ID: 985517552

View in Genome Browser
Species Human (GRCh38)
Location 5:354714-354736
Sequence TGCCACATGCTGCTGGTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985517552_985517562 20 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517562 5:354757-354779 TCCTGAGTTTGAGTCAGGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 194
985517552_985517565 22 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517565 5:354759-354781 CTGAGTTTGAGTCAGGGTGGGGG 0: 1
1: 0
2: 2
3: 25
4: 296
985517552_985517564 21 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517564 5:354758-354780 CCTGAGTTTGAGTCAGGGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 255
985517552_985517560 16 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517560 5:354753-354775 GCACTCCTGAGTTTGAGTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 220
985517552_985517561 19 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517561 5:354756-354778 CTCCTGAGTTTGAGTCAGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 230
985517552_985517559 15 Left 985517552 5:354714-354736 CCCGTGACCAGCAGCATGTGGCA 0: 1
1: 1
2: 3
3: 21
4: 213
Right 985517559 5:354752-354774 TGCACTCCTGAGTTTGAGTCAGG 0: 1
1: 0
2: 2
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985517552 Original CRISPR TGCCACATGCTGCTGGTCAC GGG (reversed) Intronic
900655256 1:3753772-3753794 CCACACATGCTGCTGGTCACAGG - Intronic
901781756 1:11598944-11598966 TGGCACCTGCTGCTGGTAACTGG - Intergenic
902047800 1:13538890-13538912 TACCATATGCTGTTGGTCATGGG - Intergenic
902222283 1:14974237-14974259 TGCCACATTCTGTTGGTGACAGG + Intronic
903051383 1:20603753-20603775 TACCACATCTTGCTGGTCAGGGG + Intronic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905818714 1:40972701-40972723 TGCCACAAGCAGCTAGGCACTGG + Intergenic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
908603859 1:65771952-65771974 TAGCCCATGTTGCTGGTCACTGG - Intergenic
908780491 1:67685786-67685808 TGCCACAGGCTGCCAGCCACGGG - Intronic
909606142 1:77510139-77510161 GGCCACAGGCTCCTGGACACTGG + Intronic
911976143 1:104497968-104497990 TGCCCCATTCTGCTGGTGGCGGG - Intergenic
912946433 1:114088606-114088628 TGCCACATCCTGCTGGCTGCTGG + Intergenic
913483095 1:119308263-119308285 TCCCCCATGATGATGGTCACAGG - Intergenic
917189787 1:172402958-172402980 TCCCAGATGCTGCTGGTCCTGGG - Intronic
919248228 1:195016231-195016253 TGCCAGATGATGCTGGTTATGGG - Intergenic
920536142 1:206737715-206737737 AGCCACTTGCTGCTGCACACAGG - Intergenic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
921814762 1:219550835-219550857 TGCCAGCTGCTGCTTGTCAATGG + Intergenic
922283681 1:224149623-224149645 TGCCAGATGCTGCTAGGCTCTGG + Intronic
922355252 1:224769169-224769191 AGCCAAACGCTGCTGGTCAGCGG - Intergenic
922648275 1:227313337-227313359 TGCCAGATGATACTGGTTACTGG - Intronic
922853259 1:228752415-228752437 GGCCACATGCTCGTGGTCAGAGG + Intergenic
923525059 1:234766221-234766243 TGCCTCTTGCTGCTCCTCACAGG - Intergenic
