ID: 985519439

View in Genome Browser
Species Human (GRCh38)
Location 5:366136-366158
Sequence CACACCTAACATTCAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985519438_985519439 -8 Left 985519438 5:366121-366143 CCTAGCAGCAGCAATCACACCTA 0: 1
1: 0
2: 5
3: 32
4: 208
Right 985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG 0: 1
1: 0
2: 7
3: 43
4: 225
985519436_985519439 9 Left 985519436 5:366104-366126 CCTCGGAACAGTGACACCCTAGC 0: 1
1: 0
2: 1
3: 6
4: 61
Right 985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG 0: 1
1: 0
2: 7
3: 43
4: 225
985519435_985519439 21 Left 985519435 5:366092-366114 CCACTGAGAGAGCCTCGGAACAG 0: 1
1: 0
2: 3
3: 19
4: 177
Right 985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG 0: 1
1: 0
2: 7
3: 43
4: 225
985519437_985519439 -7 Left 985519437 5:366120-366142 CCCTAGCAGCAGCAATCACACCT 0: 1
1: 0
2: 3
3: 21
4: 181
Right 985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG 0: 1
1: 0
2: 7
3: 43
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985519439 Original CRISPR CACACCTAACATTCAGATGT TGG Intronic
901545779 1:9955662-9955684 CACATCTAAAATTCAGGTGAAGG - Intronic
902836688 1:19051937-19051959 CACACCTGGCACCCAGATGTTGG - Intergenic
903855406 1:26335031-26335053 AACACCTAGCATGCAGATTTTGG + Intronic
906570398 1:46833110-46833132 CACACCTAACACTCAGATCTTGG - Intergenic
909785329 1:79604807-79604829 TGTCCCTAACATTCAGATGTGGG + Intergenic
910512501 1:88022539-88022561 AACAACCTACATTCAGATGTGGG - Intergenic
910987494 1:93020006-93020028 GACACCTACCATCCAGATCTCGG + Intergenic
911565652 1:99460814-99460836 CACACCTATCATTGTGATTTGGG + Intergenic
911977272 1:104515498-104515520 TACACCTAACATCCATATATTGG + Intergenic
912889683 1:113516239-113516261 CAGACCTTACATTCAAATCTTGG + Intronic
913130610 1:115835176-115835198 CAGACCTCCCATTCACATGTAGG - Intergenic
914257572 1:145973160-145973182 CACACCTAGCACCCAGATCTTGG - Intronic
914316020 1:146512668-146512690 CCCACCTAACCTGCAGATTTTGG + Intergenic
914498335 1:148220693-148220715 CCCACCTAACCTGCAGATTTTGG - Intergenic
916276553 1:163000422-163000444 GACACCTGACATTGAGATTTTGG - Intergenic
916532993 1:165676213-165676235 CACACCTGGCACTCAGATCTTGG + Intronic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
918023418 1:180717581-180717603 CACACCCAAGATTCTGATGTAGG - Intronic
919413278 1:197273915-197273937 CACACCTCACATCCAGATCTTGG - Intronic
919608861 1:199720145-199720167 GACACCTTACATTTAGCTGTTGG - Intergenic
922011212 1:221590100-221590122 CATACCTACCACTCAGGTGTTGG + Intergenic
923281560 1:232448009-232448031 CACACCTGACTTTCACATGATGG - Intronic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1067395095 10:45908318-45908340 CACACCTATCACCTAGATGTTGG + Intergenic
1067863412 10:49877450-49877472 CACACCTATCACCTAGATGTTGG + Intronic
1074714364 10:116204433-116204455 CACACCTAACACCCAGATCTTGG + Intronic
