ID: 985515209

View in Genome Browser
Species Human (GRCh38)
Location 5:340143-340165
Sequence CCAGGTCTAAATGGTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 5, 2: 45, 3: 197, 4: 709}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985515209_985515214 -5 Left 985515209 5:340143-340165 CCAGTGAAACCATTTAGACCTGG 0: 1
1: 5
2: 45
3: 197
4: 709
Right 985515214 5:340161-340183 CCTGGGTTTTTTGATGTTGTTGG 0: 1
1: 2
2: 10
3: 55
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985515209 Original CRISPR CCAGGTCTAAATGGTTTCAC TGG (reversed) Intronic
902157537 1:14500977-14500999 CCAGGCCCAAATGGATTCACTGG + Intergenic
902647709 1:17813727-17813749 CTAGGTCTAAACGGTTTCACTGG - Intronic
902832591 1:19027075-19027097 CCAGGCCCAGATGGTTTCACTGG + Intergenic
902867960 1:19293075-19293097 CCAGGTCTACATGGCTTCATTGG + Intergenic
902982615 1:20136677-20136699 CCAGGTCCAGATGGCTTCACTGG - Intergenic
903151220 1:21410731-21410753 CCAGGACTACATGGTGTTACTGG - Intergenic
903784654 1:25851476-25851498 CCAGGTCCAGATAGTTTCTCTGG - Intronic
904338654 1:29815880-29815902 CCAGTCCCAAATGGCTTCACTGG - Intergenic
904441118 1:30532229-30532251 CCAGGCCCAGATGGCTTCACTGG - Intergenic
904934278 1:34117489-34117511 CCAGGACCACATGGATTCACTGG + Intronic
904967436 1:34387210-34387232 CCAGGCCCAGATGGTTTCACTGG + Intergenic
904985194 1:34540463-34540485 CCAGGCATAAAAGATTTCACTGG + Intergenic
905288241 1:36901068-36901090 CCAGGCCCAGATGGGTTCACTGG + Intronic
905498012 1:38410652-38410674 CTAGGTCCAGATGGCTTCACTGG + Intergenic
906018242 1:42602673-42602695 CCAGGCCCAGATGGTTTCACTGG + Intronic
906741073 1:48185829-48185851 CATGGTCCAAATGGCTTCACCGG + Intergenic
907016161 1:51015123-51015145 TCATGCCTAGATGGTTTCACTGG + Intergenic
907817233 1:57931462-57931484 CCAGGCCTAGATGGATTCACTGG - Intronic
907926681 1:58961649-58961671 CCAGGACCAGATGGATTCACAGG + Intergenic
908537942 1:65095939-65095961 CCAGGACCAGATGGATTCACAGG - Intergenic
908574815 1:65448629-65448651 CAAGGCCTAGATAGTTTCACTGG - Intronic
908947112 1:69511743-69511765 CCAGGCCTAGATGGCTTTACTGG + Intergenic
908989441 1:70068966-70068988 CCAGGCCCAGATGGTTTCACTGG - Intronic
909051413 1:70773183-70773205 TCTGTTCTAAATGTTTTCACTGG + Intergenic
909083388 1:71143055-71143077 CTAGTGCCAAATGGTTTCACTGG - Intergenic
909794942 1:79721731-79721753 CCAGTTCAAAATAGTTTCACTGG + Intergenic
910346150 1:86241003-86241025 CCAAGCCTTGATGGTTTCACTGG + Intergenic
910548118 1:88442256-88442278 CCAGGTCCAAATGGTTTCACTGG + Intergenic
910782679 1:90957182-90957204 CCAGGACTATGCGGTTTCACTGG + Intronic
911129137 1:94371538-94371560 CCACATCCAGATGGTTTCACTGG - Intergenic
911555640 1:99341246-99341268 CCAGGACCAGATGGATTCACAGG - Intergenic
912600269 1:110924247-110924269 CTAGTCCCAAATGGTTTCACTGG + Intergenic
913032964 1:114930637-114930659 CCAGATCTGGATGATTTCACTGG + Intronic
913092494 1:115487784-115487806 CCAGGTCCAGATGGATTCATTGG + Intergenic
913599851 1:120412656-120412678 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914087210 1:144464019-144464041 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914192986 1:145426991-145427013 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914311399 1:146470189-146470211 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914591018 1:149105905-149105927 CCAGGTCCAGATGGTTTCACTGG + Intergenic
915060492 1:153178882-153178904 CCAGGTCCAAAAGGATTAACTGG - Intergenic
915617752 1:157053536-157053558 CCAGATCCAAATGGTTTCACTGG - Intergenic
915871696 1:159567182-159567204 CCAGGGCCAGATGGTTTCACTGG + Intergenic
916139937 1:161687528-161687550 CCAGTCCTAGATGGTTTTACTGG - Intergenic
916258510 1:162815790-162815812 CCAGGCCCAGATGGTTTCACTGG - Intergenic
916603531 1:166317640-166317662 CTAGGTCTAGATAGGTTCACTGG - Intergenic
917273920 1:173309788-173309810 TCAGGTCCAAATGGCTTCACTGG - Intergenic
917612848 1:176706579-176706601 CCAGGCATGAATTGTTTCACAGG + Intronic
917715870 1:177737017-177737039 CCAGGTCGAGATAGTTCCACTGG + Intergenic
917763111 1:178185994-178186016 CCAGGTCCAGATAGTTTCAATGG - Intronic
918711796 1:187740235-187740257 CCAGGACCAGATGGTTTCACTGG - Intergenic
918960941 1:191276739-191276761 ACAGGCCTATATGGTTTTACTGG + Intergenic
919038304 1:192346015-192346037 CCATTTCCAAATGGTTTCACAGG + Intronic
919562704 1:199141698-199141720 CCAGGCCTAGATGGTTTAACTGG + Intergenic
919696734 1:200584238-200584260 ACAGGACTTAATGGCTTCACTGG + Intronic
921125424 1:212173450-212173472 CCAAGTCTTAATGATTTAACAGG - Intergenic
922294598 1:224238589-224238611 CCAGGTCAAAATGGATTGAATGG - Intronic
922732377 1:227957124-227957146 CCAAGGCCAGATGGTTTCACTGG - Intergenic
922947463 1:229529341-229529363 CTAGGTCAAAATAGTTTCAATGG + Intronic
923947327 1:238902676-238902698 CCAGGACCACATGGATTCACAGG + Intergenic
924397539 1:243639263-243639285 CCAGGCCCAGATGGTTTCACTGG + Intronic
924787717 1:247214780-247214802 AAAGGTCTAGATGGTCTCACTGG - Intergenic
924939183 1:248800068-248800090 TCAGGTCCAGGTGGTTTCACTGG - Intergenic
1062967570 10:1620512-1620534 CCAGGCCCAAATGGTGTCACTGG + Intronic
1063056916 10:2515153-2515175 CCAGGCCCAGATGGTTTTACTGG + Intergenic
1063374142 10:5542826-5542848 CCAGGCCCAGATGGTTTCCCTGG + Intergenic
1063855315 10:10244280-10244302 CCAGTTTTAGATGGATTCACTGG + Intergenic
1064197210 10:13254221-13254243 CCAGGTTGAGATGGCTTCACTGG - Intergenic
1064510537 10:16085331-16085353 CCAGGACCAGATGGCTTCACTGG + Intergenic
1064664287 10:17634219-17634241 CCAGGCCTAGATGGCTTCACTGG - Intergenic
1065163744 10:22952557-22952579 CCAGGTCCAGATGGTTTTACTGG + Intronic
1065365474 10:24931748-24931770 CCATGTCAAGATGGTTTTACTGG + Intronic
1065677301 10:28191162-28191184 CCAGGTCCAGATGGCTTCACTGG + Intronic
1065905976 10:30252473-30252495 TCAGATCCAAATGGTTTCACTGG - Intergenic
1066043092 10:31571152-31571174 CCAGGCCCAAATGGCTTCACTGG + Intergenic
1066471353 10:35701143-35701165 CCTGGTCTGGTTGGTTTCACAGG + Intergenic
1066684732 10:37969816-37969838 TCAGGCCTAAATGGTTTCATTGG + Intronic
1066692037 10:38039164-38039186 CCAGGTCCATAAGGGTTCACTGG - Intronic
1066724953 10:38381476-38381498 CCAGGCCCAGATGGTTTCACTGG - Intergenic
1067022147 10:42810607-42810629 CCAGGCCCAGATGATTTCACTGG - Intronic
1067027188 10:42854029-42854051 CCAGACCCAAATGGTTTCACTGG - Intergenic
1067191700 10:44075331-44075353 CCAGGCTTAGATGGTTTCACTGG - Intergenic
1067259121 10:44671394-44671416 CCAGGACCCAATGGTTTCACTGG + Intergenic
1067846545 10:49727354-49727376 CCAGGCCCAAGTGGCTTCACTGG + Intergenic
1068563181 10:58540639-58540661 CCAGGACCAGATGGCTTCACTGG + Intronic
1068732380 10:60373820-60373842 CCAGGACTGAAAGGTTTCCCAGG - Intronic
1069644845 10:69986961-69986983 CCAGGCTCAAATGGTTTTACAGG + Intergenic
1070021659 10:72592359-72592381 CCTGGTCCAGATGGTTTCACTGG + Intronic
1070316650 10:75319969-75319991 CCAGATTCAGATGGTTTCACTGG + Intergenic
1070376053 10:75831962-75831984 CTAGGAGAAAATGGTTTCACGGG - Intronic
1070687198 10:78495291-78495313 CCAGGTCCAGATGCCTTCACTGG + Intergenic
1071046803 10:81388548-81388570 CAAGGTCTAGATAGCTTCACTGG - Intergenic
1071054778 10:81496615-81496637 CCAGGTATTAAATGTTTCACTGG - Intergenic
1071190921 10:83099660-83099682 TCAGGGCCAAGTGGTTTCACTGG + Intergenic
1071199086 10:83196790-83196812 CCAGGCCCAAATGGTTTCACTGG - Intergenic
1071350460 10:84736065-84736087 CTAAGCCTAAATGGTTTCACTGG - Intergenic
1071845084 10:89513773-89513795 CCTGGTTTAAATGGTTTCTTTGG - Intronic
1071983459 10:91027306-91027328 CCAGGACCAGATGGATTCACAGG + Intergenic
1072194266 10:93102170-93102192 CCAGGCCCAAATGGCTTCATAGG - Intergenic
1072609482 10:97007322-97007344 CCAGGCCCAGATGGTTTAACTGG + Intronic
1073026563 10:100491292-100491314 CCAGGCCTAGATGGTTTCACTGG + Intronic
1073039348 10:100590949-100590971 TCAGGCCTATATGGTTTTACTGG + Intergenic
1073576141 10:104626533-104626555 CCAGGCCCAAATGGTTTCACTGG + Intergenic
1073658423 10:105444394-105444416 CCAGGCCCAGATGCTTTCACTGG - Intergenic
1073869101 10:107841416-107841438 CCAGGACCATATGGCTTCACTGG + Intergenic
1074248667 10:111721231-111721253 CCAGGCCCAGATAGTTTCACTGG + Intergenic
1074630656 10:115251444-115251466 CCAGCTCAAAATGGGTCCACTGG - Intronic
1074879387 10:117642149-117642171 CCAGGACCAAATGGTTTCATTGG - Intergenic
1075217459 10:120549389-120549411 CCAGGCCCAGGTGGTTTCACTGG + Intronic
1075681227 10:124333999-124334021 CCAAGCATAAAGGGTTTCACTGG + Intergenic
1075869106 10:125755602-125755624 CCAGGTTAAGATGGTTTTACTGG - Intronic
1076213212 10:128669221-128669243 CCAGGTCTAGAAGGCTTCACTGG + Intergenic
