCAGGAGGTGGAGG - Intronic
1166232480 19:41433264-41433286 GGTCTCACTGGAGGTGGTGGAGG + Exonic
926141238 2:10369682-10369704 GGCCTTCTTGGAGGAGGTGGTGG + Intronic
930040403 2:47118132-47118154 GGCTTCATAGGAGGAGGTGAGGG + Intronic
931060253 2:58520826-58520848 GACTTCAGTGGAGGAGGGGTGGG + Intergenic
932180526 2:69642884-69642906 GGTCACAGTGGACGAGGTGTTGG - Exonic
934301912 2:91781430-91781452 GGACTTCTTGGAGGAGGTGGTGG + Intergenic
936522518 2:113220120-113220142 GGCCTCGCTGTAGGAGGAGTAGG + Exonic
944987142 2:205190363-205190385 AGCCTCCAGGGAGGAGGTGTAGG - Intronic
946249585 2:218404466-218404488 GTCTTCCTGGGAGGAGGTGTGGG - Exonic
947799848 2:232921955-232921977 GGCCCCACTGGAGGAGATGAGGG + Intronic
948561850 2:238859386-238859408 GGCTTCATGGGAGGGGGTGTCGG + Intronic
948687385 2:239677646-239677668 GGCCCCCCTGGAGGAGGTGTGGG - Intergenic
1170779307 20:19409549-19409571 TGTCTCATTGGAGAAGGAGTAGG + Intronic
1172492866 20:35355015-35355037 GTCCTTATTGGAGTGGGTGTGGG - Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175591104 20:60192928-60192950 GGCCACAATGGAGGAGCTCTGGG + Intergenic
1176127552 20:63482715-63482737 GGGGTCTTTGGAGGAGCTGTGGG - Intergenic
1176656364 21:9591813-9591835 AGCCTCTCTGAAGGAGGTGTTGG + Intergenic
1177137138 21:17317459-17317481 GGCCTCATAGGATGAGTTGGGGG - Intergenic
1177485645 21:21751789-21751811 GGTCTTATTGAAGGAAGTGTCGG + Intergenic
1179419270 21:41222760-41222782 AGACTCCTTGGAGGAGGTGAGGG + Intronic
1179441573 21:41398488-41398510 GGCCTCATTTGTGAAGGTTTAGG - Intronic
1180046131 21:45306613-45306635 GGGCTCCATGGAGGAGGTATTGG - Intergenic
1180814518 22:18781289-18781311 GGACTTCTTGGAGGAGGTGGCGG - Intergenic
1180831070 22:18906389-18906411 GGGCGCCTTGGAGGAGGTGGCGG + Exonic
1180834919 22:18925100-18925122 GGCCTCATTGGCGTAGAAGTAGG + Exonic
1181068772 22:20319952-20319974 GGCCGCCTTGGAGGAGGTGGCGG - Exonic
1181200706 22:21215625-21215647 GGACTTCTTGGAGGAGGTGGCGG - Intronic
1181474304 22:23159037-23159059 GCCCTCATTGGAGGAGCCATGGG + Intronic
1181701035 22:24621348-24621370 GGACTTCTTGGAGGAGGTGGCGG + Intronic
1184652183 22:45924500-45924522 GGGCTTCCTGGAGGAGGTGTGGG + Intronic
1185089960 22:48760804-48760826 GGCCTAATTGGAGGAGTGTTTGG + Intronic
1203226211 22_KI270731v1_random:79810-79832 GGACTTCTTGGAGGAGGTGGCGG + Intergenic
1203264617 22_KI270734v1_random:6976-6998 GGACTTCTTGGAGGAGGTGGCGG - Intergenic
1203281157 22_KI270734v1_random:131660-131682 GGGCGCCTTGGAGGAGGTGGCGG + Intergenic
1203285008 22_KI270734v1_random:150399-150421 GGCCTCATTGGCGTAGAAGTAGG + Intergenic
950677637 3:14564296-14564318 GGCCGCGTGGGTGGAGGTGTCGG + Intergenic
951882299 3:27491302-27491324 GGTATCATTGGAGAAGGTGAGGG + Intergenic
953387079 3:42512833-42512855 GGCCTCCATGGAGGAAGCGTTGG - Intronic
954107980 3:48419532-48419554 GGCCTCAGGGGAGGGGATGTGGG - Intronic
955403861 3:58613020-58613042 AGCCCCATTGGAGGAGGTAACGG - Intronic