1075792517 10:125095188-125095210 CACACCTAGCAAACAGATCTTGG + Intronic
1075986809 10:126795126-126795148 CACAACTAACATTCAAATTTTGG + Intergenic
1076286464 10:129302468-129302490 CACACCTAGCAACCAGATCTTGG + Intergenic
1078189799 11:9084017-9084039 AACACCAAACATCCAGATCTTGG + Intronic
1080158333 11:29139935-29139957 CACACCTGACACTCAGGTCTTGG - Intergenic
1080851706 11:36076074-36076096 CACACCTAGCACCCAGATCTTGG - Intronic
1080957123 11:37111030-37111052 CACACCTAAGATTCCCCTGTGGG + Intergenic
1084009319 11:66338842-66338864 CCCACCTGACATTCAGGAGTGGG + Intronic
1085907157 11:80777174-80777196 GACACCTAACATTTAGATAGAGG - Intergenic
1086740276 11:90359425-90359447 CACACCCAATACTCAGATGTTGG + Intergenic
1087112319 11:94483978-94484000 CACATGTAACATCCAGATCTTGG + Intronic
1088333581 11:108678418-108678440 CTCACCTAACATTTGGAGGTCGG - Exonic
1088691597 11:112333138-112333160 CACTCCAGACATTGAGATGTGGG - Intergenic
1090020051 11:123120322-123120344 TACACCCATCTTTCAGATGTTGG + Intronic
1091365733 11:135018805-135018827 CACACCCAGCATCCAGATCTTGG + Intergenic
1092671895 12:10872261-10872283 CACACCTAACATACAGAATGGGG + Intronic
1092775361 12:11940712-11940734 CACATCCAACAACCAGATGTTGG + Intergenic
1093164069 12:15785648-15785670 CACACCTAGCACCCAGATCTTGG + Intronic
1094684318 12:32695976-32695998 GACACCTAATATACATATGTTGG - Intronic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1096972482 12:55678847-55678869 CACATCCAGCATTCAGATCTTGG + Intergenic
1097581957 12:61468946-61468968 TACTCCTACCATTCTGATGTTGG + Intergenic
1097945088 12:65358695-65358717 GCCACCTACCATTCAGATTTTGG - Intronic
1099390460 12:82072768-82072790 CGCACCTAGCATTCAGATCTTGG - Intergenic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1101177865 12:102174777-102174799 CACACCTAAAATTAAGAGTTTGG - Intronic
1101623606 12:106416566-106416588 CAGACCTGAGCTTCAGATGTAGG + Intronic
1102125763 12:110479213-110479235 CACACCTAGCACCCAGATCTTGG - Intronic
1106260958 13:28066343-28066365 CACACCCAACTCTCAGATCTTGG + Intronic
1106969065 13:35114105-35114127 CACACCTCACATCCACATCTTGG - Intronic
1107608048 13:42081844-42081866 CACACCTAAGGCTCAGATCTTGG - Intronic
1107954631 13:45499035-45499057 CACACCTAATACTCAGATCTTGG - Intronic
1108101477 13:46961280-46961302 CACACCTAAGATACAGATCCAGG + Intergenic
1108337006 13:49453790-49453812 TACACCTATCATTCAGACCTTGG - Intronic
1111282050 13:86039306-86039328 CATACCTATCATGCAGATCTTGG - Intergenic
1111427172 13:88101903-88101925 AACTCCTATTATTCAGATGTTGG - Intergenic
1111571558 13:90094156-90094178 CACACCTAGAGTCCAGATGTTGG + Intergenic
1111668637 13:91300876-91300898 CACACCCAACACTCAGATATTGG - Intergenic
1112332599 13:98488023-98488045 CACACCCACGATTCACATGTTGG + Intronic
1112628255 13:101130942-101130964 GACACCTATAATGCAGATGTCGG + Intronic
1115389729 14:32841407-32841429 CACACCTAACACTAAAATCTTGG - Intergenic
1115667859 14:35573275-35573297 AACACAAAACATTCAGAAGTTGG + Intronic
