ID: 985517181

View in Genome Browser
Species Human (GRCh38)
Location 5:353093-353115
Sequence CTCTGGCTTATTAGGAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985517169_985517181 16 Left 985517169 5:353054-353076 CCCCACAGGTGGCCCCTTTTTGT 0: 1
1: 0
2: 0
3: 19
4: 178
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125
985517177_985517181 2 Left 985517177 5:353068-353090 CCTTTTTGTGGGTAGAGCAGGCC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125
985517171_985517181 14 Left 985517171 5:353056-353078 CCACAGGTGGCCCCTTTTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 215
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125
985517170_985517181 15 Left 985517170 5:353055-353077 CCCACAGGTGGCCCCTTTTTGTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125
985517174_985517181 4 Left 985517174 5:353066-353088 CCCCTTTTTGTGGGTAGAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125
985517176_985517181 3 Left 985517176 5:353067-353089 CCCTTTTTGTGGGTAGAGCAGGC 0: 1
1: 0
2: 2
3: 10
4: 110
Right 985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG 0: 1
1: 0
2: 2
3: 14
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985517181 Original CRISPR CTCTGGCTTATTAGGAGAAT TGG Intronic
908796716 1:67837174-67837196 CTCTGGCTTATTACTGCAATAGG + Intergenic
912829816 1:112942490-112942512 TTCTGGCTTGTTAGGTGAAATGG + Intronic
916849251 1:168686369-168686391 CTCTGGCTGGTTAGGAGACAGGG - Intergenic
920797070 1:209149378-209149400 CTCTAGCTTATCAGAAAAATAGG - Intergenic
922414083 1:225404233-225404255 CTCTGGCTTCTGAGGGGAATTGG - Intronic
923956924 1:239032774-239032796 CTGGGACTTATTAGGGGAATTGG + Intergenic
1064296263 10:14081622-14081644 CTCTGGATTATTATGATTATTGG - Intronic
1068461202 10:57331324-57331346 CTCTGGTTTATTAGTAGTAAAGG + Intergenic
1069515176 10:69071744-69071766 CTCTGGCTTTGGAGAAGAATGGG - Intergenic
1077671530 11:4162106-4162128 CACTGGCTTATATTGAGAATGGG - Intergenic
1078884049 11:15482320-15482342 CCCTGGCTTATTAGGTAAAGTGG - Intergenic
1080044524 11:27795454-27795476 CTCTTACTTATTAGCATAATTGG - Intergenic
1080259544 11:30332614-30332636 CTCTGGTATATTAGGAGCAGAGG - Intronic
1084413138 11:69015355-69015377 CTCTGGCTGATGCTGAGAATGGG + Intergenic
1085187909 11:74592026-74592048 CTCTGGATTGTTAGGAGAAGAGG - Intronic
1085335154 11:75687838-75687860 CCCTGGCTAGTTAGGAGGATAGG + Intergenic
1087151315 11:94862059-94862081 CTCTGCCTTATTTGGAGTCTTGG + Intronic
1088874240 11:113920682-113920704 CTCTTACTTAATAGGATAATTGG - Intronic
1091199827 11:133768148-133768170 CTGTGTCATATTAGGTGAATTGG - Intergenic
1091937343 12:4444322-4444344 GTCTGGCTTTCTAGGAGAAGGGG - Intronic
1105681448 13:22731945-22731967 CACTGGCTTATTTGGAAACTGGG - Intergenic
1107738230 13:43420454-43420476 ATCTGGCTTCTAAGGAGAATGGG + Intronic