957040017 3:75329419-75329441 GGCCTCTGTGGTGGAGGAGTTGG - Intergenic
958258251 3:91349560-91349582 GGGCTCAGTGGAGAAGATGTGGG - Intergenic
959297587 3:104556911-104556933 GGGCTCACTGGAGGAGCTGAGGG - Intergenic
961118154 3:124349505-124349527 GGCCACATTGGAAGAAGTCTTGG - Intronic
961484734 3:127208794-127208816 GGCCTCACAGGAGGGGCTGTGGG - Intergenic
961941039 3:130637109-130637131 GTTCTCATTGGAGGAGGGGGAGG - Intronic
962690774 3:137896273-137896295 GGCCTCATAGAATGAGGTTTTGG - Intergenic
962879278 3:139560970-139560992 GAGCTTGTTGGAGGAGGTGTGGG + Exonic
964374452 3:156035712-156035734 GGCATCAGTGGAGGAGGAGGGGG - Intergenic
967095834 3:186176536-186176558 GGCCAGAATGGGGGAGGTGTGGG + Intronic
968358127 3:198123784-198123806 GGCCTCATGGGAAGTGGTGCAGG + Intergenic
968897864 4:3415223-3415245 GGCCTCATTGGAGGCTGGCTCGG + Intronic
969837499 4:9854592-9854614 GGCCTCATAGGATGAGTTGAAGG - Intronic
975324180 4:73041441-73041463 GGCCACATTGGTGGAAGTGGTGG + Intergenic
978141849 4:105326819-105326841 GGCCCCATTGTAGAAGGTCTTGG + Intergenic
978346347 4:107774089-107774111 GGCCTAATTTGAGGAAGAGTTGG - Intergenic
980064187 4:128165648-128165670 GGCCTGTTTGGAGCAGGTATAGG - Intronic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
983129313 4:163995445-163995467 CTCCTCCTTGGAGGAGGGGTTGG + Intronic
985440314 4:189979272-189979294 GGCCTCATGGGAAGTGGTGCAGG - Intergenic
985514987 5:337771-337793 GGCCTCATTGGAGGAGGTGTAGG + Intronic
985548203 5:520477-520499 GGCCTCCTTGAAGCAGGAGTGGG - Intronic
986311973 5:6557609-6557631 GGTCTCTTAGGAGGAGGTTTTGG - Intergenic
986382846 5:7204041-7204063 GGCCTCATTGCAGGGAGAGTTGG + Intergenic
989140808 5:38199506-38199528 TGCCTCTTGGTAGGAGGTGTCGG - Intergenic
992531997 5:77660839-77660861 GGCCTCATGGCAGAAGGTGAAGG - Intergenic
994707393 5:103223217-103223239 GGCCTGCGTGGAGGAGGTGGAGG + Intergenic
996638038 5:125718461-125718483 TTCCTAATTGGAGGACGTGTTGG - Intergenic
997370676 5:133357752-133357774 GGCCTCATTTTAGGGGGTGTGGG - Intronic
1000333106 5:160221341-160221363 AGCCTGATTGGAGGAGGCGGGGG + Intronic
1001708629 5:173760321-173760343 GGCCCCACGGGAGGAGGAGTTGG - Intergenic
1002373472 5:178772608-178772630 GGACTCCTTTGAGGAGGTGGAGG - Intergenic
1005066473 6:21822894-21822916 GACCACAGTGGAGGAGGTGGTGG + Intergenic
1005592903 6:27347731-27347753 GTCCCCATTGCAGGAGGAGTAGG + Intergenic
1005665331 6:28047003-28047025 AGCCTCGTTGATGGAGGTGTTGG - Intergenic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006202716 6:32310913-32310935 TGCCTAAATGGAGGAGGTGAAGG - Intronic
1006321330 6:33321310-33321332 GGGCTCATTGGAGGTGGTGGCGG + Exonic
1006545001 6:34773439-34773461 GGCCTCATTCCAGGAGCTGCAGG - Exonic
1006801277 6:36761155-36761177 GGCCTCCTTTGAGGAGATTTAGG - Intronic
1009582060 6:65549109-65549131 GGCCTCACGGCAGGAGGTGAGGG - Intronic