924110460 1:240693751-240693773 TGCCAGATGCTGCTAGATACTGG - Intergenic
1063971764 10:11385987-11386009 TCCCACATAATGCTGGTCATGGG - Intergenic
1067147685 10:43705328-43705350 TGCAACTTGCTGCTGGGAACGGG - Intergenic
1067168005 10:43880456-43880478 TGCTTCATGCTGCTGCTCCCCGG + Intergenic
1067172919 10:43922522-43922544 TGCCACTTCCTGATGGTCCCTGG - Intergenic
1067729864 10:48802846-48802868 TGCCACTTGCTGGTGGTGAGTGG + Intronic
1069609733 10:69764910-69764932 TGGCAGATGCTGCTGGTGTCCGG - Intergenic
1070769962 10:79076489-79076511 AGACACATGCTGCTGGGCAGGGG - Intronic
1070800482 10:79242323-79242345 TGCCGCCAGCTCCTGGTCACAGG + Intronic
1072309243 10:94138676-94138698 TGTCACCTGCTGCTGGACATAGG + Intronic
1073226889 10:101928534-101928556 TGGCACATGCTTATGGTCCCAGG + Intronic
1074709184 10:116163007-116163029 TGTCACATGCTGCTGCTGGCAGG + Intronic
1074870063 10:117569308-117569330 TGGCACATGCTGCTGCCCCCCGG - Intergenic
1074967277 10:118502311-118502333 TGGCACATTCTGCTTGGCACTGG - Intergenic
1075002929 10:118811064-118811086 TGCCCCATTCTCCTGGTCCCGGG + Intergenic
1075419952 10:122293391-122293413 TGCCACATGCTCCAGATCAAAGG - Intronic
1076699572 10:132264503-132264525 TGGCACATCCTGCTGGACAGAGG + Intronic
1076778160 10:132709503-132709525 TGCCCTTTGCTGTTGGTCACAGG + Intronic
1077046069 11:545793-545815 TGCCTTATGCTGCTGGGAACAGG - Intronic
1077142711 11:1031441-1031463 TGGCTCATGTTGCTGGTCAGGGG + Intronic
1077305084 11:1865321-1865343 TGCCACATGCACCGGGCCACTGG + Intronic
1078262893 11:9727629-9727651 AGCCACATGGTGGTGGTTACTGG - Intronic
1078359579 11:10657941-10657963 TGCCACATGCAGCCGGGCTCGGG - Intronic
1079774996 11:24514097-24514119 TGCCACATGCTTCTGTTTATGGG - Intronic
1080409015 11:32005955-32005977 TGCCACATCCTGTTGGTTATGGG + Intronic
1089530243 11:119123249-119123271 TCCCACATGATGCTGTTCTCTGG - Intronic
1089574499 11:119431948-119431970 CGCCACATGGTGGGGGTCACTGG + Intergenic
1091761552 12:3090733-3090755 TTCCTCATGCTTCTGGGCACAGG - Intronic
1092144205 12:6203435-6203457 TGCAAAGTGCTGCTGGGCACTGG - Intronic
1092377925 12:7970871-7970893 TCCCACATGCTGGGGGACACCGG + Intergenic
1095922089 12:47541802-47541824 TGCCACATTTTGTTGGTCACAGG - Intergenic
1099083107 12:78210951-78210973 TGCCACACGGTGCTGGTCACAGG + Exonic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1101897181 12:108765612-108765634 TGCCACATGGAGATGGCCACTGG - Intergenic
1102619048 12:114179138-114179160 AGCTACTTCCTGCTGGTCACAGG - Intergenic
1104943693 12:132406341-132406363 TGCCCCATGGTCCTGTTCACGGG - Intergenic
1107597898 13:41982219-41982241 TGCCACATACTGCAGTTTACAGG + Intergenic
1107761051 13:43679285-43679307 TGTCTCATGCTGCTGACCACAGG - Intronic
1111659610 13:91192928-91192950 TGCCACATTCTGTTGGTCAAAGG - Intergenic
1112924034 13:104651079-104651101 TGCCATTTGGTGCTGGTCAGTGG + Intergenic
1117445057 14:55796286-55796308 TGCCACAGGCTGCGGGGCAGAGG + Intergenic
1118122628 14:62862576-62862598 TGCCACATCCTATTGGTCAAAGG - Intronic
1119597692 14:75951213-75951235 TGGCACATGCTTGTGGTCCCAGG + Intronic