1077149450 11:1063356-1063378 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1078354043 11:10620469-10620491 CCAGACCTAAATGGGTACACGGG + Intronic
1078378864 11:10821445-10821467 CCAGGACCACATGGTTGCACTGG + Intronic
1078472077 11:11597397-11597419 CCAGGTCCAAATGGCTTTACTGG - Intronic
1078488464 11:11746282-11746304 ACAGGCCCAAATGATTTCACTGG + Intergenic
1078591617 11:12645808-12645830 CCAGGCCCAGATGGGTTCACTGG + Intergenic
1078712080 11:13803112-13803134 GCAGTTCCAGATGGTTTCACTGG + Intergenic
1078992138 11:16659740-16659762 CCAGGCCCAGATGGTTTCACTGG - Intronic
1079072762 11:17362579-17362601 CCAGGTTCGGATGGTTTCACTGG - Intronic
1079516089 11:21271507-21271529 CCAGGCCCAGATGGGTTCACTGG + Intronic
1080305843 11:30834576-30834598 CCAGTCCTAGATGGGTTCACTGG + Intronic
1080487080 11:32719934-32719956 TCAGGCCCAGATGGTTTCACTGG + Intronic
1080577598 11:33614336-33614358 CCTGCTCTATATGGTCTCACAGG + Intronic
1081127411 11:39338880-39338902 CCAGGACAAGATGGTTCCACTGG - Intergenic
1081132252 11:39394528-39394550 CCAGGACCAGATGGATTCACAGG - Intergenic
1081844081 11:46225923-46225945 TCAGGTCCAGATGGTTTCATGGG + Intergenic
1082556866 11:54573662-54573684 CCAGGCCAAGATGGCTTCACTGG + Intergenic
1082985262 11:59163565-59163587 CCAGGGCTAGATGCTTTTACTGG + Intergenic
1083715578 11:64573827-64573849 CCAGGCCCAAATGGCTTCACTGG + Intergenic
1084503351 11:69549199-69549221 CCAGTCCCACATGGTTTCACTGG + Intergenic
1085217648 11:74846332-74846354 CAAGGACCAGATGGTTTCACTGG + Intronic
1085613395 11:77974037-77974059 TCAGGCCTCAATGGCTTCACTGG - Intronic
1086447325 11:86881704-86881726 CCAGGACCAGATGATTTCACTGG - Intronic
1087096480 11:94324158-94324180 CAAGGTCCAAATGGATTCACTGG + Intergenic
1087135545 11:94714488-94714510 CCAGGTCCAGATGATTTCACTGG - Intronic
1087850305 11:103020157-103020179 CCAGGACCAGATGGCTTCACTGG + Intergenic
1087954751 11:104271789-104271811 TCAGGTCTTAATGGCTTTACTGG - Intergenic
1088210599 11:107451808-107451830 CCAGGACCAAACCGTTTCACTGG + Intronic
1088463206 11:110104623-110104645 CCAGGTCTACCTGATTTCAGAGG - Intronic
1088510633 11:110570141-110570163 CCAGGCCCAGATGGTTTCACTGG - Intergenic
1088859284 11:113784915-113784937 AGAAGTCAAAATGGTTTCACGGG + Intergenic
1088929504 11:114336852-114336874 TCAGGTCAAAATGGGTTCGCTGG + Intergenic
1088996433 11:115002622-115002644 CCAGGACCAGATGGCTTCACTGG + Intergenic
1089122794 11:116150358-116150380 TCAGGCCTAAATGGTTTCACTGG + Intergenic
1090168173 11:124573940-124573962 CCAGGTTCAAATGGGTTCACTGG + Intergenic
1090586397 11:128217824-128217846 CCAGGTCCAGGTGGTTTCACTGG - Intergenic
1090724582 11:129512578-129512600 TCAGGCCCAAATGGTTTCACTGG - Intergenic
1090987470 11:131782384-131782406 CTAGGTCTGCATGGCTTCACTGG + Intronic
1091071939 11:132573838-132573860 CCAGGTCCAGATGGCTTCACAGG - Intronic
1091075481 11:132611839-132611861 CCAGGACTGAAGGGTTTCTCAGG + Intronic
1091276126 11:134352053-134352075 CCAGGACCAGATGGCTTCACTGG - Intronic
1091349866 11:134884849-134884871 CCAGCCCTGAATAGTTTCACAGG - Intergenic
1091830524 12:3546702-3546724 CCAGGCATATATGGTTTTACTGG + Intronic
1091868483 12:3864519-3864541 CTAGGTCCAGATGGTTTCAGTGG - Intronic
1092734812 12:11570957-11570979 CCAGGCCTAGATGGCTTTACTGG - Intergenic
1092983722 12:13824233-13824255 CCAAGCCCAAATGGCTTCACTGG - Intronic
1093136058 12:15452375-15452397 CCAGGACTAGACGGATTCACAGG + Intronic
1093186556 12:16026695-16026717 CCAGCTCTAGATGGCTTCATTGG + Intronic
1093242340 12:16692800-16692822 CCAGGGCCAGATGGCTTCACAGG + Intergenic
1093400090 12:18735359-18735381 CCAGGACCAAATGACTTCACAGG - Intronic
1093687853 12:22077005-22077027 CCAGTTCCAAATGGCTCCACAGG + Intronic
1093695336 12:22152901-22152923 CCAGGTCCAAATGGCTTCAGTGG + Intronic
1093826459 12:23696234-23696256 CCAGGCCCAGATGGTTTCATTGG - Intronic
1093944797 12:25095741-25095763 CCATGACTGAATGGCTTCACTGG - Intronic
1094060236 12:26306827-26306849 CCAGGTCCAGATGGCTTCACTGG + Intergenic
1094584109 12:31761305-31761327 CCAGGTCTAGATATTTTCATAGG + Intergenic
1095886907 12:47197925-47197947 CCAGGCCCAGATGGGTTCACTGG + Intronic
1096568623 12:52503720-52503742 CCAGGCCTGGATGGGTTCACAGG - Intergenic
1096896307 12:54823603-54823625 CCACTTCCAAATGGTTTCCCTGG - Intergenic
1097224948 12:57471570-57471592 CCAGGTCCATATGTGTTCACTGG - Exonic
1097780144 12:63693191-63693213 CTAGGTCCAGATGGTTTCACTGG - Intergenic
1098130214 12:67342188-67342210 CCAGGACCTAATGGCTTCACTGG - Intergenic
1098546720 12:71719578-71719600 CCAGGCTTAGATGGTTTCATTGG - Intergenic
1099206315 12:79731902-79731924 CCAAGCCTAGATGCTTTCACTGG + Intergenic
1099648154 12:85387409-85387431 CCAGGAACAAATGGTTTCATAGG + Intergenic
1099689399 12:85932847-85932869 CCAGGTTCCATTGGTTTCACTGG - Intergenic
1099761987 12:86935019-86935041 CCAGGTCTTAATGGATTCACTGG + Intergenic
1099976821 12:89554436-89554458 CCAGGTGTAGACTGTTTCACTGG + Intergenic
1100065161 12:90635009-90635031 CCAGGCCCAGATGGTTTCAGTGG + Intergenic
1100160209 12:91850352-91850374 CCAGGGCTAGATGTTTTCTCAGG + Intergenic
1101582583 12:106055889-106055911 CCAGGTCCAAATACCTTCACTGG + Intergenic
1101893847 12:108739625-108739647 CTAGGTTGAAATGGTTTCCCTGG - Intergenic
1102319150 12:111916384-111916406 TCAGGCCCAGATGGTTTCACTGG - Intergenic
1102428482 12:112862986-112863008 CCAGCTCTATCTGGGTTCACTGG + Intronic
1105528130 13:21194675-21194697 CCAGGCCCAGATTGTTTCACCGG - Intergenic
1105689815 13:22825579-22825601 CCAGGACCAAATGATTTCACTGG + Intergenic
1106333280 13:28759902-28759924 CCAGGACTAGATGGCTTCACTGG - Intergenic
1106369524 13:29117924-29117946 CCCTGTCCAGATGGTTTCACTGG + Intronic
1107131258 13:36898307-36898329 CCAGGCCCACATGGTTTCACTGG + Intronic
1107370654 13:39743636-39743658 CCAGGACCAGATGGATTCACAGG + Intronic
1107584605 13:41831311-41831333 CCAGGTCTGATTGGTTCCACCGG - Intronic
1108126283 13:47247390-47247412 CCAGGCCTACACAGTTTCACTGG - Intergenic
1108194375 13:47977315-47977337 CCGGGACCAAATGGCTTCACTGG + Intronic
1108265522 13:48703838-48703860 CCAGATCCAGATGGCTTCACTGG - Intronic
1108489116 13:50962314-50962336 CCAGGTCCAAATGGCTTCACTGG - Intronic
1108624674 13:52216100-52216122 CCAGGACCAGATGGATTCACAGG + Intergenic
1108661373 13:52590321-52590343 CCAGGACCAGATGGATTCACAGG - Intergenic
1108684848 13:52810095-52810117 TCAGATCTAAATGTTTGCACTGG + Intergenic
1109129832 13:58570200-58570222 CCAGGTCAAGAGGGATTCACTGG - Intergenic
1109493951 13:63143649-63143671 CCAAGTCCAACTGGTTACACCGG + Intergenic
1109701353 13:66028709-66028731 CCAGGCTCAAATGGTTTTACTGG - Intergenic
1110018277 13:70436629-70436651 ACAGGTCTAGATGGTTTCACTGG + Intergenic
1110136415 13:72072840-72072862 GCAGGTCAAGAAGGTTTCACAGG + Intergenic
1110545801 13:76754009-76754031 TCGGGTGTAAATCGTTTCACCGG - Intergenic
1111062143 13:83035172-83035194 CCAGGAACAAATGGCTTCACTGG + Intergenic
1111152383 13:84272192-84272214 CCAGGCCTAGATTGTTTCATTGG - Intergenic
1111665259 13:91259212-91259234 CCAGGTCTAAAAGGCTGCATTGG + Intergenic
1112524983 13:100136506-100136528 CCAGGCCCAGATGGTTTCACTGG - Intronic
1112564293 13:100539791-100539813 CCAGGACCAGATGGCTTCACTGG - Intronic
1113510655 13:110852202-110852224 CCAGGTCAAGATGGCTTCTCTGG + Intergenic
1113703129 13:112403095-112403117 CCAGGAAGAGATGGTTTCACAGG - Intronic
1113809905 13:113133565-113133587 TCAGGTACAGATGGTTTCACTGG + Intronic
1114505743 14:23211391-23211413 CCAGGCTTAGATGGCTTCACTGG + Intronic
1114802015 14:25786633-25786655 CCAAGACTAAGTGGTTTCACAGG - Intergenic
1115889632 14:38012223-38012245 GGAGGACTAAATGGTTTCATGGG + Intronic
1116016225 14:39410633-39410655 CCAGGACTGGATGGCTTCACAGG - Intronic
1116092301 14:40325290-40325312 TCAGGCCTAGATGGGTTCACTGG + Intergenic
1116218899 14:42056365-42056387 CCAGGTCCAGAGGGTTTCACTGG + Intergenic
1116264711 14:42673492-42673514 CCAGGTCCAGATGCGTTCACTGG + Intergenic
1116751101 14:48885034-48885056 CCAGGTCCAGATGACTTCACTGG - Intergenic
1117188663 14:53269019-53269041 CCAGGACCAGATGGATTCACAGG - Intergenic
1117191901 14:53300998-53301020 CCAGGACCAGATGGATTCACAGG - Intergenic
1117194030 14:53321580-53321602 CCAGGACCAGATGGATTCACAGG + Intergenic
1117687722 14:58271939-58271961 CCAGGGCTAAATAGTTACATTGG - Exonic
1118080525 14:62353887-62353909 CCAGGACCTAATGGCTTCACTGG - Intergenic
1118099915 14:62586355-62586377 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1119117150 14:72034772-72034794 CCCGGACCAGATGGTTTCACTGG - Intronic
1119202050 14:72762077-72762099 CCAGATCCAAATGGATTCACTGG + Intronic
1121040901 14:90746191-90746213 CCAGGTCCAGATGGCTTTACTGG - Intronic
1121476111 14:94205159-94205181 CCAGGCCCAGATGGTTTCAATGG - Intronic