1116107575 14:40529803-40529825 CACTCCTAGCATTCAGATCATGG - Intergenic
1116909223 14:50440817-50440839 CACACCTAGTATCCAGATCTTGG + Intronic
1117287871 14:54304901-54304923 CACATCTAACACCCAGATCTTGG - Intergenic
1118168853 14:63365131-63365153 CACATCTAGCATCCAGATCTTGG + Intergenic
1119106477 14:71930045-71930067 CACACCTAACACTCAGACCTTGG - Intergenic
1119222631 14:72921408-72921430 CACACTTAGCATTCAGGTCTTGG + Intergenic
1121370524 14:93354336-93354358 CACTCCTAAGTTTCAGATCTTGG - Intronic
1123483894 15:20666298-20666320 CACACCTCACATCCAGATCTTGG + Intergenic
1125225710 15:37393376-37393398 CACACCTAACACCCAGATCTTGG - Intergenic
1127322499 15:57860911-57860933 CACACCTAGCACCCAGATCTTGG - Intergenic
1127590226 15:60415260-60415282 CACATGTAACATCCAGATCTTGG - Intergenic
1129643919 15:77412688-77412710 CACACTTAGCATCCAGATCTTGG + Intronic
1130374694 15:83318361-83318383 CACACCCAACATACATATGATGG - Intergenic
1132329975 15:101005570-101005592 CACACCTCACACCCAGATCTTGG + Intronic
1134016574 16:10892519-10892541 CACACATGACATGCAGATGAAGG - Intronic
1134069592 16:11252652-11252674 CACACCCAGCCTTCCGATGTAGG - Intronic
1134417450 16:14056637-14056659 CACACCTACCACTCAGATCTTGG - Intergenic
1134428946 16:14182654-14182676 CATACCTAGCATTCAGACCTTGG + Intronic
1134754204 16:16651784-16651806 CACACCTAATGCTCAGATCTTGG + Intergenic
1134899363 16:17922049-17922071 CACACCTAAGGCTCAGATCTTGG + Intergenic
1135661335 16:24299518-24299540 CACACCCAGCACTCAGATCTTGG - Intronic
1139031454 16:62886769-62886791 AACACCTAGCACTCAGATCTTGG - Intergenic
1141047212 16:80726615-80726637 AATACCTAGCATTCAGATCTTGG + Intronic
1143743468 17:8972152-8972174 CACACCTAGCTTCCAGATCTTGG + Intergenic
1146191770 17:30774158-30774180 CACATCTAACATGCAGATTTTGG - Intronic
1146336943 17:31980834-31980856 CACATCTAACATGCAGATTTTGG - Intronic
1146821824 17:35989424-35989446 CACACCAAGCACTCAGATTTTGG - Intronic
1149388423 17:56165619-56165641 TAGACCAAACGTTCAGATGTTGG + Intronic
1149414415 17:56444288-56444310 TTCACCTAACATTCAACTGTAGG + Intronic
1149619149 17:58029113-58029135 CACACCTAGCACCCAGATCTTGG + Intergenic
1150372008 17:64647121-64647143 TGCACCTAACACTGAGATGTAGG - Intronic
1150506596 17:65704726-65704748 CACACCTCACATTCACATGACGG + Intronic
1151006607 17:70445005-70445027 CACAACTAGCATCCAGATTTTGG + Intergenic
1151805683 17:76403696-76403718 CACACCTAGCATCCAGATCTTGG + Intronic
1152792268 17:82287661-82287683 CACACTTAGCCTTCAGATCTTGG + Intergenic
1153145014 18:2021421-2021443 CGCAGCTAGCATTCAGATCTAGG - Intergenic
1153856940 18:9159142-9159164 CACACCTAAAATGCAGATCTTGG - Intronic
1154397175 18:14001499-14001521 CACACCTAACATCCAGGCCTTGG - Intergenic
1154936388 18:21062128-21062150 CACACCTAGCACCCAGATCTTGG + Intronic
1156191874 18:34729567-34729589 CACACTTTAAAATCAGATGTAGG + Intronic
1156349250 18:36288879-36288901 AACTCCTATTATTCAGATGTTGG - Intergenic