1119662395 14:76461382-76461404 TGCTAAGTGCTGCTGGACACTGG + Intronic
1120056180 14:79926733-79926755 TGTCAGATGCTGCTGATAACTGG - Intergenic
1120096030 14:80388661-80388683 TGGCTGATGCTGCTGGTCCCAGG - Intergenic
1121242317 14:92439745-92439767 TGCCACTTGCAGCTGGTGACAGG - Intronic
1121451473 14:94011000-94011022 TGGCAGATGCTGCTGGTCCTGGG + Intergenic
1122880098 14:104686967-104686989 AGCCACATGTTCCTGGCCACTGG - Intergenic
1123020640 14:105396271-105396293 TGCCCCAGGCTCCTGGTCCCAGG - Exonic
1124641214 15:31397743-31397765 TGCCAGGAGCTGCTGGCCACTGG - Intronic
1124888187 15:33706955-33706977 TGCCCCATGCTTCTGGCCAAAGG + Exonic
1125524745 15:40367880-40367902 GGCTACCTGCTGCTGGTCTCCGG + Exonic
1125775553 15:42209282-42209304 TCCCAGATGTTGCTGGTCCCTGG + Intergenic
1126332320 15:47546664-47546686 GGCCACAAGGTGCTGGTCATGGG - Intronic
1127947556 15:63770462-63770484 TGCCAGATACTGCTAGGCACTGG - Intronic
1128340105 15:66816612-66816634 TATCACTTCCTGCTGGTCACTGG + Intergenic
1128364013 15:66984129-66984151 TGGCTCATGATTCTGGTCACTGG + Intergenic
1128622082 15:69159704-69159726 TGCCAAATACTACTGGGCACTGG + Intergenic
1128622096 15:69159845-69159867 TGCCAAATACTACTGGGCACTGG + Intergenic
1130243692 15:82222618-82222640 TGCCACACACTGCTGGGCACTGG + Intronic
1130310887 15:82753163-82753185 TGTCACATGCTACTGGCTACTGG - Intergenic
1130742118 15:86612187-86612209 TGCATCCTGCTGCTGGTCAAAGG - Intronic
1131188268 15:90293580-90293602 TGCCACCTGCTGCTGATAAGTGG - Intronic
1131282557 15:91033215-91033237 TGCCACCTGCTGCTGCTAAGTGG + Intergenic
1131512308 15:93056119-93056141 AGGCCCATGCTGCTGGTCCCCGG + Intronic
1132241104 15:100257585-100257607 AGCCACAGGCTGCTGGGCTCTGG - Intronic
1132593657 16:738127-738149 TGCCACAGGGTGCTGGGCAGAGG + Intronic
1132600227 16:769817-769839 TCCCACTTTCTGCTGGTCAGTGG + Intronic
1133102142 16:3486059-3486081 TGCCACAAGCTGCTGCTCCAAGG + Exonic
1134466885 16:14486811-14486833 TGCTACATGCTGCTTCTGACAGG - Intronic
1134831111 16:17323686-17323708 TGCCACTTGCTCCTGTTCACTGG + Intronic
1135633588 16:24055412-24055434 TGCCGCATGCAGCTCGTCAGGGG - Intronic
1137666686 16:50253821-50253843 TGCTACATGCTGGTGGGGACTGG + Intronic
1138519914 16:57565115-57565137 TGCCAGAAGCTGATGTTCACAGG - Exonic
1139793819 16:69465143-69465165 TGCCACCTGGAGCTGGTCTCTGG + Exonic
1142164687 16:88579868-88579890 TGCCACATGCTGAGTGTGACTGG + Intronic
1142527332 17:553056-553078 TGCCACATGCTGCTGTGTAGTGG + Intronic
1142527338 17:553121-553143 TGCCACATGCTGCTGTGTAGTGG + Intronic
1142527350 17:553251-553273 TGCCACATGCTGCTGTGTAGTGG + Intronic
1144450089 17:15369921-15369943 TGACACATAATGTTGGTCACGGG - Intergenic
1144649361 17:16997717-16997739 TGCCACATGCTGGTGACCATAGG - Intergenic
1149683567 17:58521868-58521890 TGCCACTAGCAGGTGGTCACAGG - Intronic
1151511151 17:74560970-74560992 AGCCCCATGCTGAGGGTCACAGG + Intergenic
1156383072 18:36581552-36581574 TGCCCCATATTGCTGATCACAGG + Intronic
1159051077 18:63422086-63422108 TCCCACCTGCTGCAGGTCCCCGG + Intronic