1122039757 14:98977472-98977494 CCAGGCCCAGATGGCTTCACTGG + Intergenic
1122764836 14:104060488-104060510 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1122808351 14:104273631-104273653 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1123781729 15:23634858-23634880 CCATGCCCAGATGGTTTCACTGG + Intergenic
1123829017 15:24114792-24114814 CCAGGTCAAGATGACTTCACTGG - Intergenic
1123843936 15:24278226-24278248 CCAGGTCAAGATGACTTCACTGG - Intergenic
1123859014 15:24444507-24444529 CCAGGTCAAGATGACTTCACTGG - Intergenic
1123936393 15:25196148-25196170 CCAGGGATGAATGGTTTCTCTGG + Intergenic
1124205612 15:27717053-27717075 CCAGGCCCAGATGATTTCACTGG - Intergenic
1124227609 15:27907891-27907913 CCAGGCCAAGATGGTCTCACAGG + Intronic
1124385149 15:29201881-29201903 CCAGGTCCAGATGGTTTCACTGG - Intronic
1124389023 15:29236713-29236735 CCAGGCCTAGATAGTTTCACTGG + Intronic
1124553371 15:30703984-30704006 CCAGGCCTAGATGGTTTCACTGG - Intronic
1124677874 15:31701684-31701706 CCAGGCCTAGATGGTTTCACTGG + Intronic
1126025237 15:44439997-44440019 CCAGGCCCAAATGGCTTCACTGG - Intronic
1126058003 15:44750354-44750376 CCAGGACCAGACGGTTTCACTGG - Intronic
1126224536 15:46255186-46255208 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1126503499 15:49375702-49375724 CCACCACTAAATGGGTTCACAGG + Intronic
1126536021 15:49765606-49765628 CCAAGACCAGATGGTTTCACTGG - Intergenic
1126552242 15:49945391-49945413 CCAAGACCAGATGGTTTCACTGG + Intronic
1126653768 15:50954353-50954375 ACAAGTCCAGATGGTTTCACTGG - Intronic
1127280254 15:57484214-57484236 CCAGGTCTAACTGGTTTCAGTGG - Intronic
1127340277 15:58035065-58035087 CTAAGTCCAGATGGTTTCACTGG - Intronic
1127545006 15:59984967-59984989 CCAGGGCTAGAGGGCTTCACGGG + Intergenic
1128252696 15:66174097-66174119 CCTGGTCTCAATTATTTCACAGG + Intronic
1128586454 15:68855393-68855415 CCAGGCCCAGATGGTTTCAGTGG - Intronic
1129095241 15:73200144-73200166 CTAGGCCTAGATAGTTTCACTGG - Intronic
1129106491 15:73311965-73311987 CTAGGACCCAATGGTTTCACTGG + Intergenic
1129307579 15:74678469-74678491 CCAGGCCTAGATGGCTTTACTGG + Intronic
1129645996 15:77433377-77433399 CCAGGTCTACCTGACTTCACTGG + Intronic
1129972558 15:79792473-79792495 CCAGGTGCAAATGGTTTCACAGG + Intergenic
1130035152 15:80352958-80352980 CCAAGACTAGATGGCTTCACTGG + Intronic
1130164925 15:81445044-81445066 CCATGCCTAGATGGATTCACTGG + Intergenic
1130310408 15:82748976-82748998 CCAGGTCCAGATGGTCTAACTGG + Intergenic
1130392338 15:83468937-83468959 CCAGGCCTAGATGGTTTTACTGG - Intronic
1130425168 15:83790116-83790138 TAAGGCCTAGATGGTTTCACTGG + Intronic
1130658258 15:85808558-85808580 CCAGGCCTAGATAGTCTCACTGG + Intergenic
1130928939 15:88406952-88406974 CCAGGTCCAGATGGCTTCACTGG - Intergenic
1131240155 15:90733412-90733434 TGAGGTCCAAATGGTTTAACAGG + Intronic
1131780499 15:95851985-95852007 CCAGGCCCAAATGGTTTTACTGG + Intergenic
1131964283 15:97823344-97823366 CCAGGTCCCAACGGGTTCACTGG - Intergenic
1132022856 15:98378893-98378915 CCAGGTCCAGATGGGTTCACTGG + Intergenic
1132258925 15:100403772-100403794 CTAGGTCCAAATGTTTACACTGG + Intronic
1132323856 15:100949411-100949433 CCAGGCCCAGATAGTTTCACTGG + Intronic
1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG + Intronic
1132422408 15:101682744-101682766 CCAGGCCAAGATGGTTTTACTGG - Intronic
1132620271 16:862944-862966 CCAGGCTCAGATGGTTTCACTGG - Intronic
1133163069 16:3925058-3925080 CCAGGTCCAGATGGGCTCACTGG + Intergenic
1133539856 16:6739502-6739524 TCCGGTCTAAATGGTTTCACTGG + Intronic
1135264773 16:21013966-21013988 CCAGGCCAAGATGGGTTCACTGG + Intronic
1136078456 16:27834530-27834552 CCAGGTCCAGATGGTTTTACTGG - Intronic
1136645694 16:31612434-31612456 CCAGGACTAGACGGATTCACAGG + Intergenic
1137658017 16:50177340-50177362 CCAGGCCCAGATGGGTTCACTGG - Intronic
1137824232 16:51476252-51476274 CCAGGACCATATGGCTTCACTGG - Intergenic
1138269675 16:55686192-55686214 CCTGGACTACATGGCTTCACTGG + Intronic
1138690527 16:58764055-58764077 CCAAGTCCAAATAGCTTCACGGG - Intergenic
1138746952 16:59374716-59374738 CCAGATCTAGATGGGTTCACTGG - Intergenic
1138769297 16:59644033-59644055 CCAGGCCCAAATTGTTTCAGTGG - Intergenic
1139232756 16:65301744-65301766 CCAGCTATAGATGGGTTCACTGG + Intergenic
1139413268 16:66783665-66783687 CCAGGCCTTAATGGTTACATTGG - Intronic
1140584324 16:76271065-76271087 CCAGGACCAGATGGCTTCACTGG + Intergenic
1142916572 17:3144474-3144496 ATAGGTCCAGATGGTTTCACTGG - Intergenic
1143738953 17:8938141-8938163 TCAGGCCCAGATGGTTTCACTGG - Intronic
1144184368 17:12782943-12782965 CCAGGTCCATATGGTTTTATGGG - Intergenic
1144361146 17:14494660-14494682 CCAGGACCAGATGGCTTCACTGG - Intergenic
1144482974 17:15642786-15642808 CCAAGTCTAACTGGGTGCACTGG + Exonic
1144598493 17:16591652-16591674 CCAGGGCCAAATGGCTTCACTGG + Intergenic
1144915708 17:18722245-18722267 CCAAGTCTAACTGGGTGCACTGG - Exonic
1146037612 17:29421521-29421543 CTAGGCCCAGATGGTTTCACAGG - Intronic
1146459154 17:33031115-33031137 CCAGGTCCAGATGGCTTCACTGG - Intronic
1147747807 17:42706167-42706189 CCAGGTCAGAATCGTTTCCCTGG - Exonic
1148573907 17:48694383-48694405 CCTGATCCAGATGGTTTCACTGG - Intergenic
1148944496 17:51247837-51247859 CCAGGCCTAGATGGTTTCACAGG - Intronic
1150021862 17:61624557-61624579 TCAGGCCCAGATGGTTTCACTGG - Intergenic
1150024434 17:61657582-61657604 CCAGGACCAGATGGTTTCACTGG - Intergenic
1150154389 17:62839407-62839429 CCAGGCCCAAGTTGTTTCACTGG + Intergenic
1150178153 17:63084092-63084114 CCAGGCCCAGATGGGTTCACTGG - Intronic
1150511806 17:65760856-65760878 CCAGGCCTACATGGATTCAATGG - Intronic
1151191665 17:72402803-72402825 CCAGGACTAAAGGGTTTCTTGGG - Intergenic
1152504625 17:80740298-80740320 GCAGGCATACATGGTTTCACTGG + Intronic
1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG + Intergenic
1153320341 18:3767280-3767302 CCAGGTCCAGATGGTTTCACAGG + Intronic
1153612869 18:6904949-6904971 CCAAGCCCAGATGGTTTCACTGG + Intronic
1154072837 18:11168867-11168889 CCAGGTCCAGATGGCTTCACTGG + Intergenic
1154372969 18:13781947-13781969 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1154472261 18:14715849-14715871 CAAGGCCCAGATGGTTTCACTGG - Intergenic
1155089920 18:22497276-22497298 CCATCTCCAGATGGTTTCACTGG + Intergenic
1155098844 18:22588507-22588529 CCAGGTCTAGACAGTTTCAGAGG + Intergenic
1155418131 18:25623456-25623478 CCAGGACAAGATGGCTTCACTGG - Intergenic
1155424512 18:25692403-25692425 CCAGTTCTAGATAGTTTTACAGG - Intergenic
1155856507 18:30840473-30840495 CCAGGACTAGATGGCTTTACTGG - Intergenic
1156025599 18:32651011-32651033 CCAGGACTCAATGGCTTCACTGG - Intergenic
1156270945 18:35531315-35531337 CCAAGATTAAATGGTTTCACTGG + Intergenic
1156329132 18:36102628-36102650 CCAGGCTGAGATGGTTTCACTGG - Intergenic
1156430608 18:37069624-37069646 CCAGGTCCAGATGGCTTCACTGG - Intronic
1156951968 18:42911821-42911843 CCAGGCCCAGATGGTTTCACTGG + Intronic
1157071145 18:44410135-44410157 TCAGGCCCAGATGGTTTCACTGG + Intergenic
1157512469 18:48287452-48287474 AGAGGCCCAAATGGTTTCACAGG + Intronic
1157766932 18:50305762-50305784 CCAGATCCAATTGGCTTCACTGG - Intergenic
1157854083 18:51088086-51088108 TCAGGCCTAGATGGTTTTACTGG + Intergenic
1157854312 18:51091288-51091310 CCATTTCTATATGCTTTCACTGG - Intergenic
1158953054 18:62514465-62514487 CCAGGTCCAGTTGTTTTCACTGG + Intergenic
1159817701 18:73096474-73096496 TCAGGTCCAGATGGTTTCACTGG - Intergenic
1159856084 18:73589768-73589790 CCAGGTTCAGGTGGTTTCACTGG + Intergenic
1159907691 18:74112070-74112092 CCAGGCCCAAATGGGTTCACTGG + Intronic
1160038947 18:75327152-75327174 CCAAGCCCAGATGGTTTCACTGG + Intergenic
1160241393 18:77125954-77125976 CCAGGCCCACATGGTTTCACCGG + Intronic
1160384916 18:78490417-78490439 CCAGGCATACATGGTTTTACAGG + Intergenic
1160627470 18:80221105-80221127 CCAGACCCAGATGGTTTCACTGG + Intronic
1163406500 19:17126263-17126285 CCAGGACAAAATGGGTCCACAGG - Intronic
1164815472 19:31197829-31197851 CCAGCTCTAGATGGCTTTACTGG + Intergenic
1165398253 19:35579743-35579765 TCAGGCCTAGATGGTTTCATTGG + Intergenic
1165526455 19:36359445-36359467 CCAGCCCCAGATGGTTTCACTGG - Intronic
1165587658 19:36933859-36933881 TCAGGCCTAGATGGCTTCACTGG - Intronic
1166023935 19:40061851-40061873 CAAAGACTACATGGTTTCACTGG - Intergenic
1167009598 19:46798328-46798350 GAAGTTCGAAATGGTTTCACTGG + Intergenic
925404011 2:3594134-3594156 TCAGGGCCAGATGGTTTCACAGG - Intergenic
925699571 2:6621838-6621860 CCAGGTGTAAATGGCTTTACTGG - Intergenic
925727695 2:6889509-6889531 CCAGATCTAAAGGGTTTCCATGG - Intronic
925750020 2:7079907-7079929 CTAGGCCCAGATGGTTTCACTGG + Intergenic
