ID: 985517249

View in Genome Browser
Species Human (GRCh38)
Location 5:353393-353415
Sequence CCACTACGGATCCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985517249_985517258 12 Left 985517249 5:353393-353415 CCCTCCTCAGGGATCCGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 985517258 5:353428-353450 ATGTGCCTGTCCCGCAGCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
985517249_985517256 10 Left 985517249 5:353393-353415 CCCTCCTCAGGGATCCGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 985517256 5:353426-353448 AAATGTGCCTGTCCCGCAGCTGG No data
985517249_985517259 13 Left 985517249 5:353393-353415 CCCTCCTCAGGGATCCGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 985517259 5:353429-353451 TGTGCCTGTCCCGCAGCTGGGGG No data
985517249_985517257 11 Left 985517249 5:353393-353415 CCCTCCTCAGGGATCCGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 985517257 5:353427-353449 AATGTGCCTGTCCCGCAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985517249 Original CRISPR CCACTACGGATCCCTGAGGA GGG (reversed) Intronic
901490167 1:9592642-9592664 CCACTCCAGAGCCCTGAGCACGG - Intronic
902613523 1:17610792-17610814 CCTCTTCGGATCTCTGAAGAAGG - Intronic
903493846 1:23751181-23751203 CCACTACAGATCCCTGGAGGAGG + Exonic
904861634 1:33542240-33542262 CCAGTACGGGTTCCTGAGCACGG - Intronic
906826565 1:48987864-48987886 CCACACTGGATCCCTGAGGATGG - Intronic
915069193 1:153252108-153252130 CCACTTCAGATCCCAGAGGAAGG - Intergenic
917008129 1:170438297-170438319 ACTCTACGGATCCCAGAGCAAGG + Intergenic
920498407 1:206471260-206471282 CCACAGCAGAGCCCTGAGGAGGG + Intronic
1064063784 10:12163184-12163206 CCACTTCGCATCCATCAGGATGG - Intronic
1064627833 10:17279621-17279643 CCACTATTGATCCCAGAGGAAGG + Intergenic
1066427614 10:35322788-35322810 CCACTACGTATCCATTAGGATGG + Intronic
1067423065 10:46175046-46175068 TCACTAAGGATCACTGAGGTGGG - Intergenic
1068347290 10:55798249-55798271 TCACTAAGGATCACTGAGGTGGG + Intergenic
1070815971 10:79323471-79323493 CGAGTACGGTTCCCTGAAGAAGG - Intergenic
1070878320 10:79837477-79837499 TCACTAAGGATCACTGAGGTGGG + Intergenic
1071733622 10:88273051-88273073 CCACTGTGGATCACTGTGGATGG + Intergenic
1075280496 10:121134362-121134384 CCACTAAGGACACCTCAGGACGG - Intergenic
1076366159 10:129922214-129922236 CCACTTCGGATAATTGAGGAGGG - Intronic
1076510849 10:131012723-131012745 CTACTACTGATTCCTGAGCAGGG + Intergenic
1078136729 11:8657965-8657987 CCACCACAGGTCCCAGAGGATGG + Intronic
1083655014 11:64225398-64225420 CCTCCACCGCTCCCTGAGGAAGG - Intronic
1087373119 11:97309913-97309935 CCACTACAGAGCCATGAGAATGG + Intergenic
1088503549 11:110507682-110507704 CCTCTATGGAACCCTCAGGATGG + Intergenic
1089524492 11:119088050-119088072 CTTCTCTGGATCCCTGAGGAGGG + Intronic
1089681270 11:120120239-120120261 GCTCTTCTGATCCCTGAGGAAGG - Intronic
1092344928 12:7707136-7707158 CCAATACGGGTCACTGAGGCAGG - Intergenic
1092489310 12:8930705-8930727 CCACCACCCATTCCTGAGGAAGG - Exonic
1092654262 12:10668211-10668233 CAACTAAGGACCCCTGAGGTAGG + Intronic
1096946483 12:55413832-55413854 CCACCACCCATTCCTGAGGAAGG + Intergenic
1104422977 12:128652321-128652343 CCACTTCCCATCCCGGAGGAAGG - Intronic
