ID: 985520958

View in Genome Browser
Species Human (GRCh38)
Location 5:373748-373770
Sequence GCGGGCGCTCCGGGTGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985520958_985520969 13 Left 985520958 5:373748-373770 CCGTGTGCACCCGGAGCGCCCGC 0: 1
1: 0
2: 1
3: 2
4: 93
Right 985520969 5:373784-373806 CCCATTCCCCGCCACGCGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985520958 Original CRISPR GCGGGCGCTCCGGGTGCACA CGG (reversed) Intronic
901081548 1:6586736-6586758 GATGGAGCTGCGGGTGCACATGG + Exonic
901544186 1:9943291-9943313 GCGGGCGGTCAGGCGGCACAGGG - Exonic
901641527 1:10695234-10695256 GCCGGCGCTCCTGGGGCCCAGGG - Intronic
903263605 1:22143607-22143629 GCTGGCGCTCCGGGTGCCTGGGG + Intronic
906027134 1:42682931-42682953 GCGGCCGCGCGGGGTCCACAGGG - Intronic
909012918 1:70354462-70354484 GCTGGCGCTGCGGCGGCACAAGG + Exonic
914803046 1:150974438-150974460 GGGGGCGCTGCGGGCGCTCATGG - Intronic
922810829 1:228414679-228414701 CCGGGAGCACCGGCTGCACAGGG - Exonic
1063672719 10:8112387-8112409 GCAGGCGCTCCAGGCTCACAGGG - Intergenic
1076782971 10:132734671-132734693 CCGGGCACTCCTGGTGCCCAAGG - Intronic
1077018559 11:407380-407402 GCGGGCCCTCCGGGTGGGCGGGG + Intronic
1077058531 11:607670-607692 CCGGGAGCCCGGGGTGCACACGG + Exonic
1077591028 11:3491187-3491209 GCAGGAGCTTTGGGTGCACATGG - Intergenic
1078087433 11:8242686-8242708 GCGGGCTTTGCGGGTGCCCAGGG - Intronic
1083364608 11:62133906-62133928 GCGGGAGGTTGGGGTGCACAGGG - Intronic
1084246743 11:67862938-67862960 GCAGGAGCTTTGGGTGCACATGG - Intergenic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1092207039 12:6621083-6621105 GCGCGCGCTGCGCGTGCACTCGG - Exonic
1094405377 12:30110761-30110783 GCGGGAGTTCCGGGTGGGCAGGG - Intergenic
1094853598 12:34393183-34393205 TGGGGCGCCTCGGGTGCACAAGG + Intergenic
1096260134 12:50085288-50085310 GCGGGCGCTCGGGGGGCGCTCGG + Exonic
1096771763 12:53939728-53939750 GCGGGCGCGCCGGGGCCAGACGG - Intronic
1097307743 12:58087886-58087908 GCAGGCGCCCCGGGAGCCCAGGG + Intergenic
1114473743 14:22980766-22980788 CCGGGCGCTCCAGGTGCCCGCGG - Intronic
1122558222 14:102592765-102592787 GCGGGCGCGGCGGGAGCCCACGG - Exonic
1122776166 14:104117815-104117837 GCGGGCCCTCGGGGTGCAAGAGG - Intergenic
1122880855 14:104689861-104689883 GCGGGCGGTCCGGCGGCGCAGGG + Intronic
1124484573 15:30103502-30103524 GCGGGCACGCCGGGTGCGCGCGG + Intergenic
1124519008 15:30393736-30393758 GCGGGCACGCCGGGTGCGCGCGG - Intronic
1124539648 15:30572510-30572532 GCGGGCACGCCGGGTGCGCGCGG + Intergenic
1124759004 15:32435072-32435094 GCGGGCACGCCGGGTGCGCGCGG - Intergenic
1131056592 15:89378756-89378778 GCGGGCGCTTCGGGTTCGGAAGG - Intergenic
1132481011 16:166100-166122 GCGGGGTCTCCGGGAGCTCAGGG + Intronic
1132570616 16:642370-642392 GCGGGCGCTCCGGGCGCGGGGGG + Intronic
1141478697 16:84292017-84292039 GAGGGCGCTGCAGGGGCACAGGG + Intergenic
1142373318 16:89694832-89694854 GCGGGGGCTGCGGGCGCAGAGGG - Intronic
1142373330 16:89694866-89694888 GCGGGGGCTGCGGGCGCAGAGGG - Intronic
1143419199 17:6776010-6776032 GCCGGCGCTCCGGGTGAGGATGG - Intergenic
1145881755 17:28357445-28357467 GCGGGCGCTCGGGCGGGACATGG - Exonic
1146909850 17:36641639-36641661 GCGGGGGCTCCTGGAACACAAGG - Intergenic
1147219195 17:38918771-38918793 GGGGGCGCTGCGGGTTCAGATGG - Exonic
1147632693 17:41942299-41942321 GAGGGAGCTCCTGGAGCACATGG - Intronic
1151580142 17:74972828-74972850 GCGGGCGCTGCAGGTGCAGGAGG - Intronic
1151703799 17:75756580-75756602 GTGGGCTCTGCGGGTGCACCTGG - Exonic
1151966500 17:77434299-77434321 GCAGGCCCTGCGGGTGGACAGGG - Intronic