1108219964 13:48223579-48223601 CTCTGGCTTATTTTCAGAAAAGG - Intergenic
1110265062 13:73528378-73528400 CTCTGGCTTTTTAAGACAATTGG - Intergenic
1110867500 13:80412660-80412682 CTGTAGCTTATTAATAGAATGGG + Intergenic
1111635619 13:90899921-90899943 CACTCACTTATTAAGAGAATAGG - Intergenic
1114828137 14:26106245-26106267 CTTTGGCTTCTTAGGAGGAAGGG - Intergenic
1117725630 14:58670265-58670287 ATCTGGATGATTAGGAGAGTGGG + Intergenic
1121017848 14:90559215-90559237 TTCTGGCTTCTGAGGAGACTTGG - Intronic
1123999656 15:25744673-25744695 GCCTGGCTTATTAGCAGATTTGG + Intronic
1126141161 15:45440213-45440235 CTATTGCTTATTTGGAGAGTGGG + Intronic
1128530062 15:68438849-68438871 CTCTGGTGTATTTGGAGAAAGGG + Intergenic
1131026485 15:89146457-89146479 ATCTGGCTTACTAAGAGAATTGG - Intronic
1137629268 16:49930789-49930811 CTCTTGCTTCTTTGGAGAAAAGG - Intergenic
1138556860 16:57775878-57775900 CTCTGGCTGATGAGGAGCCTGGG - Intronic
1140920004 16:79528597-79528619 CTGTGTTTTATTAAGAGAATGGG - Intergenic
1151013102 17:70524687-70524709 CTCTGGATTATTAAGATAATAGG + Intergenic
1153394063 18:4597902-4597924 CTCTGGGTTATGATGAGAAAGGG + Intergenic
1153552943 18:6281551-6281573 TTATGGCTTATTAGGGTAATTGG - Intronic
1157535856 18:48456936-48456958 CGCTGGCTCATTAGGGGAAAGGG + Intergenic
1158191402 18:54832630-54832652 CTCTGGCTTATTCGGACATTTGG + Intronic
1159234049 18:65648107-65648129 CTCTGGCTGATGAGGAGAAGAGG + Intergenic
1159884791 18:73893654-73893676 CTCTGGCTTTTTAGAAGTGTGGG + Intergenic
1160197510 18:76768388-76768410 CTCTGTCTTCTTTGGAGAACTGG + Intergenic
1164428515 19:28166486-28166508 CTCTGGATGATTTGGAGAAGGGG - Intergenic
1164533310 19:29064520-29064542 TTCTGGCTTTTAAGGAGAGTAGG - Intergenic
1168549899 19:57284083-57284105 CTCTGACATATTAGAGGAATGGG - Intronic
927131480 2:20064157-20064179 CTCTAGCTTGTTAGGAGAGCAGG + Intergenic
929003420 2:37370613-37370635 CTCTTGCTTCTTTGGAAAATTGG - Intronic
929834988 2:45387450-45387472 CTGTGGATTACTAGTAGAATAGG + Intergenic
930372892 2:50526661-50526683 CTCTGTTTTATTTGGGGAATAGG - Intronic
933625480 2:84593248-84593270 CTCTCAATTATTTGGAGAATAGG + Intronic
933696934 2:85226604-85226626 GTTTGGGTGATTAGGAGAATGGG - Intronic
935073435 2:99716318-99716340 CTCTGGGATAGTAGCAGAATGGG + Intronic
935805221 2:106739951-106739973 TAATGGCTTATTAGGAGAAAAGG + Intergenic
937369365 2:121286749-121286771 TTCTGCCCTGTTAGGAGAATGGG + Intergenic
938741296 2:134235055-134235077 TTCTGGCTTCTTTGGAAAATTGG + Intronic
939291698 2:140204118-140204140 CTCAGGCTTATTCAGAGAAATGG + Intergenic
939770617 2:146311534-146311556 CTTTTGGTTATTTGGAGAATTGG - Intergenic
941219730 2:162761911-162761933 TTGAGACTTATTAGGAGAATAGG - Intronic
944475173 2:200096222-200096244 CACTGGGTTATTAGAAGGATTGG - Intergenic
