ID: 985517180

View in Genome Browser
Species Human (GRCh38)
Location 5:353089-353111
Sequence TTCTCCTAATAAGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985517180_985517191 21 Left 985517180 5:353089-353111 CCTGCTCTGGCTTATTAGGAGAA 0: 1
1: 0
2: 3
3: 10
4: 115
Right 985517191 5:353133-353155 CCCTTTGTGGGGCCCCAGAGTGG No data
985517180_985517185 9 Left 985517180 5:353089-353111 CCTGCTCTGGCTTATTAGGAGAA 0: 1
1: 0
2: 3
3: 10
4: 115
Right 985517185 5:353121-353143 GGCCCTCACTGCCCCTTTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 170
985517180_985517193 25 Left 985517180 5:353089-353111 CCTGCTCTGGCTTATTAGGAGAA 0: 1
1: 0
2: 3
3: 10
4: 115
Right 985517193 5:353137-353159 TTGTGGGGCCCCAGAGTGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 228
985517180_985517184 8 Left 985517180 5:353089-353111 CCTGCTCTGGCTTATTAGGAGAA 0: 1
1: 0
2: 3
3: 10
4: 115
Right 985517184 5:353120-353142 TGGCCCTCACTGCCCCTTTGTGG 0: 1
1: 0
2: 3
3: 21
4: 185
985517180_985517186 10 Left 985517180 5:353089-353111 CCTGCTCTGGCTTATTAGGAGAA 0: 1
1: 0
2: 3
3: 10
4: 115
Right 985517186 5:353122-353144 GCCCTCACTGCCCCTTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985517180 Original CRISPR TTCTCCTAATAAGCCAGAGC AGG (reversed) Intronic