925791713 2:7495450-7495472 CCAGGACTGAATGGCTTTACTGG + Intergenic
926122290 2:10250279-10250301 CCAGGCCCAGATGGCTTCACTGG - Intergenic
926238075 2:11064158-11064180 CCAGGACTAGGTGGTTTCATTGG - Intergenic
926713691 2:15905789-15905811 CCAGGCCCAGATGGTTTCACTGG + Intergenic
927619613 2:24639186-24639208 CCAGGTCCAGATGGCATCACAGG - Intronic
927799267 2:26082642-26082664 TCAGGCCCAAATGGCTTCACTGG + Intronic
927823440 2:26289361-26289383 CCAGGTCTAGATGATTCCAAAGG - Intronic
927902824 2:26833639-26833661 CCAGGTCCAGATGGCTTTACTGG + Intergenic
927947325 2:27143889-27143911 CCAGAACCAAATGGCTTCACTGG - Intergenic
928047118 2:27946598-27946620 CCAGGTCCAGATGGCTTCATTGG - Intronic
928047448 2:27950755-27950777 CCAGGCCCAGATGGTTTCACTGG - Intronic
928301149 2:30126171-30126193 CCAGGCCCAGATGGCTTCACTGG + Intergenic
928448722 2:31358298-31358320 CCAGGTCCAAACGATTTCACTGG + Intronic
928464404 2:31508594-31508616 ACAGGCCTAGATTGTTTCACTGG + Intergenic
929319409 2:40523855-40523877 CCAGGCACAGATGGTTTCACTGG - Intronic
929582125 2:43088015-43088037 CCAGGCAGAAAAGGTTTCACAGG + Intergenic
929833105 2:45366010-45366032 TCAGGTCCAGATGGCTTCACTGG - Intergenic
930155342 2:48101610-48101632 CCAGGTGTAGATGGTTCCACTGG + Intergenic
931504369 2:62908064-62908086 CCAGGTCCACATGGCTTCATTGG - Intronic
931526231 2:63157489-63157511 CCAGGTCCCGATGGTTTCACTGG - Intronic
931985863 2:67741566-67741588 CCAGGACCAGATGGATTCACAGG - Intergenic
932069386 2:68602235-68602257 CCAGGACCAGATGGCTTCACTGG + Intronic
932105169 2:68935580-68935602 CCAGGACTAAAGGGTTTCGTGGG + Intergenic
932395256 2:71441004-71441026 CCAAGTCCTGATGGTTTCACTGG + Intergenic
932520018 2:72402109-72402131 CCAAGACTAGATGGTTTCAGTGG - Intronic
933076241 2:77931016-77931038 CCAGGGCCACATGGTTTCACTGG + Intergenic
933237394 2:79880427-79880449 CCAGGACCAGATGGATTCACAGG - Intronic
933529813 2:83493603-83493625 CCAGGTTCAGATGGTTTCACTGG + Intergenic
934878888 2:97954864-97954886 CCAGGCCAAAATGGCTTTACTGG + Intronic
934975299 2:98798041-98798063 CCAACTCTATATGGTTTCAAAGG - Intronic
935158576 2:100507960-100507982 ACAGGTCCAGATGGCTTCACTGG + Intergenic
935185489 2:100728389-100728411 CCAAGCCAAGATGGTTTCACTGG + Intergenic
935286686 2:101570645-101570667 CCAGGACCAGATGGCTTCACTGG - Intergenic
935343309 2:102078623-102078645 CCATGCCCAGATGGTTTCACTGG + Intronic
935432867 2:102995543-102995565 TCAGGCCCAAATGGGTTCACTGG - Intergenic
935566231 2:104610650-104610672 CTAGGCCCAGATGGTTTCACTGG + Intergenic
935613588 2:105052724-105052746 CCAGGCCCAGATGGCTTCACTGG - Intronic
935664875 2:105501996-105502018 CCAGGCCCAAATCATTTCACTGG + Intergenic
935723723 2:106003297-106003319 CCAGGTCCAGATGGCTTCACTGG - Intergenic
935759498 2:106307099-106307121 CCAGGCCCAGATGGTTTCCCTGG + Intergenic
935895123 2:107727927-107727949 CCAGGCCCAAATGGTTTCGCTGG + Intergenic
935954297 2:108360266-108360288 CCAGGGCCAGATGGATTCACAGG + Intergenic
936273929 2:111075198-111075220 CTAGGCCTTAATGGTTTCATTGG - Intronic
936372593 2:111914998-111915020 CCAGGCCCAGATGGTTTCATTGG - Intronic
936398316 2:112147156-112147178 CCAGGCCCACATGGTTTCATTGG - Intronic
937107258 2:119328231-119328253 CCAGGCCCAGATGGTTTCACTGG - Intronic
937351502 2:121166622-121166644 TTAGGTCCAAGTGGTTTCACTGG - Intergenic
937409185 2:121657873-121657895 CTAGGCCCAAATGGCTTCACTGG - Intergenic
937508745 2:122569229-122569251 CCTGGACTAGATGGCTTCACTGG - Intergenic
937542628 2:122977434-122977456 CCAGGCTCAAATGGGTTCACTGG + Intergenic
937933728 2:127225874-127225896 CGAGGACCAAATGGATTCACAGG - Intergenic
937970879 2:127547929-127547951 CCAGGTGTGGATGGTTTCACTGG - Intronic
938151216 2:128884874-128884896 CCAGGCCCAAATAGTTTCACTGG - Intergenic
938214438 2:129498661-129498683 TCATGTCTAGATGGCTTCACTGG + Intergenic
938840391 2:135156219-135156241 CCAGGCCCAGATGGTTTCACAGG + Intronic
939572165 2:143853132-143853154 TCTTGTCTAAATGATTTCACAGG + Intergenic
939725000 2:145708079-145708101 CCAGGACCAGATGGCTTCACTGG - Intergenic
939761344 2:146184719-146184741 CCAGGTCTAGATGGTTTTACAGG - Intergenic
939916574 2:148051956-148051978 CCAGGACTAGATGGCTTCACTGG - Intronic
940508081 2:154581199-154581221 ACAGGCCCATATGGTTTCACTGG + Intergenic
940879101 2:158928523-158928545 CCAGGACTTGATGGGTTCACTGG - Intergenic
941125050 2:161575251-161575273 GCAGGCCTAGGTGGTTTCACTGG - Intronic
941535132 2:166713135-166713157 CCAGGACTAGATGGCTTAACTGG - Intergenic
941741709 2:169042752-169042774 CCAGGACTAAATGGCTTCACTGG + Intergenic
941946055 2:171098513-171098535 CCAGGCCTAGATGGTTTCACTGG + Intronic
942160315 2:173178695-173178717 CCAGGCCAAGATGATTTCACTGG + Intronic
942527148 2:176866075-176866097 CCAGGCTCAGATGGTTTCACAGG - Intergenic
942887631 2:180946922-180946944 CCTGGCCCAAATCGTTTCACTGG - Intergenic
942894134 2:181030667-181030689 CCAGGTCCACATAGTTTTACAGG - Intronic
943490386 2:188547078-188547100 CCAGGTGTAGATGGTTTCACTGG + Intronic
943887070 2:193232555-193232577 CCAGGGCCAGATGGCTTCACTGG + Intergenic
944099336 2:196005749-196005771 CCAGGACTAGATGGCTTCACTGG + Intronic
944521960 2:200580027-200580049 CTAGGTCCAGATGGTTTCAGAGG - Intronic
944593632 2:201241582-201241604 CCAGGACCAGATGGCTTCACAGG + Intronic
944745779 2:202654016-202654038 CCAGGCCAAGATGATTTCACTGG - Intronic
944745885 2:202655665-202655687 CCAGGCCAAGATGATTTCACTGG - Intronic
944792547 2:203146274-203146296 TCAGGCCCAGATGGTTTCACTGG + Intronic
944991056 2:205236222-205236244 CCAGGTACAAATGACTTCACTGG + Intronic
945010495 2:205457098-205457120 CCAGGCCCAGATGATTTCACTGG - Intronic
945143101 2:206708371-206708393 CCAGGGTTTTATGGTTTCACAGG - Intronic
945231021 2:207590042-207590064 CCAGGCCTATGTGGGTTCACTGG - Intronic
945718982 2:213394833-213394855 CCAAGTCCATATGGTTTCACTGG - Intronic
946184108 2:217967694-217967716 CCAGGTCCCGATGGCTTCACAGG + Intronic
946992237 2:225346866-225346888 CTAGGTCGAGATGGCTTCACTGG - Intergenic
947356807 2:229304740-229304762 CCAGGACCAGATGGTTTTACAGG + Intergenic
947366283 2:229398379-229398401 TCAGGTCCAAATGCTTTCACTGG + Intronic
948651500 2:239448533-239448555 CCAGGTATAGATGGCTTCACTGG - Intergenic
948680736 2:239632936-239632958 CCAGGCCAAAATGGCTCCACAGG - Intergenic
1169048144 20:2553674-2553696 CCAGGCCTGGATGATTTCACTGG - Intronic
1169183141 20:3588790-3588812 CCAGGCCCATTTGGTTTCACTGG - Intronic
1169282906 20:4282038-4282060 CCAGGACTCATTCGTTTCACTGG - Intergenic
1169983555 20:11415449-11415471 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1170197977 20:13710161-13710183 CCAAGTCCAAATGGCTTCACTGG - Intergenic
1170416886 20:16153168-16153190 CCAGGTCCACATGGTTTTACTGG + Intergenic
1170754765 20:19190647-19190669 CCAGGCCTAGATGGGTTCATTGG - Intergenic
1171061083 20:21960696-21960718 CCAGGACTCCATGGTTTCAATGG - Intergenic
1171319414 20:24227456-24227478 CCAGGCCCAGATGGGTTCACTGG + Intergenic
1171356676 20:24551111-24551133 CCAGGCCCAAATGCCTTCACTGG - Intronic
1172172546 20:32948358-32948380 CCAGGCCTAAATGGCTTCCATGG + Intronic
1173008762 20:39161638-39161660 CCAGGACCAGATGGCTTCACTGG - Intergenic
1173535277 20:43805959-43805981 CCAGGACCAAATGGCTTAACTGG - Intergenic
1174119801 20:48255606-48255628 CCAGGCCAAGATGGTTTCACTGG + Intergenic
1174523294 20:51150613-51150635 GCAGGTCTAGATGGTTTCTCTGG + Intergenic
1174854803 20:54033681-54033703 CCAGTACTAGATGGATTCACAGG + Intronic
1175075474 20:56368863-56368885 CCAAGTCTCACTGGTGTCACTGG + Intergenic
1175376540 20:58529868-58529890 CCAGGCCCAAATGGCTCCACTGG - Intergenic
1175432609 20:58916835-58916857 CCAGGCCCAGGTGGTTTCACAGG + Intergenic
1175436305 20:58952329-58952351 CCAGGCCTAGATGGCTTCAGTGG + Intergenic
1175631225 20:60538043-60538065 CCAGGCCTAGGTGGTTTCAATGG + Intergenic
1176639692 21:9289815-9289837 CCAGATCTAAAGAATTTCACTGG + Intergenic
1176802229 21:13442055-13442077 CAAGGCCCAGATGGTTTCACTGG + Intergenic
1176865461 21:14050173-14050195 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1176878360 21:14159016-14159038 CCAGACCCAAATGGTTTCACTGG + Intronic
1177064652 21:16414821-16414843 CTGGATCCAAATGGTTTCACAGG - Intergenic
1177066885 21:16449256-16449278 ACAGGCCCAGATGGTTTCACAGG - Intergenic
1177177574 21:17716727-17716749 CCAGGACTGAATGGATTCACAGG + Intergenic
1177623462 21:23627303-23627325 CCAGGTAAGTATGGTTTCACAGG - Intergenic
1177796670 21:25785884-25785906 CCAGGGCTAGATGGTTTCACTGG - Intergenic
1177923776 21:27188013-27188035 CCAGGTCTAGAGAGCTTCACTGG + Intergenic
1180348703 22:11779195-11779217 CCAGATCTAAAGAATTTCACTGG + Intergenic
1180372990 22:12062650-12062672 CCAGATCTAAAGAATTTCACTGG + Intergenic