1156908669 18:42384980-42385002 CAAACCTAACACTCAAATATAGG + Intergenic
1157876694 18:51280490-51280512 CACACCTGCCATTTTGATGTGGG - Intergenic
1158223687 18:55178206-55178228 GACACTTAAAATTCAGATCTTGG + Intergenic
1158353398 18:56589051-56589073 CATAGCTAACACTCAGATCTTGG + Intergenic
1158509468 18:58077730-58077752 CTCACCTAAAATGCAGAGGTGGG + Intronic
1158995972 18:62920085-62920107 CCCACCTAACCTTCTGATGAAGG + Exonic
1162776735 19:12984371-12984393 CACACCAGACATTCAGACATGGG - Intergenic
1162845701 19:13390848-13390870 CAAACCTTACATCCAGATGCTGG - Intronic
1163056880 19:14726558-14726580 AACAGCTTACAGTCAGATGTGGG - Intronic
1164512623 19:28910044-28910066 CACACCTCACATCCTGATGTGGG + Intergenic
1165661905 19:37588349-37588371 CACTCCTATCATTAAAATGTTGG + Intronic
925506030 2:4565063-4565085 CACACCTAATGCTCAGATGTTGG - Intergenic
926448714 2:12975879-12975901 GACACCTAGCATACAGATTTGGG + Intergenic
926555762 2:14356072-14356094 CACACCTATCACCCAGATCTTGG + Intergenic
927089230 2:19697924-19697946 CACACCCAACATTCAATGGTGGG + Intergenic
928545406 2:32324782-32324804 AACACGTAACATCCAGATCTTGG + Intergenic
928650523 2:33399514-33399536 TTCCCCTAACATTCATATGTGGG + Intergenic
930537319 2:52659727-52659749 CATACCTAACATCCAGATCATGG + Intergenic
930980691 2:57523177-57523199 AACAACTTACACTCAGATGTGGG + Intergenic
931050119 2:58403991-58404013 CACACCTAACACCTAGATCTTGG + Intergenic
931211380 2:60199639-60199661 CACACCTATGACTCAGATCTTGG + Intergenic
934577126 2:95409942-95409964 TACACCCGACATCCAGATGTTGG - Intronic
934639429 2:96018608-96018630 TACACCTGACATCCAGATGTTGG - Intergenic
934794224 2:97086777-97086799 TACACCTGACATCCAGATGTTGG + Intronic
936253907 2:110892459-110892481 AACACCTGACATCCAGATGTTGG + Intronic
936630340 2:114195235-114195257 CACACGTAACATCCAAATCTTGG - Intergenic
938409081 2:131048914-131048936 CACATCCAACAGTCAGCTGTCGG + Exonic
938473338 2:131586061-131586083 CTCACCCCACATTCAGAGGTGGG + Intergenic
939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG + Intergenic
941411100 2:165158061-165158083 CACAGCTAGCACTCAGATCTTGG - Intronic
941529536 2:166649858-166649880 CACACACCAAATTCAGATGTTGG + Intergenic
942233937 2:173886015-173886037 CACACCTACCACCCAGATCTTGG + Intergenic
942347496 2:175018395-175018417 CACCCCTCACAGTAAGATGTGGG + Intergenic
943562077 2:189476230-189476252 CCCCCCTAAAATTCAAATGTTGG + Intergenic
944609809 2:201391088-201391110 CACACCTAACACCCAGATCTTGG + Intronic
944757611 2:202780257-202780279 CACACCCAACATTGTGATTTTGG + Intronic
945510626 2:210697987-210698009 TACACATAGCACTCAGATGTTGG - Intergenic
946529331 2:220554788-220554810 CACATCTAATACCCAGATGTTGG + Intergenic
947702914 2:232250090-232250112 AACTCCAAACATTCAGAAGTAGG + Intronic
1169982567 20:11402698-11402720 CACATCTAACATCCAGATCTTGG + Intergenic
1170286256 20:14712957-14712979 AACACCTAACAACAAGATGTTGG - Intronic