1107328223 13:39268584-39268606 ACACTACAGATCCATCAGGAAGG - Intergenic
1113385549 13:109844615-109844637 CCAGTACAGAGCCCTGAAGAAGG + Intergenic
1114843085 14:26289132-26289154 GCACTAAGAATCTCTGAGGAGGG + Intergenic
1116012304 14:39366194-39366216 CCACTACTGGGCCCTGAGGACGG - Intronic
1116594728 14:46826458-46826480 ATACTAAGGATCCCTGAGCAGGG + Intergenic
1122901228 14:104783114-104783136 CTACTCCGGGTCCCTCAGGAGGG + Intronic
1202839762 14_GL000009v2_random:110999-111021 CCAGTACGGGTCCCTGAGAATGG - Intergenic
1202909140 14_GL000194v1_random:101139-101161 CCAGTCCGGGTCCCTGAGAACGG - Intergenic
1123538317 15:21261546-21261568 CTACTCGGGCTCCCTGAGGAGGG - Intergenic
1124720726 15:32108989-32109011 CCACTACGGTTACCTGAAAAGGG + Intronic
1129239928 15:74245153-74245175 CCTCTGGGGCTCCCTGAGGACGG + Intronic
1131958559 15:97764070-97764092 CCACTAAGAAGCCCTGAGGAGGG - Intergenic
1132609879 16:810344-810366 CCCCTCTGGTTCCCTGAGGAGGG + Intronic
1132802332 16:1760571-1760593 CCACTCCAGAGCCCTGAGGCCGG - Intronic
1132896038 16:2229858-2229880 CCACTGTGGACACCTGAGGAAGG - Intronic
1133494090 16:6299650-6299672 CCATTAGGGATCTCTGAGAAGGG - Intronic
1134799295 16:17069859-17069881 CCACTACCAGTCCCTCAGGAAGG + Intergenic
1138415484 16:56869124-56869146 CCACAACGGTTCCATGAGGTAGG - Intronic
1142787927 17:2239008-2239030 CACCTACTGAGCCCTGAGGAGGG - Intronic
1143243611 17:5464930-5464952 GCACTACGGAGCCCAGAGGAGGG - Intronic
1145403768 17:22568972-22568994 CTACTCAGGCTCCCTGAGGAGGG - Intergenic
1148698039 17:49572885-49572907 CAACTAAGGCTCCCTGGGGATGG + Intergenic
1150596659 17:66611856-66611878 CCACTTTGCATCCATGAGGATGG - Intronic
1155482319 18:26302799-26302821 ACATTACAGATCACTGAGGAAGG - Intronic
1163021523 19:14483207-14483229 CCACTACGGAAGGCTGAGGTGGG + Intronic
1163601196 19:18250165-18250187 CATTCACGGATCCCTGAGGAAGG + Intronic
1166350887 19:42197561-42197583 CCACTCCCCACCCCTGAGGAAGG + Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926197175 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG + Intronic
929171790 2:38939518-38939540 CCAGTACACATCCCTGAGAATGG - Intronic
930655555 2:54003925-54003947 CCACTACGCATCTATGAGAATGG - Intronic
945148939 2:206767689-206767711 CCACTACTCAACCCTGGGGATGG - Intronic
948385341 2:237577356-237577378 CCACTGCTGAGCCTTGAGGAAGG + Exonic
1172136310 20:32689208-32689230 CCACTAGGAATCCCAGAGGTGGG - Intergenic
1173921964 20:46753001-46753023 CCACTATGGAGCACTCAGGAAGG - Intergenic
1174487610 20:50871150-50871172 CCTCTAGGGCTCCTTGAGGATGG - Intronic
1181291369 22:21796245-21796267 CCACTACAGATTCCTGAAGACGG - Intronic
950348431 3:12321857-12321879 GCACTAGGGATCCCTGAACATGG - Intronic
951901194 3:27659270-27659292 TCACTACTAATCTCTGAGGATGG + Intergenic
955921251 3:63957992-63958014 CCACTACTGATCACTGTGAATGG + Intronic
985517249 5:353393-353415 CCACTACGGATCCCTGAGGAGGG - Intronic
990132337 5:52601428-52601450 TCACTTAGGATCCTTGAGGAAGG + Intergenic
994140351 5:96334487-96334509 CCAATACAGTTCCCTGAAGATGG - Intergenic
995456305 5:112356168-112356190 CCACAATGGCTCCCTGACGATGG + Intronic
997264669 5:132488198-132488220 CCACTCTGGATCTCTCAGGAGGG + Intronic
1003064286 6:2890086-2890108 CCACTACAGCTCCAAGAGGATGG - Exonic