1180423738 22:12897283-12897305 CCAGATCTAAAGAATTTCACTGG + Intergenic
1180763329 22:18225062-18225084 CCAGGACCAAATGGTTTTACTGG + Intergenic
1180772317 22:18399482-18399504 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180803696 22:18649098-18649120 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180807068 22:18720348-18720370 CCAGGACCAAATGGTTTTACTGG + Intergenic
1180978466 22:19865819-19865841 CCAGGCCCAGATGGTTTCATTGG - Intergenic
1181218023 22:21346159-21346181 CCAGGACCAAATGGTTTTACTGG + Intergenic
1181303337 22:21898239-21898261 CCAGGCCCCAGTGGTTTCACTGG - Intergenic
1181599924 22:23944381-23944403 CCAGGACCAGATGGTTTTACTGG + Intergenic
1181816606 22:25442261-25442283 CCAGGCTTAGATGGTTTTACTGG + Intergenic
1182400316 22:30071074-30071096 CCAGGACCACATGGCTTCACTGG + Intergenic
1182502777 22:30759737-30759759 TCAGGCCTACATGATTTCACAGG + Intronic
1183173747 22:36206688-36206710 CCAGGCTTAACTGGTTCCACTGG + Intergenic
1183907785 22:41055336-41055358 CCAGGCCTAGATAGCTTCACTGG - Intergenic
1184308063 22:43622063-43622085 CCAGGACTTGATGATTTCACTGG + Intronic
1184316343 22:43694345-43694367 CCAGGCCTAAATGGCTTCTCAGG + Intronic
1185071186 22:48657409-48657431 CCAGGACCAGATGGCTTCACTGG + Intronic
1185323271 22:50212243-50212265 CCAGGACCAGATGGCTTCACTGG - Intronic
1203234157 22_KI270731v1_random:140471-140493 CCAGGACCAAATGGTTTTACTGG - Intergenic
949350920 3:3124488-3124510 CCAGGCCCAGATGGTTTCAGTGG - Intronic
949453097 3:4209094-4209116 CCAGGTCTAGATGTTTTAACTGG - Intronic
949633780 3:5959925-5959947 CCAGGACCAGATGGTTTCATGGG - Intergenic
949671853 3:6406606-6406628 CTTGGCCTAGATGGTTTCACTGG + Intergenic
949678668 3:6487520-6487542 CCAGGACCAGATGGATTCACAGG - Intergenic
950705909 3:14781459-14781481 CCAGGTCCATATGGTTTTACAGG + Intergenic
951368096 3:21809922-21809944 CTAGGCATAAATTGTTTCACTGG + Intronic
951371059 3:21848767-21848789 CCAGGACCATATGGCTTCACTGG + Intronic
952223079 3:31344352-31344374 CCAAGTCCAGATGGTTTCACAGG + Intergenic
952372675 3:32738370-32738392 CCTAGGCTAGATGGTTTCACTGG - Intronic
952564927 3:34643585-34643607 CCAGGTCAAGATGGTTTTATTGG + Intergenic
952735416 3:36686202-36686224 CCAGGCCTAGATGGGTTCACTGG + Intergenic
952867999 3:37870151-37870173 CCAGGCCCAGATGATTTCACTGG - Intronic
953203837 3:40802607-40802629 CCAGGCCCAGATGGTTTCTCAGG + Intergenic
953831972 3:46306904-46306926 CCAGGTCTATATGGTTTCACTGG - Intergenic
954605459 3:51905956-51905978 CCAGGAGAAAATGGTTTCATGGG + Intergenic
954805418 3:53217098-53217120 CCAGACCTAGATGGCTTCACTGG + Intergenic
955242589 3:57192250-57192272 CCAGGCCCAGATGGTTTCACTGG - Intergenic
955602718 3:60664585-60664607 CTAGGACTACATTGTTTCACTGG - Intronic
955999930 3:64718511-64718533 CCAAGTTTAAATGGTATCATGGG - Intergenic
956339069 3:68200442-68200464 CCAGGCTTCAATGGGTTCACCGG - Intronic
956465192 3:69513434-69513456 CCAGGACCAGATGGCTTCACTGG + Intronic
956954579 3:74321922-74321944 CCAGGTCCAGATGGGTTCAATGG + Intronic
957778006 3:84780353-84780375 TCAGGTTTATATGGCTTCACTGG + Intergenic
957871606 3:86096474-86096496 CCAGGACCAGATGGATTCACAGG + Intergenic
958512788 3:95070108-95070130 CCAGGACCAAATGGCATCACTGG + Intergenic
959147124 3:102561456-102561478 CCAGGACCAAATGGTTTCATAGG - Intergenic
959253266 3:103975254-103975276 CCAGGACCAGATGGATTCACAGG + Intergenic
959290906 3:104472629-104472651 CTAAGGCTAGATGGTTTCACTGG + Intergenic
959456428 3:106568435-106568457 CCAGGCCCAGATGGGTTCACTGG + Intergenic
959536347 3:107489999-107490021 CTAGGTCCAGATGGTTTCACTGG + Intergenic
959727945 3:109565658-109565680 CCAGGCCCAAATGGTTTCACAGG - Intergenic
960630015 3:119720554-119720576 CCAGGCCTAAACAGTTTTACAGG + Intronic
960634705 3:119772434-119772456 CCAGGCCCAGATGGTTTCAGTGG + Intergenic
961331324 3:126142227-126142249 CCAGGGCTGAATGATTTCACTGG + Intronic
961341143 3:126220735-126220757 CCAGGACCAGATGGCTTCACTGG + Intergenic
961359735 3:126359478-126359500 CCAGGCCCAAATGGTTTTATAGG - Intergenic
961924799 3:130466977-130466999 CCAGGTATGGATGATTTCACTGG + Intronic
962447283 3:135478357-135478379 CCAGGACCATATGGCTTCACTGG - Intergenic
962516612 3:136157874-136157896 CCAGGGCTAAATGCCTTCACTGG + Intronic
962673404 3:137732733-137732755 CCAGGACCACATGGATTCACAGG - Intergenic
963146067 3:141996155-141996177 CCAGGTCTTAAAATTTTCACTGG + Intronic
963640528 3:147856791-147856813 CCAGGACCAGATGGATTCACTGG + Intergenic
963845685 3:150154597-150154619 ACAGGTCCATATGGGTTCACTGG + Intergenic
964743562 3:159990615-159990637 TCAGGTCCACATGGTTTCTCTGG + Intronic
965151050 3:164975191-164975213 TCAGGCCTAGATGGTTTCATTGG + Intergenic
965265745 3:166540380-166540402 CCAGGCCTTGATGGCTTCACTGG + Intergenic
965646398 3:170886247-170886269 CCAGGTCCAAATGGTTTCACAGG - Intergenic
966477257 3:180364215-180364237 CCAGGCCCAGATGGGTTCACTGG - Intergenic
966545747 3:181145582-181145604 CCAGGTCCAAATGAGTTCACTGG + Intergenic
966755331 3:183364885-183364907 CAAGGCCCAGATGGTTTCACAGG + Intronic
967376270 3:188805299-188805321 CCAGGTCCAGATGGCTTCACTGG - Intronic
1202747202 3_GL000221v1_random:115213-115235 CCAGATCTAAAGAATTTCACTGG - Intergenic
968535071 4:1120619-1120641 CCAGGCCCAGATGGGTTCACTGG + Intergenic
968537139 4:1140066-1140088 CCAGGACCAGATGGCTTCACTGG + Intergenic
969337271 4:6519020-6519042 CCAGGCCCAGATGGGTTCACTGG + Intronic
969692904 4:8715513-8715535 CCAGATCCAGATGGTTTCACTGG - Intergenic
969833809 4:9821841-9821863 CCAGGTCCACATGGTTTCAGTGG - Intronic
970336342 4:15048323-15048345 CCAGGCCTAGATGGCTTTACTGG - Intronic
970490244 4:16564757-16564779 CCAGGCCCAGATGGTTTCACAGG + Intronic
970957476 4:21831688-21831710 CCAGGACCTGATGGTTTCACTGG + Intronic
971445714 4:26745855-26745877 TCAGGCCTAGATGGCTTCACTGG + Intronic
971584059 4:28382186-28382208 CCAGATCTATATGAATTCACAGG - Intronic
971730505 4:30372926-30372948 CCAGGATCAAATGGCTTCACTGG + Intergenic
971831883 4:31705111-31705133 CCAGGAGAAAATGGTTTCATGGG - Intergenic
972186649 4:36536411-36536433 CCAGTCCCAGATGGTTTCACTGG - Intergenic
972443781 4:39123247-39123269 CCAGGACTAAATGAGTTTACTGG + Intronic
972912824 4:43839268-43839290 CCAGGTCTGGATGTTTTCACTGG - Intergenic
972915810 4:43878203-43878225 CCAGGTTCTGATGGTTTCACTGG + Intergenic
973013566 4:45107725-45107747 CCAGGACCAGATGGATTCACAGG - Intergenic
973874091 4:55197662-55197684 CCAGGCACAGATGGTTTCACTGG + Intergenic
973904520 4:55514995-55515017 CCAGGTCCAGATGGGTTCATTGG - Intronic
974217466 4:58869180-58869202 CCAGGTCCACATGGTTTTACTGG + Intergenic
974524655 4:63033499-63033521 CCATGCCCAAATGATTTCACTGG + Intergenic
974599568 4:64059901-64059923 TCATGTCTAGATGTTTTCACAGG + Intergenic
974795435 4:66742822-66742844 CCAGGCCAAAATGGCTTTACTGG + Intergenic
974899129 4:67975006-67975028 TCAGGCATGAATGGTTTCACTGG - Intergenic
975211778 4:71709509-71709531 CCAGCCCCAGATGGTTTCACTGG - Intergenic
975227836 4:71895006-71895028 CCAGGACCAGATGGATTCACAGG + Intergenic
975534426 4:75434429-75434451 CCAGGCCCAGATGGTTTCACTGG + Intergenic
976702904 4:87990443-87990465 CCAGGCCCAGATGGTTTCACCGG + Intergenic
977025883 4:91819290-91819312 CCAGGACTAGATGGGTTCACTGG - Intergenic
977326180 4:95577416-95577438 CCAGGACCAGATGGATTCACAGG - Intergenic
977414068 4:96708149-96708171 TCATGACTACATGGTTTCACTGG - Intergenic
977418861 4:96770712-96770734 CTAGGTCATAATGGCTTCACTGG - Intergenic
978085855 4:104652984-104653006 CCAGTTCCAGATGGTTACACTGG + Intergenic
978406738 4:108387441-108387463 CCAAATCCAGATGGTTTCACTGG + Intergenic
979098741 4:116587690-116587712 CCAGATCCAGATGATTTCACTGG - Intergenic
979420048 4:120493099-120493121 CCAGGTCTAAATGATTTCACTGG - Intergenic
980521231 4:133937515-133937537 CCAGAGCTACTTGGTTTCACTGG - Intergenic
981060842 4:140423633-140423655 CCAGGACTAGGTGGCTTCACTGG - Intronic
981171467 4:141629422-141629444 CCAGGACCAGATGGTTTCAATGG - Intergenic
981241964 4:142488488-142488510 CCAGGTCAACAGGGCTTCACTGG - Intronic
981496150 4:145395599-145395621 CCAGGTCAAGATGATTTCACTGG + Intergenic
981555941 4:145993951-145993973 CCAGGACCATATGGATTCACTGG - Intergenic
982239661 4:153286435-153286457 CCAGGACCAGATGGCTTCACTGG - Intronic
982290140 4:153772453-153772475 TCAGGCCCAGATGGTTTCACTGG - Intergenic
982498569 4:156124521-156124543 CCAGGTCTAGATGGGTGCACTGG + Intergenic
982575536 4:157104665-157104687 CTAGGACCAGATGGTTTCACTGG - Intronic
982602085 4:157464884-157464906 CCAGGACCAGATGGTTTCATTGG + Intergenic
982928445 4:161370073-161370095 CCAGGCCAAAATGTTTTCAATGG - Intergenic
983342370 4:166479948-166479970 CCAGTTCTAGATTATTTCACAGG + Intergenic