946266083 2:218542934-218542956 CACTGGCTTAGTAAGAGGATAGG + Intronic
946336312 2:219038936-219038958 CTCTTGCCTCTTAGGAGAAGAGG + Exonic
1171420557 20:25014627-25014649 ATCTGACTTATTAGGAGGCTTGG - Intronic
1171949874 20:31411905-31411927 CTCTGGCTTAGTAGAAGATAGGG + Intronic
1173289700 20:41703632-41703654 CTCTGGCTTAATAGGAGCACAGG + Intergenic
1175158481 20:56990565-56990587 TTCTGGCTTATGTGGAAAATTGG + Intergenic
1175461804 20:59157416-59157438 CTCTGGCTTGGGAGGCGAATTGG + Intergenic
1175552225 20:59824969-59824991 CTCTGCCTTACTAGTAGAACTGG - Intronic
1177519238 21:22195874-22195896 GTCTGTCTTATTTGGAGAAATGG + Intergenic
1179521410 21:41948003-41948025 CCCTGTCTTGTTGGGAGAATGGG + Intronic
1185416921 22:50715596-50715618 CTCTGGCTTAGGAGGAGGACTGG + Intergenic
950346051 3:12294156-12294178 TTCTGGCTTATGAGGAAACTGGG - Intronic
952192284 3:31036316-31036338 CCCTGGCTTATCTGGACAATGGG - Intergenic
955338825 3:58109162-58109184 CTCTGGCTTTTTTGCAGGATGGG + Exonic
957515799 3:81249406-81249428 ATCTGGCTTATTTGGTGACTAGG + Intergenic
961395227 3:126582419-126582441 CTCTTGCTTATTGGGAGAATAGG - Intronic
962107904 3:132412260-132412282 TTCTGTATTATTAGCAGAATGGG - Intergenic
964998058 3:162912417-162912439 ATGTGGCTTACTATGAGAATTGG + Intergenic
969942638 4:10749751-10749773 CTCTGGATTTCTAGGAGAAAAGG - Intergenic
970385360 4:15550513-15550535 ATATGGCTTGCTAGGAGAATGGG - Intronic
971293208 4:25363876-25363898 CTGTGACTTAGTAGGAGCATGGG + Intronic
972210600 4:36831853-36831875 CTCTGGTTTATTAGCAGAGGAGG - Intergenic
972590923 4:40486297-40486319 CTCTGGCATATTAAGGAAATTGG - Intronic
972813269 4:42614061-42614083 CTATGGCTAAATATGAGAATAGG - Intronic
973812435 4:54584619-54584641 CTCTGACATATTGGGAGCATTGG - Intergenic
974070861 4:57122200-57122222 AATTGGCTTATTAGGACAATTGG - Intergenic
978611848 4:110550305-110550327 TTCTGGATTATGAGGAGAATTGG - Intronic
982019927 4:151192647-151192669 CTTTGGCTTCATAGGAGATTGGG - Intronic
984396603 4:179209904-179209926 AGCTGGCTCATTAGGAGACTTGG - Intergenic
985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG + Intronic
986278911 5:6306518-6306540 CTATGGTTTATTAGGAGATGGGG + Intergenic
988205625 5:28129909-28129931 ATCTTTCTTATTAGGAGAAAGGG + Intergenic
990163147 5:52965686-52965708 CTTTGTATTATTATGAGAATAGG + Intergenic
991187338 5:63825479-63825501 CCTTGGCCTATTAGGAGCATAGG - Intergenic
995762649 5:115579560-115579582 CTCTGGCTTGTTAGGAGCATGGG + Exonic
1000126359 5:158247709-158247731 CTCTGGCTTATTTTGAGGTTTGG + Intergenic
1000822876 5:166007115-166007137 CTCTCTCTTATTTGGAGAATTGG + Intergenic
1001480589 5:172086641-172086663 CCCTGGCGTTTTTGGAGAATTGG - Intronic
1003008544 6:2404715-2404737 CTCTGGCTAATAAGGAAAACGGG - Intergenic
1003524667 6:6887580-6887602 CTCTGCCTTAATAGAAGCATTGG - Intergenic