1006358157 6:33572831-33572853 CCACTAGGAATCCCAGAGGTGGG - Exonic
1006908009 6:37545921-37545943 AGACTGCGGCTCCCTGAGGACGG - Intergenic
1007210797 6:40192080-40192102 ACACTGGGGTTCCCTGAGGATGG - Intergenic
1007223058 6:40294140-40294162 AGACTGGGGATCCCTGAGGATGG - Intergenic
1007243338 6:40442617-40442639 AGACTAGGGCTCCCTGAGGATGG + Intronic
1007707167 6:43798070-43798092 AGACTGCGGTTCCCTGAGGACGG - Intergenic
1007740009 6:44004469-44004491 CGACTGGGGCTCCCTGAGGATGG + Exonic
1007740071 6:44004700-44004722 AGACTGCGGCTCCCTGAGGACGG + Exonic
1009609401 6:65920909-65920931 CCAGTTTGGCTCCCTGAGGATGG + Intergenic
1011481341 6:87796785-87796807 CAACTACGCTTCCCTGAGCAAGG + Intergenic
1013949870 6:115766938-115766960 CCAATAGGGATCCCTGTGCAGGG - Intergenic
1014949219 6:127535926-127535948 ACACTGCAGATACCTGAGGAAGG + Intronic
1015827072 6:137325372-137325394 ACACTACTAATGCCTGAGGATGG - Intergenic
1017557105 6:155583381-155583403 CCACTACGCCTGGCTGAGGATGG + Intergenic
1019558996 7:1646635-1646657 AGTCTATGGATCCCTGAGGAAGG - Intergenic
1024157354 7:46638908-46638930 CCACTACTTATCCCTTAAGAGGG - Intergenic
1024266632 7:47611677-47611699 CTTCTATGGAGCCCTGAGGATGG - Intergenic
1028656906 7:93219178-93219200 CCACTGCAGTTCCCTGATGAAGG - Exonic
1028832165 7:95340245-95340267 CCACTAGGGCTGCATGAGGAAGG - Intergenic
1032077354 7:128842404-128842426 CCACCAGGGGTCCCTGAGGGAGG + Intronic
1036130457 8:6104636-6104658 CTGCTTCGGATCCCTGAAGAAGG - Intergenic
1038475046 8:27859967-27859989 CCACTACACACCCATGAGGAGGG - Intergenic
1040915428 8:52563722-52563744 CCACTGGGGAGCCCTCAGGAGGG - Intronic
1041472073 8:58221922-58221944 CCCCTACAGATCCATCAGGAGGG - Intergenic
1045850814 8:106696647-106696669 CCACTACGGATCTATTAGAACGG - Intronic
1053102868 9:35385976-35385998 AGACTATGGATCCATGAGGATGG + Intronic
1053102963 9:35386660-35386682 CCACTTCAGATCTCAGAGGAAGG - Intronic
1053620379 9:39809049-39809071 CTACTACTGATCCCTGACGCTGG + Intergenic
1053626321 9:39874885-39874907 CTACTACTGATCCCTGACGCTGG - Intergenic
1053878548 9:42568348-42568370 CTACTACTGATCCCTGACGCTGG + Intergenic
1053894117 9:42726030-42726052 CTACTACTGATCCCTGACGCTGG - Intergenic
1054217567 9:62375816-62375838 CTACTACTGATCCCTGACGCTGG + Intergenic
1054233142 9:62533347-62533369 CTACTACTGATCCCTGACGCTGG - Intergenic
1054263777 9:62898394-62898416 CTACTACTGATCCCTGACGCTGG - Intergenic
1056041015 9:82667396-82667418 CAACTACCTATCCATGAGGATGG + Intergenic
1057332053 9:94124469-94124491 CCACTTCATATCCATGAGGAAGG - Intergenic
1057910855 9:99019509-99019531 CCAATACTGATCCTAGAGGACGG - Intronic
1059644701 9:116253124-116253146 ACACTAAGGATACCTGTGGAAGG + Intronic
1060612473 9:124980166-124980188 GCACTACAGATCCCTAAAGATGG + Intronic
1061386839 9:130295482-130295504 CCCCTGGGGATCCCTGAGGGTGG + Intronic
1061400868 9:130367639-130367661 CCACTAAGGATCCCAGGGGGAGG + Intronic
1203482647 Un_GL000224v1:20823-20845 CCAGTCCGGGTCCCTGAGAACGG + Intergenic
1192102729 X:68281866-68281888 CCACTACACATCCGTGAGAATGG + Intronic
1198481245 X:137043230-137043252 CCACTACACATCCATTAGGATGG - Intergenic
1198521385 X:137456221-137456243 CCACTGAGTATCCCTGAGAATGG + Intergenic