983483088 4:168299826-168299848 CCAGGACTATATGGCTTCACAGG + Intronic
983498118 4:168467700-168467722 CTAGACCCAAATGGTTTCACAGG + Intronic
983599828 4:169514483-169514505 CTGGGCCTAGATGGTTTCACTGG - Intronic
983978909 4:173970266-173970288 CCAGGACAAAATGGTTTCACTGG - Intergenic
984130221 4:175865924-175865946 CTAGGTTCAAATGGTTTCAGTGG - Intronic
984147803 4:176085419-176085441 CCAGGCCCAGATCGTTTCACTGG - Intronic
984369429 4:178843248-178843270 CCAGGACCTGATGGTTTCACTGG - Intergenic
984831172 4:183975699-183975721 ACAGGTTTGGATGGTTTCACTGG + Intronic
985223702 4:187735997-187736019 CCAGGTCCAGATGGATTTACTGG + Intergenic
1202754580 4_GL000008v2_random:48209-48231 CCAGATCTAAAGAATTTCACTGG + Intergenic
985515209 5:340143-340165 CCAGGTCTAAATGGTTTCACTGG - Intronic
985565440 5:612995-613017 ACATGTCCATATGGTTTCACTGG - Intronic
986088436 5:4477532-4477554 CCATATTTAAATTGTTTCACAGG - Intergenic
986406483 5:7430237-7430259 CCAGGTCCAAATGGCTTCCCTGG + Intronic
986513700 5:8538123-8538145 TCAGGCTTAGATGGTTTCACTGG + Intergenic
988276992 5:29093356-29093378 CCAGGTTCGAATGGCTTCACTGG - Intergenic
988323898 5:29737544-29737566 CCAGGTCTAAAAGTCTTCCCTGG - Intergenic
988357359 5:30196106-30196128 TCAAGTTAAAATGGTTTCACGGG - Intergenic
988384467 5:30543036-30543058 CCAGGACCCAATGGTTTCACTGG + Intergenic
988490405 5:31700811-31700833 CCAGGTCTGAAAGGTTTCCTGGG - Intronic
988819757 5:34870489-34870511 CCAGGCCCAGATGATTTCACCGG + Intronic
989117759 5:37972323-37972345 CCAGGCCCAGAGGGTTTCACTGG - Intergenic
990202191 5:53388675-53388697 TCAGGTCCAGATGGTTTCCCTGG + Intergenic
990919935 5:60951802-60951824 CCAGGACCAGATGGCTTCACAGG - Intronic
992852995 5:80829841-80829863 CCAGGCACAAATGGCTTCACTGG - Intronic
992991011 5:82283457-82283479 CCAGGCCCCAATGGTTTTACAGG - Intronic
993349369 5:86828927-86828949 TTAGGTCTAGATGGCTTCACAGG - Intergenic
993473817 5:88339753-88339775 CCAGTACTCAATGGCTTCACTGG + Intergenic
993655033 5:90567420-90567442 CCAGGACCAGATGGTTTCACTGG - Intronic
994524167 5:100882644-100882666 CTAGGAGAAAATGGTTTCACGGG + Intronic
994793435 5:104262160-104262182 CCAGGTTTAGATGGATTCATGGG + Intergenic
994834082 5:104826991-104827013 CCAGGCCCAGATGGTTTTACAGG - Intergenic
994917726 5:106001653-106001675 CCAGGACCAGATGGATTCACAGG - Intergenic
995080389 5:108044744-108044766 CCAGGTCCACATAGTTTCACTGG - Intronic
995656344 5:114431199-114431221 CCAGGACCACATGGGTTCACTGG - Intronic
995824970 5:116285971-116285993 CCAGGACCAGATGGCTTCACTGG - Intronic
996116522 5:119626316-119626338 CCATGACTACATGGTTTCACTGG - Intronic
996320956 5:122216013-122216035 CCAGGACTAGATAGATTCACTGG + Intergenic
996426956 5:123323646-123323668 CCAGGACCAGATGGCTTCACTGG - Intergenic
996963730 5:129282734-129282756 CCAGGACCAGATGGATTCACAGG + Intergenic
996971182 5:129370232-129370254 CAAGGTTCAAATGGCTTCACTGG + Intergenic
997190244 5:131926641-131926663 CCAGGACCAGATGGCTTCACTGG - Intronic
997621090 5:135296505-135296527 CCAGGCCCAGATGGCTTCACTGG - Intronic
997621395 5:135299179-135299201 CCAGGCCCAGATGGCTTCACTGG + Intronic
998050808 5:139032669-139032691 CCAGGTTCAGATAGTTTCACTGG - Intronic
998255446 5:140583475-140583497 CCAGGACCAAATGGCTTCAATGG + Intronic
999027907 5:148256466-148256488 CCAGGACTAGATGGATTCACAGG - Intergenic
999235419 5:150088314-150088336 CCAGGACCAGATGGCTTCACTGG + Intronic
999541451 5:152577804-152577826 CCAGGCCCAAATGGTTTCACTGG - Intergenic
999580050 5:153028324-153028346 CCAGGCCCAGATGGATTCACTGG + Intergenic
999605668 5:153312755-153312777 CCAAGCCTAAATGGCTTTACTGG - Intergenic
1000442356 5:161279106-161279128 CCATGTCCAGATGGTTTCATTGG - Intergenic
1000495561 5:161979140-161979162 CCAGGCACAAATGGTTTCACTGG + Intergenic
1001161224 5:169316467-169316489 CCAAGCCTAGATGGTTTCACTGG + Intergenic
1001538459 5:172518001-172518023 CCAAGTCCAGATGGGTTCACTGG + Intergenic
1001808014 5:174605185-174605207 CCAGGACCACATGGTTTCACTGG - Intergenic
1001852137 5:174977948-174977970 CCAGGACCAGATGGCTTCACTGG + Intergenic
1001887535 5:175308858-175308880 CCAGGCCCAGATGGCTTCACTGG + Intergenic
1002448541 5:179306009-179306031 CCAGGTCTAGACGGTTTTACTGG + Intronic
1002568029 5:180124259-180124281 CCAAGCCTAGATGGTTCCACTGG + Intronic
1003932408 6:10937943-10937965 CCAGGGCCAGACGGTTTCACTGG + Intronic
1003983644 6:11413770-11413792 CCAGGTGCAAGTGGCTTCACTGG - Intergenic
1004580758 6:16949261-16949283 CCAGGTCAAAATAGTCTCTCAGG + Intergenic
1004885308 6:20045353-20045375 CTAGGTGTAAATGGCATCACTGG + Intergenic
1005171102 6:22985809-22985831 TCAGGCCTAGATGGTTTCATTGG - Intergenic
1005243963 6:23860770-23860792 CCAAGCCCAGATGGTTTCACTGG + Intergenic
1005380861 6:25232716-25232738 CCAGATGGAAATGGTTTCCCAGG - Intergenic
1005608612 6:27501072-27501094 CCAGGCCTAGATGGCTTCATTGG + Intergenic
1006529077 6:34634807-34634829 CCAGGTTTGAATGGTTTTGCTGG + Intronic
1006586066 6:35113847-35113869 CCAGTACTACATGGCTTCACTGG + Intergenic
1007145951 6:39631872-39631894 TTAGGCCTAGATGGTTTCACTGG - Intronic
1007193972 6:40043671-40043693 CCAGGACCAGATGGCTTCACTGG + Intergenic
1007334620 6:41145128-41145150 CCAGGCCCAGATGGCTTCACTGG - Intergenic
1007516446 6:42416778-42416800 CCAGGACCAGATGGTTTCACAGG - Intronic
1007886090 6:45232308-45232330 CCAGCTGTAAATGGCTTCAGTGG + Intronic
1008235545 6:49043385-49043407 CCAGGCCCAGATGGATTCACTGG - Intergenic
1008930766 6:56936947-56936969 CCAGCTCCAAATGGGTTCACTGG + Intronic
1009219413 6:60965600-60965622 CCAGGACCAGATGGATTCACAGG + Intergenic
1009242419 6:61198592-61198614 CAAGGGAAAAATGGTTTCACGGG + Intergenic
1009416777 6:63424358-63424380 CCAGGCCTAGATATTTTCACTGG + Intergenic
1009709847 6:67303185-67303207 CCAGGGCTTAATGGTTTCATTGG - Intergenic
1010137149 6:72568901-72568923 CCAGGCCCAAATGGGTTCACTGG + Intergenic
1010347760 6:74832253-74832275 CCAGGTCTAGATGGTTTCATAGG - Intergenic
1010719445 6:79265524-79265546 CCAGGACCAGATGGTTTTACTGG + Intergenic
1010803638 6:80208806-80208828 CCAGGCCTAAATGGCTTTATTGG + Intronic
1010933079 6:81827249-81827271 CCAGGACCAATTGGCTTCACTGG + Intergenic
1011505569 6:88038925-88038947 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1011924940 6:92630759-92630781 CCAGATTTAAATGGGTTTACTGG - Intergenic
1013114503 6:107091684-107091706 CCAGGCCCAAATGGGTTCAAAGG + Intronic
1013199973 6:107884584-107884606 CCAGGCCCAGATGGTTTCCCTGG + Intronic
1013483355 6:110571163-110571185 CTAGGCCCAAATGTTTTCACTGG - Intergenic
1014122683 6:117743991-117744013 CCAGGACCAAATGCTTTCACTGG + Intergenic
1014228337 6:118873658-118873680 CCAGGACCAGATGGGTTCACTGG + Intronic
1014394701 6:120911959-120911981 TCAGGCATAGATGGTTTCACTGG - Intergenic
1014605693 6:123471591-123471613 CCAGGCCAAAATGTTTCCACTGG + Intronic
1014679830 6:124414611-124414633 CCAAGTCCAAATGGCTTCACTGG - Intronic
1014716942 6:124877236-124877258 CCAGGTCCAAATGGTTTCACTGG - Intergenic
1015529537 6:134207611-134207633 CCAGGACTAAAAGGCTTCCCAGG - Intronic
1015686570 6:135869996-135870018 CCCTGTCTACATGGTTTCAGTGG - Intronic
1016291514 6:142533422-142533444 CCGGATCCAAATGGTTTCCCTGG - Intergenic
1017367519 6:153661835-153661857 CCAGGACTAGATGGCTTCACTGG - Intergenic
1017803138 6:157917012-157917034 CCAGGTCCAGATGATTTCAGTGG - Intronic
1017994201 6:159517851-159517873 CCAGGACCAGATGGATTCACAGG - Intergenic
1018097521 6:160403429-160403451 CCAGGCCCAGATGGGTTCACAGG + Intronic
1018408853 6:163520025-163520047 ACAGCTCTAAAATGTTTCACTGG - Intronic
1018665321 6:166131059-166131081 CCAGGGCCAAATGGCTTTACTGG + Intergenic
1019125275 6:169835438-169835460 CCAGGTCCAGATGATCTCACTGG + Intergenic
1019336881 7:488826-488848 CCAGGACCAGATGGCTTCACTGG + Intergenic
1019832056 7:3340893-3340915 CTGGGTCCAGATGGTTTCACTGG + Intronic
1020012166 7:4811817-4811839 CAAGGTCCAGATGGTTTCATTGG - Intronic
1020351488 7:7224426-7224448 CCAGGTCCAGATGGTTTTACTGG - Intronic
1021338332 7:19432349-19432371 CCAGGCCTAGATAGTTTCACTGG + Intergenic
1021357614 7:19671480-19671502 CCAGGCCCAGTTGGTTTCACTGG + Intergenic
1021548776 7:21846812-21846834 CCAGGTCCAGATGATTTCACTGG - Intronic
1021973889 7:25992346-25992368 CCAGGCCTAGATGGCTTCATTGG + Intergenic
1022058511 7:26767078-26767100 CCAGGACCAAATGGATTCACAGG - Intronic
1022117092 7:27270693-27270715 CCAGGTCTGTATGGATTCACTGG - Intergenic
1022686157 7:32598818-32598840 CCAGGACCAGATGGATTCACAGG + Intergenic
1022938723 7:35209294-35209316 CTAGGTCCAGATGGTTTCACTGG - Intronic
1023213012 7:37828957-37828979 GCAGGTTTAAATAGTTTTACTGG + Intronic
1023524781 7:41089206-41089228 CCAGGCCAAGATGGGTTCACTGG - Intergenic
1023977642 7:45042825-45042847 TTAGGCCCAAATGGTTTCACTGG + Intronic