1016136276 6:140547826-140547848 GGCCTCATAGGATGAGGAGGTGG + Intergenic
1016819724 6:148335921-148335943 AGCCTCATTGGATGAGTGGTAGG + Intronic
1021915873 7:25431863-25431885 GGCCTGATGGGAGGTGGTGAGGG + Intergenic
1022418886 7:30201879-30201901 GGTCTCATTGGAAGGGATGTGGG + Intergenic
1026978787 7:74514665-74514687 GGCCTCCTTGGAGCAGGGGTTGG + Intronic
1026993073 7:74598718-74598740 GGCCACATTGGAGGGAGTGGTGG - Intronic
1027491048 7:78826745-78826767 AGCCTCACTGACGGAGGTGTGGG + Intronic
1028724535 7:94072244-94072266 GGACCCATTTGAGGAGGTATCGG - Intergenic
1030027934 7:105342984-105343006 GGCCTCTTGGGAGTAGGTTTGGG - Intronic
1032696937 7:134345203-134345225 GGGGTCATTGCATGAGGTGTGGG + Intergenic
1037451155 8:19016285-19016307 GGGCTCATGGGAAGAGGTGGGGG - Intronic
1037665282 8:20963742-20963764 GGTCTCATTGGAGCAGGGCTAGG + Intergenic
1037969173 8:23160053-23160075 GGCCTCTCTGGAGGAGGGGGAGG + Intronic
1038499404 8:28031042-28031064 GACTGCCTTGGAGGAGGTGTGGG - Intronic
1038860820 8:31387578-31387600 GACCTCATTGGAGAGGGTGTGGG + Intergenic
1041053621 8:53960742-53960764 GGCCTCCTTGGAGAAGTTGAGGG - Intergenic
1042901996 8:73738127-73738149 GTCATCATTGGAGGCTGTGTAGG - Intronic
1046747818 8:117894864-117894886 CACCTCATTTGAGGAGGTGAGGG + Intronic
1048878242 8:138853249-138853271 GGCCCCATTGGAGCAGGTTCAGG + Intronic
1049210008 8:141381614-141381636 GGCCTTATTGATGGAGGTGTGGG + Intergenic
1049624250 8:143613009-143613031 GGCCGCATGGGAGGAAGTGGGGG + Intronic
1049831536 8:144704386-144704408 GGCCTCTTTCGAGGGGGTGCAGG + Intergenic
1050203471 9:3173825-3173847 GGCTGCACTGGAGGGGGTGTGGG + Intergenic
1055756824 9:79567208-79567230 AGCCTCATTTGAGGAAGTGTTGG - Intergenic
1056259420 9:84833085-84833107 GGCCTCATTGGTGGTGGTGGTGG + Intronic
1057340912 9:94200506-94200528 GGCCTCACAGGAGCAGCTGTTGG - Intergenic
1059621063 9:116006191-116006213 GGCCTCATTGCAGAAGGGGCAGG + Intergenic
1059811903 9:117864600-117864622 GGCCACATTGGAGACGGTGACGG + Intergenic
1061762941 9:132863100-132863122 GGGAGCATTGCAGGAGGTGTGGG - Intronic
1062004393 9:134231976-134231998 GGCCTCAGTGGAGGTGGTGGAGG + Intergenic
1062255718 9:135619826-135619848 GGCCTCACTGGAGGCGTTTTCGG - Intergenic
1062270476 9:135705931-135705953 GGCCTCACTGGAGCAGAGGTGGG + Intronic
1062356493 9:136166780-136166802 GGCCACATTGGAGAAGTTTTTGG + Intergenic
1062723580 9:138058420-138058442 GGCCTGCTTGGAGAAGGTCTGGG + Intronic
1062741997 9:138180319-138180341 GGCCTCATGGGAAGTGGTGCAGG + Intergenic
1203634081 Un_KI270750v1:95295-95317 AGCCTCTCTGAAGGAGGTGTTGG + Intergenic
1194852850 X:98890670-98890692 GGAATCATTGGAGGAAGTGGGGG + Intergenic
1198185585 X:134251242-134251264 GACCTGATTGGAGGGGGGGTGGG - Intergenic
1198582561 X:138082106-138082128 AGACTCTTTGCAGGAGGTGTAGG + Intergenic
1200129369 X:153832554-153832576 GGCCTCATGGGAGGTGGTGATGG - Intergenic
1200235724 X:154466889-154466911 GCCCTCATTGGTGGAGGGGGTGG + Intronic