1172892315 20:38275079-38275101 CACACTTAACATCCAGGTTTTGG + Intronic
1173269686 20:41521678-41521700 TACACCTAACACTCAGATCTTGG + Intronic
1173379024 20:42520719-42520741 CACAACTAGCATGCAGATCTTGG - Intronic
1173470460 20:43319689-43319711 CCCACATAACAGTCAGAGGTGGG - Intergenic
1175002744 20:55647246-55647268 AACACCTAACATTAAATTGTTGG + Intergenic
1175369483 20:58478291-58478313 CACACCTAGCACCCAGATCTTGG - Intronic
1176700349 21:10040452-10040474 CACATCTAGCATTCAAATCTTGG - Intergenic
1177538082 21:22455453-22455475 CACACCTAAAATACAGATTCAGG - Intergenic
1177952474 21:27555728-27555750 CACACTTAACATCCAGTTCTTGG - Intergenic
1178995037 21:37391166-37391188 CACACCTAACATTCAGACATAGG - Intronic
1179422562 21:41248354-41248376 CTCACCTCAGATTCGGATGTGGG - Intronic
1179556923 21:42184961-42184983 CACACTGAACAATCAGATTTGGG - Intergenic
1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG + Intronic
950586083 3:13893357-13893379 CACACCTAACATACTGCCGTTGG - Intergenic
951639663 3:24822522-24822544 CACACTTAGCATCCAGATCTTGG - Intergenic
951760323 3:26140543-26140565 CACCCCCTACATTCATATGTTGG + Intergenic
951926964 3:27918012-27918034 CATACTTAACACTCAGATCTTGG - Intergenic
952922843 3:38298329-38298351 CACACCTAGTACTCAGATATTGG - Intronic
955312672 3:57905084-57905106 GACACCAAACATTTAGATCTTGG - Intronic
956236230 3:67074457-67074479 CACACCTAGCACACAGATGATGG + Intergenic
956660236 3:71590400-71590422 CACACCTAGCACCCAGATCTTGG + Intergenic
957348751 3:78995895-78995917 CAGGCCAGACATTCAGATGTGGG + Intronic
957491045 3:80927294-80927316 CACTCCCAAAATTCACATGTTGG - Intergenic
957583162 3:82102738-82102760 CACACTTAACATCCAGATGTTGG - Intergenic
959476328 3:106816524-106816546 CAGCCTTAACATTCAGAGGTGGG - Intergenic
961857612 3:129888417-129888439 CACACCTATCACCCAGATCTTGG + Intronic
962585235 3:136836040-136836062 CACACCTAGCATCCAGATCTTGG - Intronic
963492464 3:146018439-146018461 CATGCCTAACATGCAGATGCTGG - Intergenic
964238475 3:154562831-154562853 CACACCTAACACACAGATCTTGG - Intergenic
964580946 3:158237250-158237272 AACACCTAACAGTCAGTTTTTGG + Intronic
966685593 3:182691354-182691376 CACACCTAGCACCCAGATCTTGG + Intergenic
967327054 3:188251421-188251443 CACACCTAGCACTCAGATATTGG - Intronic
969726885 4:8924219-8924241 GACATCAAAAATTCAGATGTGGG + Intergenic
969989086 4:11241940-11241962 CACACCTAGCACTCAGCTTTTGG + Intergenic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
974351951 4:60759822-60759844 CACACTTAACTCTCAGATCTTGG + Intergenic
974861201 4:67523739-67523761 CACACCTAGCACTCAGATCTTGG + Intronic
975298380 4:72760775-72760797 CAAGCCTAAGATTCAAATGTAGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
979070082 4:116191796-116191818 TACAACTAACAATCAGATGGGGG + Intergenic
980203194 4:129682655-129682677 CACACCTAGCATACAGAATTTGG + Intergenic
981020868 4:140026757-140026779 CTCACCTAACATTAAAATATGGG + Intronic