1158893562 18:61894210-61894232 GCGGGCGCGCCGGGACCACCCGG - Intronic
1160512495 18:79460482-79460504 GTGGGGGCTCCAGGCGCACACGG - Intronic
1161065887 19:2237053-2237075 GCGGGGCCTCAGGATGCACAAGG - Intronic
1161068982 19:2251168-2251190 GCGGGCGCTGCGGGTCCCCCCGG + Exonic
1163366838 19:16880161-16880183 GCGGGGTCTCCGGCTGCACCCGG - Exonic
1163582119 19:18145169-18145191 GCGGGCGATCCGCGTCTACATGG + Exonic
1165243155 19:34482604-34482626 GCGGGCGCTCGAGGCGCGCACGG + Exonic
1165854185 19:38870104-38870126 GCGGGGCCTCCGGGGGCACAGGG - Exonic
1167660181 19:50791760-50791782 GAGGCCGATCCCGGTGCACACGG + Exonic
925216829 2:2103633-2103655 GTGGGCTCTGCAGGTGCACAGGG + Intronic
928093766 2:28392156-28392178 GCGGGCGCCCCGGGCGCGCAGGG - Intergenic
931256902 2:60581872-60581894 GCGGGCGCCCCGGGTGGCCGAGG - Intergenic
932773588 2:74514629-74514651 GCGGCTGCTCCGGGTGCACAGGG + Exonic
947156214 2:227164725-227164747 GGGGGCGGTCCGGGCGCTCATGG - Exonic
949004586 2:241637853-241637875 GCGGGCGCTGCGGGAGCGCGGGG + Intronic
1183090546 22:35519143-35519165 GGGGGCACTCCTGCTGCACACGG + Intergenic
1185314134 22:50171461-50171483 GAGGCCTCTCCGGGTGCACTGGG + Intronic
1185366922 22:50441047-50441069 GCGGGCCTGCCGGGTGCATAGGG + Intronic
955971972 3:64445352-64445374 CCGGGAGCTCCGGCTGAACATGG + Intronic
961894863 3:130158672-130158694 GCAGGAGCTTTGGGTGCACATGG - Intergenic
966862972 3:184241008-184241030 GCGGGCTCTGCAGGGGCACATGG - Exonic
966915893 3:184583873-184583895 GCGGGCGATGCGGGGGCCCAAGG + Intronic
969004964 4:4011720-4011742 GCAGGAGCTTCAGGTGCACATGG - Intergenic
969300022 4:6292219-6292241 GCGTGCGCTCCAGGTGGGCAGGG - Intronic
969525040 4:7700040-7700062 GCGGGAGCCCTGGGGGCACACGG - Intronic
969747909 4:9088423-9088445 GCAGGAGCTTTGGGTGCACATGG + Intergenic
985520958 5:373748-373770 GCGGGCGCTCCGGGTGCACACGG - Intronic
986713224 5:10502793-10502815 GTGGGCCTTCTGGGTGCACACGG - Intergenic
991442837 5:66669298-66669320 GTGGGCGCTCCTGGTGGAGAAGG + Intronic
992676711 5:79112414-79112436 CTGGGCGCGCCGGGTGCAGAGGG - Intronic
992732744 5:79689591-79689613 GCGCGGGCTCCGGCTGCACCAGG - Intergenic
996478718 5:123949499-123949521 GCGGGAGTTCCGGGTGGGCATGG - Intergenic
999252362 5:150190376-150190398 GGGGGCGCTGGGGGTGCACCTGG + Intronic
1001533231 5:172479542-172479564 GCGGGGGCTCCCGGCGCAGAAGG - Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1003076733 6:2989044-2989066 GCAGGCGCTCCGGGCGCAGCTGG - Intronic
1013226678 6:108124080-108124102 GGGAGAGCTCCGGGAGCACAAGG + Intronic
1017770975 6:157644342-157644364 GTGGGGGCTCTGTGTGCACATGG - Intronic
1018208804 6:161460593-161460615 GCAGGAGTTCCGGGGGCACAAGG + Intronic
1020325093 7:6968211-6968233 GCAGGAGCTTTGGGTGCACATGG - Intergenic
1024639345 7:51316815-51316837 GCGGGGGCGCCGGGAGCGCAGGG + Intronic
1025145411 7:56496807-56496829 ATGGGAGCTCAGGGTGCACAAGG + Intergenic
1026740565 7:72976044-72976066 CCGGGGGCTCGGGGCGCACAGGG + Intergenic
1026797864 7:73377529-73377551 CCGGGGGCTCGGGGCGCACAGGG + Intergenic
1027103167 7:75389027-75389049 CCGGGGGCTCGGGGCGCACAGGG - Intergenic
1034491566 7:151395796-151395818 GCGGGTGTTCCGGGAGCACCGGG - Exonic
1037116687 8:15236851-15236873 GCGGAGGCTCCGGCCGCACACGG - Intronic
1049452553 8:142669931-142669953 GCGGCTGCTCCGGGTGAGCAGGG - Exonic
1051233842 9:14978484-14978506 GAGGGCAAACCGGGTGCACATGG - Intergenic
1057208145 9:93185242-93185264 GCGGGGGCTCCGGGGGCTCCCGG - Exonic
1185457247 X:317315-317337 CCGGGAGCTGCGGGTGCTCAGGG + Intronic
1200068816 X:153517917-153517939 GCGGGCGCGGCGCGGGCACAAGG + Intronic