1159093015 18:63870728-63870750 GGCCAGATGCTGCTGGTCTGAGG - Intergenic
1159859970 18:73636403-73636425 TGCTACGTTCTGCTTGTCACAGG - Intergenic
1160553008 18:79707099-79707121 TTCCACATGCTCCTCCTCACTGG - Intronic
1161044909 19:2129583-2129605 TGCCACCTCCTCCTGGTGACAGG + Intronic
1162042280 19:7978120-7978142 TGCCAGGTGCTGGGGGTCACTGG - Intronic
1162361735 19:10224448-10224470 TGCCGCATGCTTCTGCTCATCGG - Exonic
1162769255 19:12939040-12939062 AGCCACAAGCTGCTGGGGACAGG - Intronic
1166740333 19:45110884-45110906 TGCCTCAGGCTTCTGGTCATGGG - Intronic
926219794 2:10927240-10927262 AGCCTGATGCTGCTGGTCCCTGG + Intergenic
926327684 2:11799480-11799502 TGGCAAATGCTGCTGGGAACGGG - Intronic
931374532 2:61695362-61695384 TGCCATGTCCTGCTGCTCACAGG - Intergenic
931391169 2:61845420-61845442 TACCACTGGCTCCTGGTCACTGG - Intronic
932825184 2:74932685-74932707 AAACACATGCTGCTGGTCACCGG - Intergenic
932909302 2:75789092-75789114 AGCCCCAGGCTGCTGGCCACAGG + Intergenic
933039300 2:77442079-77442101 TTCCACATTCTGCTGTTCTCAGG - Intronic
933808230 2:86015573-86015595 GGCCACTTGCTGAAGGTCACAGG + Intergenic
934902573 2:98172330-98172352 TGCGTCATTCTGCTGGTCAGGGG + Intronic
935068592 2:99674374-99674396 TGCCGCACTGTGCTGGTCACTGG - Intronic
937062512 2:118991043-118991065 TGCCTCCTGCTGCCTGTCACTGG + Intronic
938487188 2:131723425-131723447 ACCCACCTGCAGCTGGTCACTGG + Intronic
938560035 2:132464046-132464068 TGCCACATTCTATTGGTCACAGG + Intronic
940770956 2:157839134-157839156 AGCCACAGGCTCCTGCTCACTGG + Intronic
944886379 2:204066520-204066542 TGCCATATTCTACTGGTTACAGG - Intergenic
1170801129 20:19591091-19591113 TGACAGATGCTGTTGGTCCCAGG + Intronic
1171953287 20:31440435-31440457 TGGCGCCTCCTGCTGGTCACTGG + Intergenic
1174209317 20:48864918-48864940 TGACACATGCTGCTCTTCAGAGG + Intergenic
1174515339 20:51087806-51087828 ATCCCCATGCTGCTGGTCCCTGG + Intergenic
1175189409 20:57201056-57201078 TGACAGAAGCTGCTGGTCCCTGG - Intronic
1178027278 21:28482738-28482760 TCCTAGATTCTGCTGGTCACTGG - Intergenic
1178220165 21:30647268-30647290 TGTCTCATGCTGCTGCCCACAGG - Intergenic
1178532539 21:33387480-33387502 TGCCTCAGGCTGAAGGTCACTGG - Intergenic
1178589884 21:33900716-33900738 TGGCACATGCTCATGGTCCCGGG + Intronic
1178643041 21:34362010-34362032 TGCCACCTGCTGGTGGGAACAGG - Intergenic
1181492563 22:23269625-23269647 CGCCAGGTGCTGCTGGTAACAGG + Intronic
1181508865 22:23379924-23379946 TCCCTGAGGCTGCTGGTCACAGG - Intergenic
1183308987 22:37099103-37099125 TGCCACATGGTGCTGTTGAGGGG + Intronic
1183400955 22:37604114-37604136 TTCCAGATGCTGCTGCTGACTGG - Intergenic
1184651991 22:45923685-45923707 TGGGACCTGCTGCAGGTCACAGG + Intronic
1185402437 22:50625940-50625962 AGCCCCCTGCTGCTGGGCACAGG - Exonic
949608228 3:5677233-5677255 TCCCACATGAAGCTGGTTACCGG - Intergenic
951397088 3:22181893-22181915 TGCCACATGATCCTCTTCACAGG - Intronic
952818599 3:37466744-37466766 TTCCCCATGCTGCTGGTCTGAGG + Intronic
953882728 3:46700048-46700070 TTCCTCATGCTGCTGGTCACAGG - Intergenic