981659407 4:147148236-147148258 CACACCTAACACTCACATCTTGG - Intergenic
981705297 4:147653139-147653161 CAGACCTATCATTAAGATCTTGG + Intronic
981824389 4:148923567-148923589 GTCAACTAACATTCACATGTAGG - Intergenic
982021189 4:151206590-151206612 CATACCTAACATACTCATGTTGG - Intronic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
987555630 5:19443669-19443691 AACACCAAACATTCAGATTACGG - Intergenic
989110047 5:37898532-37898554 CACACCTAGCACTCAGATATTGG - Intergenic
989467509 5:41774369-41774391 CACACCTAGCACCCAGATCTTGG + Intronic
989511177 5:42289186-42289208 CACAGCTAACTTTCATGTGTGGG - Intergenic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
990878646 5:60516908-60516930 CACCCCTCACACTCAGAAGTGGG - Intronic
992847386 5:80764892-80764914 CACACTGAACATGCAGCTGTGGG - Intronic
993121155 5:83775587-83775609 CACCCCTAAAATTCATGTGTTGG - Intergenic
993346586 5:86791210-86791232 CACACCTAGCTTCCAGATCTTGG - Intergenic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994514945 5:100759547-100759569 CACCCCGACCATTCAGATGGTGG + Intergenic
994746063 5:103679918-103679940 CAGACATCACCTTCAGATGTGGG + Intergenic
996384215 5:122893413-122893435 CACACCTACCACGCAGATCTTGG - Intronic
997800762 5:136858938-136858960 CACACCTAGAATCCAGATCTTGG - Intergenic
998054065 5:139058885-139058907 CACACCTAGCATCCAGATCTTGG - Intronic
998748387 5:145288578-145288600 CACACCTAACATACAGATGCTGG - Intergenic
999788216 5:154911523-154911545 CATACCTAGCACTCAGATCTTGG - Intronic
999993510 5:157069968-157069990 CTGACCTAACATCCAGATCTTGG - Intergenic
1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG + Intronic
1001749021 5:174114124-174114146 CACAGCTAACATCCAGAACTGGG - Intronic
1002405507 5:179027148-179027170 CACACCTGACAGTCAGGTTTCGG - Intronic
1003139893 6:3462510-3462532 CACACCTAGCACCCAGATCTTGG + Intergenic
1003913244 6:10761565-10761587 CATACCTAGCACTCAGATATTGG - Intronic
1005176843 6:23056608-23056630 CACACCTAACTCCCAGATGTTGG + Intergenic
1006658226 6:35615301-35615323 CAAACCTAGCACTCAGATCTTGG + Intronic
1007341606 6:41194290-41194312 CCCACCTCACATTCAGAAGCAGG + Intronic
1008460218 6:51760446-51760468 CACATCTTACGTTCAGATGATGG + Intronic
1010205578 6:73319950-73319972 CACACCTAATACTCAGATTTTGG + Intergenic
1010372109 6:75122370-75122392 CAAACGTACCACTCAGATGTGGG + Intronic
1013204281 6:107932788-107932810 CACATCTAGCATGCAGATCTTGG + Intronic
1013699877 6:112752927-112752949 CACACATAGCACTCAGATATTGG - Intergenic
1015183457 6:130386073-130386095 AACAACTAACATTCAGTTTTGGG + Intronic
1015185583 6:130412232-130412254 CACACCCATCATTCAGACCTTGG - Intronic
1016717423 6:147250635-147250657 CACACCCAGCATGCAGAGGTGGG - Intronic
1019348184 7:540705-540727 CACAGGGAACACTCAGATGTTGG - Intergenic
1019926707 7:4197784-4197806 CGCTCCTGACCTTCAGATGTGGG + Intronic
1021362886 7:19738490-19738512 CACACCTATCACCCAGATCTTGG + Intronic
1023617885 7:42039220-42039242 TTCACCTAAAATTCATATGTTGG + Intronic