1003778190 6:9392812-9392834 CTCTGGTATATTAAGAGTATTGG - Intergenic
1004188369 6:13442015-13442037 AGCTGTGTTATTAGGAGAATTGG - Intronic
1007191383 6:40021851-40021873 CTCCCACGTATTAGGAGAATTGG - Intergenic
1009029551 6:58040126-58040148 CTTTGCCTTATTAAGTGAATAGG + Intergenic
1009421173 6:63466471-63466493 CTCTGGCTACTGTGGAGAATAGG + Intergenic
1009662067 6:66626465-66626487 TTCTGGCTCACTAGTAGAATAGG - Intergenic
1010363831 6:75026987-75027009 ATCTGATATATTAGGAGAATCGG - Intergenic
1010541859 6:77101248-77101270 CTCAGGCTTCTCAGGGGAATTGG + Intergenic
1010870674 6:81034279-81034301 CTCTTCCTTATTGGCAGAATTGG + Intergenic
1012408788 6:98931993-98932015 CTCTATTTTATAAGGAGAATGGG + Intronic
1016170322 6:141006430-141006452 TTCTTGCTTATTAGGAAATTGGG - Intergenic
1016625803 6:146166732-146166754 CTCTTGCTAATTACCAGAATGGG + Intronic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1017716375 6:157216574-157216596 CTCTGTCTTCTTAGGAGGAGTGG + Intergenic
1023475438 7:40572943-40572965 CTCTGCGTTATTTGGAGAGTGGG + Intronic
1024880716 7:54082527-54082549 CTCCAGCTTAAGAGGAGAATGGG - Intergenic
1025112591 7:56231762-56231784 CTCTGTCTTTTTAAGAGACTGGG - Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1027152819 7:75744738-75744760 CTCTGGCTTTCTAAGAGATTAGG - Intergenic
1027768291 7:82374351-82374373 CTCTGATTTGATAGGAGAATGGG - Intronic
1030017500 7:105239031-105239053 GGCTTGCTTATTAGGAGAAGTGG - Intronic
1034289944 7:149922127-149922149 CTCTGGTTGTTTAGAAGAATTGG + Intergenic
1034661119 7:152770710-152770732 CTCTGGTTGTTTAGAAGAATTGG - Intronic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1035139789 7:156747862-156747884 CTGTGAATTATTAGGAGATTTGG - Intronic
1037102628 8:15065759-15065781 CTATGGCTTATTCAGAGAATTGG - Intronic
1040767666 8:50934317-50934339 GCTTGGCTTATTTGGAGAATAGG - Intergenic
1044485339 8:92746173-92746195 CTTTGGCTCTTTAAGAGAATAGG - Intergenic
1044668848 8:94658261-94658283 GTCAGGGTTATTATGAGAATTGG + Intronic
1045618387 8:103944924-103944946 CTTTGGCTAATTAGGCTAATAGG + Intronic
1046306578 8:112375000-112375022 CTCTGGACCATTAGGAGAGTTGG + Intronic
1047560952 8:125987760-125987782 CTCTGGCTTATGTGGGGAACCGG - Intergenic
1050757686 9:9027708-9027730 CTCAGGCTTAAAGGGAGAATAGG + Intronic
1051438990 9:17062944-17062966 TGCTTGCTTAGTAGGAGAATAGG - Intergenic
1052915315 9:33920813-33920835 CTGTGGGTTAATAGGAGTATCGG + Intergenic
1056314888 9:85378567-85378589 CTCTGACTTAGTAGGCAAATGGG + Intergenic
1056942750 9:90969276-90969298 CTCTGGCTTTGTAGGAGTCTGGG + Intergenic
1186348214 X:8716468-8716490 CTCTCGCTTATGAGGAGACATGG - Intronic
1192296105 X:69850277-69850299 CTGTGGCTTATTAGTAGAGTTGG + Intronic
1195510400 X:105709579-105709601 GTGTGGCTTATTAGAGGAATGGG + Intronic
1196353923 X:114765524-114765546 CTCTGGCTAGCTGGGAGAATGGG - Intronic