1024002280 7:45198388-45198410 CCAGAGCCAGATGGTTTCACTGG + Intergenic
1024019739 7:45356565-45356587 CCAGACCCAGATGGTTTCACTGG + Intergenic
1024050230 7:45616211-45616233 CCAGGCCCAGATGGTTTCACTGG + Intronic
1024052407 7:45635050-45635072 TCAGGTCCAGATGGATTCACTGG - Intronic
1024203949 7:47136749-47136771 CCAGGTCCATATGGCTTTACTGG - Intergenic
1024320178 7:48058306-48058328 CCAGGACATAATGGCTTCACTGG - Intronic
1024369816 7:48568715-48568737 CCACTACCAAATGGTTTCACTGG - Intronic
1024480998 7:49863074-49863096 TCAGGACCAGATGGTTTCACTGG - Intronic
1024872544 7:53982842-53982864 CCAGGACCAGATGGCTTCACTGG - Intergenic
1024941846 7:54771332-54771354 CCAGGCCCAAATGTCTTCACTGG + Intergenic
1025922948 7:65931343-65931365 GCAGGTCCAGATGGTTTCACTGG - Intronic
1026549388 7:71354803-71354825 TCAGGCCCAGATGGTTTCACAGG - Intronic
1026908099 7:74074943-74074965 CCAGGACCAGATGGCTTCACTGG + Intergenic
1027492158 7:78841740-78841762 CCAGGTTTAAATGGTTATCCGGG + Intronic
1028152950 7:87396031-87396053 CCAGATGTACATGATTTCACAGG + Intronic
1028164811 7:87526228-87526250 CCAGATGTACATGATTTCACAGG - Intronic
1028192784 7:87871816-87871838 CCAGGTCTGGATAGCTTCACTGG - Intronic
1028696655 7:93721368-93721390 CCAGGCCCAGGTGGTTTCACTGG - Intronic
1028716805 7:93980162-93980184 CCAGGACCAGATGGCTTCACTGG + Intronic
1028730233 7:94139099-94139121 CCAGGTCCAAAAGGCTCCACAGG - Intergenic
1029038198 7:97544835-97544857 CCAGGTATAGATGGTTTCACTGG + Intergenic
1029453830 7:100657102-100657124 CAAGGTCTAAATGGAATCACCGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030174535 7:106638096-106638118 CCAGGCCCAGATGGTTTCACTGG + Intergenic
1030180328 7:106700870-106700892 CCAGGCCTAGATGGGTTTACTGG - Intergenic
1030239835 7:107310177-107310199 CCAAGTCTAACTGGTATCACTGG - Intronic
1030367986 7:108668380-108668402 CCAAGTCTATTTGGTTTGACAGG - Intergenic
1030500479 7:110353389-110353411 CCAGGACTGGATGGATTCACAGG - Intergenic
1030510361 7:110475739-110475761 CCAGGACCAGATGGATTCACAGG + Intergenic
1030585463 7:111413244-111413266 CCTGGACCAGATGGTTTCACTGG + Intronic
1030812756 7:113994961-113994983 CCAGGACCAGATGGCTTCACTGG + Intronic
1031092476 7:117376330-117376352 CCAGGTCCAGATGGTTTCACTGG + Intronic
1031112997 7:117634102-117634124 CCAGGTCCAGATGGGTTCACTGG - Intronic
1031130023 7:117822008-117822030 TCAGGCCTAGATGGTTTCCCTGG - Intronic
1031284141 7:119843017-119843039 GCAGGTAAAAATGGTTTCATGGG + Intergenic
1031300287 7:120055780-120055802 CCAGGTTTAAATGGGTTCGCTGG + Intergenic
1031433982 7:121710070-121710092 CCAGGACCAGATGGATTCACAGG - Intergenic
1031879767 7:127184046-127184068 CCAGGCTCAAATGGCTTCACTGG + Intronic
1032106094 7:129031577-129031599 CCAGGACCAAATGGCTTTACTGG + Intronic
1032371564 7:131358640-131358662 CCAGGCCCAGATGGTTTCACTGG - Intronic
1032860298 7:135871910-135871932 CCAGGCCCATATGGTTTTACAGG - Intergenic
1032928660 7:136639290-136639312 CCAGGTACAACTGGTTTCAGAGG - Intergenic
1033052200 7:138015637-138015659 CCAGGTCCAAATGGTTCCATAGG - Intronic
1033487025 7:141801051-141801073 CCAGGACCAGATGGCTTCACTGG + Intergenic
1033679135 7:143575779-143575801 CTAGGTTTAGATGGTTTCACTGG + Intergenic
1033692702 7:143753675-143753697 CTAGGTTTAGATGGTTTCACTGG - Intergenic
1033817352 7:145089830-145089852 CCAGGTCTGAATGGCTTTGCTGG - Intergenic
1033847827 7:145456214-145456236 CCAGGTCCATATGGTTGCTCTGG + Intergenic
1034363092 7:150519704-150519726 CCAGGTATAGATGGTTTCACAGG - Intronic
1035091173 7:156312566-156312588 CCAGGTCTAGATGGCTTCATGGG - Intergenic
1035277937 7:157759101-157759123 GCAGGTCTGAAGGGCTTCACAGG - Intronic
1035646711 8:1228341-1228363 CCAGGTTCAGATGGTCTCACTGG + Intergenic
1035956161 8:4082348-4082370 ACAGGCCCAGATGGTTTCACTGG + Intronic
1035988443 8:4460805-4460827 CCAGGCTCAAATGGCTTCACTGG + Intronic
1036291252 8:7493486-7493508 CCAGGGCCAAATGGCTCCACTGG + Intergenic
1036330237 8:7818050-7818072 CCAGGGCCAAATGGCTCCACTGG - Intergenic
1036383602 8:8258286-8258308 TCAGGCCTACATGGCTTCACTGG - Intergenic
1037531636 8:19781285-19781307 CCAGGACCACATGGGTTCACTGG + Intergenic
1037699279 8:21258922-21258944 CCAAGCCTGGATGGTTTCACAGG + Intergenic
1038171563 8:25138918-25138940 CCAGGCCTAAATAGCTTTACTGG + Intergenic
1038339400 8:26672020-26672042 CTAGGTCCAAATGGTTTCAATGG - Intergenic
1038371580 8:26998347-26998369 CCAGGCCTAGATGGCTTCATTGG - Intergenic
1038509842 8:28122407-28122429 CCAGCCCTAGATAGTTTCACTGG - Intronic
1038582562 8:28762092-28762114 CCAGGCCTAGATGGTTTCCCTGG - Intergenic
1038656500 8:29457354-29457376 CCAGGCCTAAATAGTTTTATTGG + Intergenic
1038752577 8:30310351-30310373 CCAGGCCCAAATGGGTTCACTGG - Intergenic
1038806329 8:30795689-30795711 CCAGGTGTAAATAGTTTTATAGG - Intronic
1038934722 8:32236245-32236267 CCAGGGCTAAATTGTCTCAAAGG - Intronic
1039497480 8:37991864-37991886 GCAGGCCTGGATGGTTTCACTGG - Intergenic
1039671094 8:39599465-39599487 CCAGGCCCAGATGGATTCACTGG - Intronic
1039802096 8:40967363-40967385 CCAGGACCAGATGGATTCACAGG + Intergenic
1040455052 8:47589180-47589202 CCAGGTCCAGATACTTTCACTGG - Intronic
1040624236 8:49127665-49127687 TCAGGTCCAGATGGGTTCACTGG - Intergenic
1040857792 8:51968180-51968202 TCAGGCCCAGATGGTTTCACTGG + Intergenic
1040904701 8:52455058-52455080 CCAGGTTCAGATGGTTTCACTGG + Intronic
1040975203 8:53184532-53184554 TCAAGACTAAATGGTTTCACTGG - Intergenic
1041069624 8:54114270-54114292 TCAGGCCTAAATGGCTTTACTGG - Intergenic
1041185191 8:55292265-55292287 CCAGGTCTAAATGGTTTTATTGG - Intronic
1041563923 8:59253563-59253585 CTAGGTCTAAATGGGTTCACTGG - Intergenic
1041771507 8:61477409-61477431 CCAGGACCAGATGGATTCACAGG - Intronic
1042107477 8:65344278-65344300 CCAGGCCCAGATAGTTTCACTGG + Intergenic
1043119049 8:76299409-76299431 CCAGGCCTATATGGATTCACAGG - Intergenic
1043234856 8:77850820-77850842 CCAGGCTTAGATGGGTTCACTGG - Intergenic
1043325451 8:79045254-79045276 TCAGGTCTAGACGGTTTCATTGG + Intergenic
1043412865 8:80017631-80017653 CCAGGTCCATATGGGTTCACTGG + Intronic
1044028234 8:87200788-87200810 CCAGTCCTAGATGGTTTCACTGG + Intronic
1044168947 8:89024905-89024927 CCAGAACTAGATGGATTCACAGG - Intergenic
1044368059 8:91373834-91373856 CCAGGACCAGATGGATTCACAGG - Intronic
1044789261 8:95829998-95830020 CCAGGCCCAGATGGGTTCACTGG + Intergenic
1045209093 8:100076565-100076587 CCAGGCCCAGATGGCTTCACTGG - Intronic
1045400701 8:101814042-101814064 CCAGGCCCAAATAGGTTCACTGG + Intronic
1046008850 8:108520798-108520820 CCAGAACCAAATGGCTTCACTGG - Intergenic
1046478829 8:114786041-114786063 CCAAGTCCAAAGAGTTTCACAGG - Intergenic
1046517317 8:115280209-115280231 CCAGGACTAGATGTCTTCACTGG + Intergenic
1046608617 8:116398978-116399000 TCAGGCCCAGATGGTTTCACTGG + Intergenic
1046983961 8:120367167-120367189 ACAGGTCTAACTGGTATCAAAGG + Exonic
1047344111 8:124010572-124010594 CCAGACCTAATTGTTTTCACAGG + Exonic
1047388804 8:124432985-124433007 CCAGGACTAGAGGGCTTCACTGG + Intergenic
1047392216 8:124461648-124461670 CCAGGTCCAAATAGCTTCATTGG - Intronic
1047675385 8:127196070-127196092 CCATGTTAAAATGGTTTCAATGG + Intergenic
1047935445 8:129772654-129772676 CCATGACCAAATGCTTTCACTGG + Intronic
1048463935 8:134646929-134646951 CCAGGACCAGGTGGTTTCACTGG + Intronic
1048464034 8:134648669-134648691 CCAGGACCAAATAGTCTCACTGG + Intronic
1049033444 8:140054930-140054952 CCAGGACCAGATGGCTTCACTGG + Intronic
1049561272 8:143311999-143312021 CCAGGCCTAGATGGTTTCACTGG + Intronic
1050218385 9:3356508-3356530 CCAGGCCCTGATGGTTTCACTGG + Intronic
1050342163 9:4651390-4651412 CCAGGTCCAGATGGCTTCACTGG + Intronic
1050440458 9:5656319-5656341 CCAGGACTAAATGTGTTCATAGG - Intronic
1050499002 9:6274584-6274606 CCAGGCCTAAATGACTTCACAGG + Intergenic
1050847179 9:10236304-10236326 CCTGGTCTAAATGACTTAACAGG - Intronic
1051019748 9:12528370-12528392 CTAGGTCCAGATGGCTTCACTGG - Intergenic
1051304025 9:15688253-15688275 CCAGGCCTAGATAGGTTCACTGG + Intronic
1051443128 9:17108858-17108880 CCAGGACCAGATGGCTTCACTGG - Intergenic
1051455718 9:17255768-17255790 ATGGGTCTAGATGGTTTCACTGG - Intronic
1051840336 9:21389913-21389935 CCAGGGACACATGGTTTCACTGG + Intergenic
1051843571 9:21426220-21426242 CCAGGTCCAGATGGATTTACAGG - Intronic
1051846822 9:21460764-21460786 CCAGGACCAAATGGCTTCACTGG - Intergenic
1051916345 9:22212561-22212583 CCAGATCTAAATGGTCTCTATGG - Intergenic
1052402721 9:28020653-28020675 CCAGGCCCAGATGGTTCCACTGG - Intronic
1052527749 9:29641122-29641144 TCAGGCCCATATGGTTTCACTGG + Intergenic
1053108040 9:35430195-35430217 CCAGGACCAGATGGCTTCACAGG + Intergenic
1053493434 9:38529365-38529387 CCAGGCTCAGATGGTTTCACTGG + Intergenic