1028467336 7:91167725-91167747 CAAACCTAGCATTCACATGTAGG - Intronic
1028783691 7:94767690-94767712 CACACTTAACATGTAGATCTTGG - Intergenic
1032730231 7:134634431-134634453 CACACCTAATGCTCAGATTTTGG + Intergenic
1032818137 7:135498127-135498149 CAGAGCCAACATTCATATGTAGG + Intronic
1038370924 8:26989584-26989606 AACTCCTATTATTCAGATGTTGG - Intergenic
1038469802 8:27805602-27805624 CACACCTACCACCCAGATCTTGG + Intronic
1040460727 8:47645304-47645326 AACAGCTAAAAATCAGATGTGGG + Intronic
1042400240 8:68336690-68336712 CACACCTAGCATCCACATTTTGG + Intronic
1043432016 8:80204439-80204461 CACACCTACCATCCAGATCTTGG + Intronic
1043707629 8:83372213-83372235 CACACCTAGTATTCAGATCTTGG + Intergenic
1044708425 8:95031184-95031206 CACACCTAGCACCCAGATCTTGG - Intronic
1047329248 8:123871300-123871322 CACACCTGGCACTCAGATCTTGG + Intronic
1047380101 8:124353549-124353571 CACACCTAACACCCAGATCTTGG + Intronic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1048388157 8:133933021-133933043 CACACCTAACACTCAGATCTTGG - Intergenic
1050243506 9:3662113-3662135 CACAGCTAGCATTCAAATGCAGG - Intergenic
1050297439 9:4219890-4219912 CACACCCAGCACTCAGATCTTGG + Intronic
1050716860 9:8538806-8538828 CACACCTTGTATTCAGATCTTGG + Intronic
1051477796 9:17527693-17527715 CACACCTAGCACTCAGATTTTGG + Intergenic
1053274483 9:36772874-36772896 CTCAGCTAACAGTCAGGTGTGGG - Intergenic
1053637551 9:40027274-40027296 CACATCTAGCATTCAAATCTTGG - Intergenic
1053768530 9:41437965-41437987 CACATCTAGCATTCAAATCTTGG + Intergenic
1054318339 9:63623844-63623866 CACATCTAGCATTCAAATCTTGG - Intergenic
1054547198 9:66349446-66349468 CACATCTAGCATTCAAATCTTGG + Intergenic
1055787160 9:79883579-79883601 AACACCTGAGATTCAGTTGTTGG - Intergenic
1056683746 9:88742583-88742605 CACTCCCACCCTTCAGATGTGGG - Intergenic
1056775570 9:89509999-89510021 AGCTCCTGACATTCAGATGTTGG + Intergenic
1057841947 9:98493355-98493377 CACACCTAACACCCAGATTTTGG - Intronic
1058041972 9:100312562-100312584 CACACCTAAATTCCACATGTTGG + Intronic
1060395218 9:123312059-123312081 CTCACCTCACTTCCAGATGTTGG + Intergenic
1062480964 9:136751183-136751205 CACACCCAACACTCAGAGCTTGG + Intergenic
1202785359 9_KI270719v1_random:10517-10539 CACATCTAGCATTCAAATCTTGG - Intergenic
1186106590 X:6214150-6214172 CACTCCTGACATTCATATTTTGG - Intronic
1188311788 X:28626121-28626143 GAAACCTGACATTCAGAAGTAGG + Intronic
1189799116 X:44675652-44675674 CACAGCCAACCTGCAGATGTGGG + Intergenic
1192387675 X:70689378-70689400 CACAACTAACATTCAGATCTTGG + Intronic
1196299503 X:114038251-114038273 CACTCCTACCATTAAGATTTTGG - Intergenic
1197016325 X:121631000-121631022 CACACCTATCACCCAGATCTTGG + Intergenic
1197305209 X:124833092-124833114 CATACCTAACTTTTAGCTGTTGG - Intronic
1198008363 X:132523038-132523060 CACACCTAGCACTCAGATCTTGG + Intergenic
1199859285 X:151785672-151785694 CACACCTAACACTTAGATCTTGG - Intergenic