954652715 3:52175215-52175237 GACCACACCCTGCTGGTCACCGG + Intergenic
957121118 3:76094263-76094285 TGCCGCATCCATCTGGTCACTGG - Intronic
957161122 3:76610688-76610710 TGTGACATGCTCCTGCTCACTGG - Intronic
957684804 3:83488356-83488378 TGACACCTGCTGCTGGTCCCTGG + Intergenic
959641574 3:108643520-108643542 TGCTTGATGCTGCTGGTCTCTGG + Intronic
960655392 3:119998330-119998352 TGCCACATGGGCCTGTTCACTGG - Intronic
960961050 3:123070605-123070627 TGCCAAGTGCTCCTGGACACAGG + Intronic
966899119 3:184467665-184467687 TGCCCCTTGCTGTTGGTCTCTGG - Intronic
967097303 3:186187553-186187575 TGACACAGGCTGCTGGACATAGG + Intronic
968634052 4:1668647-1668669 TGCCACCTGCAGCTGCTTACCGG + Exonic
969120005 4:4901116-4901138 GGCCACATGCAGCAGGTCAAGGG - Intergenic
969306542 4:6329163-6329185 AGCCCCATGCTGCGGGTCACCGG + Intronic
971341035 4:25769312-25769334 TCAGACATGCTGCAGGTCACAGG + Intronic
979753218 4:124305152-124305174 TGCCACATGTTGATGGTCAGAGG - Intergenic
982645420 4:158018606-158018628 TGGCAAATGCTGCTAGTCATTGG - Intergenic
984254321 4:177372620-177372642 TCCCATCTGCTGCTGGTCTCTGG - Intergenic
984395363 4:179190907-179190929 TGGCATATGCTGCTTGACACAGG + Intergenic
985280809 4:188283913-188283935 TGCCACATGCTGGTGGTGCCTGG + Intergenic
985517552 5:354714-354736 TGCCACATGCTGCTGGTCACGGG - Intronic
985590059 5:759898-759920 AGCCACATGCTGCTGGCCAAGGG + Intronic
985706486 5:1404292-1404314 TCCCAGATGCTGCAGGCCACTGG - Intronic
986150610 5:5126595-5126617 TGACACATGGTGCTGGGCAGAGG + Intergenic
988019184 5:25601183-25601205 TGCCACTTGCTGCTGGCTGCAGG + Intergenic
988566069 5:32320753-32320775 TGCCACAGCCTGCTGCCCACTGG - Intergenic
988633826 5:32959951-32959973 AGCCATGTGCTGCTTGTCACTGG + Intergenic
989523243 5:42424688-42424710 TGCCAGAGGCTGCGGGTCAATGG + Intronic
990352057 5:54928771-54928793 TGCCCCTTGCTGCTGCTCTCTGG - Intergenic
994929492 5:106163423-106163445 TGCCTCATTCTGCAGGTCAGTGG - Intergenic
997417545 5:133740680-133740702 TGCCACCTGCCCCTGGCCACTGG - Intergenic
997742637 5:136270578-136270600 TGCAACACGATGCTGGGCACTGG + Intronic
998098077 5:139408854-139408876 TGCCACATTCTGTTGGTTAAAGG + Intronic
998107995 5:139480898-139480920 AGCCACATCCTGCTGTCCACAGG - Exonic
998371812 5:141666603-141666625 TGCCACCAGCTGCTGGGCCCCGG - Exonic
999331390 5:150675917-150675939 TCACACATGCTGCTGGTTAGAGG - Intronic
999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG + Intergenic
1006644567 6:35507064-35507086 TGCCATATTCTACTGGTCACAGG - Intronic
1015111348 6:129595503-129595525 TGCCACATGCTGCTGTTCTCTGG + Intronic
1016580556 6:145625035-145625057 TGCCATTAGCTGCTTGTCACTGG - Intronic
1019902018 7:4028386-4028408 TGTCACATGCTGTGGTTCACGGG - Intronic
1020012651 7:4815213-4815235 GGCCACATGCTGTGGGTCCCTGG - Intronic
1020093942 7:5357229-5357251 TGCCAACTGCTCCTGGTCGCTGG + Exonic
1020444951 7:8259288-8259310 GGCCACATGCTACTGGTCCATGG + Intronic
1022249533 7:28593672-28593694 TTCCACATGATCCTAGTCACTGG + Intronic