1053520927 9:38778782-38778804 CCAGACCCAAATGATTTCACTGG + Intergenic
1054193083 9:62002775-62002797 CCAGACCCAAATGATTTCACTGG + Intergenic
1054645325 9:67585916-67585938 CCAGACCCAAATGATTTCACTGG - Intergenic
1055049865 9:71968388-71968410 CCAGGCCCAAATGGCTTTACTGG - Intronic
1055378457 9:75678280-75678302 CTGGGTCTAGATGGGTTCACTGG + Intergenic
1056033322 9:82577366-82577388 CCAGGACCAGATGATTTCACTGG + Intergenic
1056192802 9:84200675-84200697 CCAGGACAAGATGGATTCACTGG + Intergenic
1056444415 9:86652003-86652025 CCAGGTCCAGGTGGTTTCATTGG - Intergenic
1057066996 9:92063399-92063421 CCAGGCCCAGATGGTTTCATGGG + Intronic
1057223821 9:93274802-93274824 CCAGGCCAAAATAGTTGCACTGG + Intronic
1057451450 9:95164893-95164915 CCAGGACCAGATGGCTTCACTGG - Intronic
1057538220 9:95937448-95937470 CCAGGCCCAGATGATTTCACTGG - Intronic
1057674174 9:97124198-97124220 CCAGGCTCAGATGGTTTCACTGG + Intergenic
1057795529 9:98154284-98154306 CTAGGCCTAGATGGTTTTACAGG - Intronic
1057876904 9:98764003-98764025 GCAGGCCCAAATGGTTTCCCTGG + Intronic
1057993131 9:99794099-99794121 CCAGGTCCATATGGTTTCTTTGG - Intergenic
1058030854 9:100196094-100196116 GCAAGACTAGATGGTTTCACTGG - Intronic
1058823383 9:108753518-108753540 TCAGGTCTAGATGATTTCATAGG + Intergenic
1058904501 9:109471006-109471028 CCAGGGCAAAAGGGTTACACAGG - Intronic
1059016632 9:110524177-110524199 CCAGGTCCAAATGATTTCAGTGG + Intronic
1059413597 9:114149624-114149646 CCAGGTCTGAAAAGTCTCACGGG + Intergenic
1060076534 9:120595505-120595527 CCAGGTCCAGATAGCTTCACTGG - Intergenic
1060320730 9:122557820-122557842 CCAGGCCTAGATGGGATCACTGG - Intergenic
1061998535 9:134203526-134203548 TCAGGTCTAGATGACTTCACCGG - Intergenic
1062019631 9:134312376-134312398 CCAGGCCCAGATGGTTTCACTGG - Intergenic
1062642579 9:137527862-137527884 CCAGATCTAGATGACTTCACTGG - Intronic
1203715838 Un_KI270742v1:145303-145325 CCAGATCTAAAGAATTTCACTGG - Intergenic
1203535375 Un_KI270743v1:32928-32950 CCAGATCTAAAGAATTTCACTGG + Intergenic
1186195063 X:7102088-7102110 CCAGGACCAGATGGCTTCACTGG + Intronic
1186710413 X:12189303-12189325 CCAGGCCCAGATGGGTTCACTGG + Intronic
1186975852 X:14904034-14904056 CCAGGCCCAGATGGCTTCACTGG + Intronic
1187465556 X:19524305-19524327 CCAAGTCTCAATGACTTCACTGG - Intergenic
1187517542 X:19986350-19986372 TCAGGCCCAGATGGTTTCACAGG + Intergenic
1187605512 X:20878121-20878143 CCAGGTCCAGATGGATTTACAGG + Intergenic
1187695868 X:21919361-21919383 CCAGGGCCAGATGGTTTCACAGG - Intergenic
1187762241 X:22600431-22600453 TCAGGTCCAGATGGGTTCACTGG - Intergenic
1187784975 X:22873563-22873585 TCAGGTTCAAATGGTTACACTGG + Intergenic
1188045277 X:25419008-25419030 CCAGGACCCAGTGGTTTCACTGG - Intergenic
1188202879 X:27314151-27314173 CCAGATCCAAATGGTTTCACTGG + Intergenic
1188261330 X:28028133-28028155 CCAGGACCAGATGGCTTCACTGG - Intergenic
1188787615 X:34367599-34367621 CCAGGACCAGATGGATTCACAGG + Intergenic
1188978329 X:36702809-36702831 CCAGGACCAGATGGATTCACAGG - Intergenic
1189029449 X:37435535-37435557 CCAGGTCAAAGTAGTTTGACAGG - Intronic
1189082057 X:37984516-37984538 CCAGGCCCAAATGGCTTCATTGG + Intronic
1189139775 X:38590527-38590549 CCAGGCCCAGATGGCTTCACTGG - Intronic
1189151388 X:38711331-38711353 CCAGGTCCAGATGACTTCACTGG + Intergenic
1189303382 X:39969174-39969196 CCAGGCCTTGATGGCTTCACGGG - Intergenic
1189502099 X:41571275-41571297 CCAGGTCAAGATGGCTTCACTGG - Intronic
1189579678 X:42392940-42392962 CTAGGGCTAGACGGTTTCACTGG + Intergenic
1189654546 X:43229204-43229226 CTAGGCCTAGACGGTTTCACTGG + Intergenic
1189667382 X:43371277-43371299 CCAGGCCCAGATGATTTCACTGG + Intergenic
1189671252 X:43411928-43411950 CCATGCCTAGATAGTTTCACTGG - Intergenic
1189930934 X:46009524-46009546 CCAGGCCTAGATGATTTCACTGG - Intergenic
1189996008 X:46638743-46638765 CCAGGCCCAGATGGTTTCACTGG + Intronic
1190024137 X:46907254-46907276 CCAGGTCCACATGGTTTCACTGG + Intergenic
1190079394 X:47343937-47343959 CCAAATCTAGATGGTTTCACTGG - Intergenic
1190140516 X:47839225-47839247 CCAGGCCCAGATGGCTTCACTGG - Intronic
1190341007 X:49295730-49295752 CCAGGTCCAGATGGTTTCACTGG - Intronic
1190402529 X:50052649-50052671 CCAGGCCCCCATGGTTTCACTGG - Intronic
1190419404 X:50213617-50213639 CCAGGCCCAGATGATTTCACTGG - Intronic
1190538298 X:51450777-51450799 CCAGGTCTAGATGGATTTACTGG - Intergenic
1190541756 X:51484476-51484498 CCAGTTCCAAATGGCTCCACAGG + Intergenic
1190605380 X:52136702-52136724 TCAGGCCCAGATGGTTTCACTGG + Intergenic
1190802272 X:53802197-53802219 CCAGAACTAGATGGCTTCACTGG + Intergenic
1190811243 X:53886163-53886185 CCAAGTCAAAATAGCTTCACTGG - Intergenic
1190933245 X:54968755-54968777 CCAGGTCCAGACGGTTTCACTGG + Intronic
1190934708 X:54987323-54987345 CCAGGATTAGATGGTTTCACTGG + Intronic
1191666742 X:63710323-63710345 TCAGGACTAGATGGCTTCACTGG + Intronic
1191694450 X:63975999-63976021 CCAGGTCCAGATGGGTTCACTGG + Intergenic
1191734963 X:64379162-64379184 TTAGGTCCAGATGGTTTCACTGG + Intronic
1191854966 X:65617316-65617338 CCAGGACCAGATGGATTCACAGG - Intronic
1192161195 X:68789221-68789243 CCCTGTGGAAATGGTTTCACTGG + Intergenic
1192198018 X:69044573-69044595 CTAGGCCCAAATGGTTTCACTGG - Intergenic
1192257610 X:69477137-69477159 ACAGGCCCAAATAGTTTCACTGG + Intergenic
1192310464 X:70008887-70008909 CCAGGCCCCAGTGGTTTCACTGG - Intronic
1192399393 X:70818974-70818996 CCAGTACTAAATGGCTTCTCTGG + Intronic
1192545937 X:72013927-72013949 CCAGGTCCAGATGGTTTCACTGG - Intergenic
1192607432 X:72533397-72533419 CCAGGCCCAGATGGCTTCACTGG + Intronic
1192862471 X:75090995-75091017 ACTGGTCCAAATGGTTTCACTGG + Intronic
1193330481 X:80230624-80230646 CCAGGACAAGATGGATTCACAGG - Intergenic
1193362614 X:80593932-80593954 CCAGGACCAGATGGATTCACAGG + Intergenic
1193521858 X:82540195-82540217 CCAGGCCCTAATGGTTTCATTGG - Intergenic
1193742075 X:85229195-85229217 CCAGGACCAAATGCCTTCACTGG + Intergenic
1193864031 X:86707364-86707386 CCATGTTCAAATGGGTTCACAGG + Intronic
1194331173 X:92584643-92584665 CCAGTTCTAGATGGCTTCTCAGG + Intronic
1194475296 X:94351133-94351155 TCAGGTACAGATGGTTTCACTGG + Intergenic
1194488727 X:94519780-94519802 CTAGGACTAGATGGTTTCACGGG + Intergenic
1194609232 X:96020442-96020464 CCAGGACTAAATGACTTCACTGG + Intergenic
1195097677 X:101520856-101520878 CCAGGACCAAACGGCTTCACTGG - Intronic
1195406341 X:104518230-104518252 CCAGGCCTAAATGGTTTTACTGG - Intergenic
1195634133 X:107094097-107094119 CCAGGTCCAAATGGCTTCATTGG + Intronic
1196022950 X:111009369-111009391 CCAGGTCTAAAAGATGGCACTGG + Intronic
1196072200 X:111538611-111538633 CCAGGTCTATATGGCTTCACTGG + Intergenic
1196359256 X:114833310-114833332 CCAGGACCAGATGGATTCACAGG - Intronic
1196535788 X:116841927-116841949 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1196822824 X:119716093-119716115 CCAGGACTAGATGGTATCACTGG + Intergenic
1196930614 X:120677702-120677724 CTAGGTCCAAGTGGTTTCACTGG - Intergenic
1197058695 X:122151473-122151495 CCAGGAACAAATGGCTTCACAGG + Intergenic
1197442202 X:126506178-126506200 CCAGGACTAGATGGCTTCACTGG - Intergenic
1197451067 X:126618956-126618978 CCAAGTCGAGATGGCTTCACTGG - Intergenic
1197547813 X:127848468-127848490 CCAGAACTAAATGGCTTCACTGG + Intergenic
1197644307 X:129001533-129001555 GCAAATTTAAATGGTTTCACTGG - Intergenic
1197672764 X:129296817-129296839 TCAGGTCCAGATTGTTTCACCGG + Intergenic
1197825424 X:130584987-130585009 TCATGTCTAAATGGCTCCACTGG + Intergenic
1198073103 X:133169038-133169060 CCAGGTCCAATGGGTTGCACAGG - Intergenic
1198180477 X:134203028-134203050 CCAGGCCCAGATCGTTTCACTGG - Intergenic
1198375797 X:136038649-136038671 CCAGGCTCAAATGGCTTCACTGG - Intronic
1198408050 X:136335475-136335497 CCAGGCCCACATGATTTCACTGG - Intronic
1198516032 X:137408176-137408198 CCAGGACCAGATGGCTTCACTGG - Intergenic
1198786442 X:140293565-140293587 CCAGGCCCACGTGGTTTCACTGG - Intergenic
1198817688 X:140609559-140609581 AGAGGTTTAATTGGTTTCACAGG - Intergenic
1198843497 X:140883916-140883938 CCAGGCTCAGATGGTTTCACTGG + Intergenic
1199014152 X:142792882-142792904 CCAGGACCAGATGGATTCACAGG - Intergenic
1199062099 X:143369342-143369364 TCAGATCTGGATGGTTTCACTGG + Intergenic
1199228026 X:145401947-145401969 CCAGGACAAGATGGCTTCACTGG + Intergenic
1199431798 X:147770011-147770033 TCAGGTCCAGATGGTTTTACTGG - Intergenic
1199702082 X:150388129-150388151 CCATACCTAGATGGTTTCACTGG - Intronic
1199702673 X:150395542-150395564 CCAGGCCTGGATGGGTTCACTGG - Intronic
1200315963 X:155133406-155133428 CCAGGACCAGATGGCTTCACTGG + Intronic
1200639874 Y:5703703-5703725 CCAGTTCTAGATGGCTTCTCAGG + Intronic