1022270158 7:28799200-28799222 TGACACAGGCTGCTGCTCAGAGG + Intronic
1023998536 7:45176718-45176740 TGACACAAGCTGCTTGTCCCAGG - Intronic
1026509223 7:71014549-71014571 TGCCACATGCCTGTGGTCCCAGG - Intergenic
1028273613 7:88823671-88823693 TGCCACATGCTCATGGTACCTGG - Intronic
1030892439 7:115015752-115015774 TGCCACATGACGCTTGTCCCAGG - Exonic
1032151635 7:129434458-129434480 TCCTCCATGCTGCTGGTCAGCGG - Exonic
1033460509 7:141543024-141543046 TGCCACTTGCTGCTGGGCTGTGG - Intergenic
1033591234 7:142809960-142809982 GGCCACATGCTGGTGGCCAGAGG - Intergenic
1034481317 7:151322032-151322054 TACCTCATTCTTCTGGTCACAGG + Intergenic
1034549439 7:151810939-151810961 TGCCACCTTCTGAAGGTCACTGG - Intronic
1036908753 8:12733122-12733144 TGACAGATGCTGCTGGTCAGGGG + Intronic
1037606810 8:20444864-20444886 TGCCATCTTCTGATGGTCACAGG - Intergenic
1039016659 8:33156997-33157019 TGGCACATGCCTGTGGTCACAGG + Intergenic
1039076258 8:33693103-33693125 TGCCTCATTCTGCTGGTCAATGG + Intergenic
1039121333 8:34151264-34151286 TGTCACATGCTGAAAGTCACGGG - Intergenic
1040846373 8:51846248-51846270 GGCCACATTCTGCTAGGCACTGG - Intronic
1041545821 8:59041033-59041055 TGCCTCCTGCTGATGGTCAAAGG - Intronic
1045349848 8:101328757-101328779 TGCCACCAGGTGCTTGTCACAGG + Intergenic
1045476173 8:102554823-102554845 TGGCACATGCTTGTGGTCCCAGG + Intronic
1046277455 8:111982308-111982330 TGCCAGATTCTGCTGGTGAATGG + Intergenic
1046381367 8:113454549-113454571 TGCCACAGGCTGGTGGAAACAGG - Intergenic
1046825614 8:118688468-118688490 TGCCCCATGCTGCTGCTTAATGG - Intergenic
1047845188 8:128798091-128798113 TGCCATATTCTGTTGGTTACAGG + Intergenic
1049573054 8:143378537-143378559 TGCCGCATGCTGCTGGCCTTCGG + Intronic
1049788018 8:144460444-144460466 GGCCACATGGTACTGGTCCCTGG - Intronic
1049856855 8:144867741-144867763 TGCCCCATACTGCTGGCCAGAGG + Intergenic
1051124682 9:13791017-13791039 TGCCACATGCCTATAGTCACAGG + Intergenic
1053208740 9:36209739-36209761 TGCAAGGTGCTGCTGCTCACTGG - Intronic
1056760730 9:89412767-89412789 TGCCACATACTGCTCCTCCCAGG + Intronic
1059293746 9:113251014-113251036 TGCCTCATGATTCTGGTGACTGG - Intronic
1059428568 9:114236501-114236523 GGCCACATGATGCCGGACACAGG - Intronic
1059451417 9:114373329-114373351 TGCCCCATACTGCTGTTCAGGGG + Intronic
1060552708 9:124493037-124493059 GGCAGCATCCTGCTGGTCACCGG - Exonic
1061572075 9:131484123-131484145 TGTCACATGCAGATGGACACCGG + Intronic
1187526441 X:20059332-20059354 TCCCAGGTGCTGCTGGTCATGGG + Intronic
1189610834 X:42732608-42732630 TGCCACATGGTGCTGTCCATAGG - Intergenic
1189732084 X:44032082-44032104 TCCCAGATGCTGCTGGTCTGAGG - Intergenic
1190124369 X:47690340-47690362 TGCCACATGCTGCTGGCCACTGG + Intergenic
1192796685 X:74429337-74429359 TGGCACATGCCTGTGGTCACAGG + Intronic
1194885084 X:99304739-99304761 TGCCACCTACTGCTGTTCCCTGG - Intergenic
1199154713 X:144533965-144533987 TGCCAGATACTGCTAGACACTGG + Intergenic
1199895949 X:152127946-152127968 TTCCTCATTCAGCTGGTCACAGG - Intergenic
1201927172 Y:19299924-19299946 TGCCACAGGCTGCAGGCCACAGG + Intergenic