ID: 985524130

View in Genome Browser
Species Human (GRCh38)
Location 5:393287-393309
Sequence AAGACAAGAATCTGTGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985524130_985524133 12 Left 985524130 5:393287-393309 CCGATGTCACAGATTCTTGTCTT 0: 1
1: 0
2: 0
3: 17
4: 269
Right 985524133 5:393322-393344 TACGTGTCTCATCCAGCCCAGGG No data
985524130_985524132 11 Left 985524130 5:393287-393309 CCGATGTCACAGATTCTTGTCTT 0: 1
1: 0
2: 0
3: 17
4: 269
Right 985524132 5:393321-393343 TTACGTGTCTCATCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985524130 Original CRISPR AAGACAAGAATCTGTGACAT CGG (reversed) Intronic
901249262 1:7761632-7761654 TAGACAAGAATTTTTGAAATTGG - Intronic
901282088 1:8045649-8045671 GAAACAAGAATCAGTGTCATCGG - Intergenic
902751463 1:18514575-18514597 AAGGCAAGATTCGCTGACATGGG + Intergenic
905304623 1:37008892-37008914 AAGAAAAGAATCAGGGAGATGGG - Intronic
906271163 1:44480053-44480075 AACACAAAGATATGTGACATTGG - Intronic
906977208 1:50588655-50588677 CAGTTAAGAGTCTGTGACATTGG + Intronic
909738707 1:79000681-79000703 AAGAAAAGAATTTCTGAAATTGG + Intronic
910783107 1:90963458-90963480 AAGACTAGAATCTGGGTCATTGG - Intronic
912158100 1:106947101-106947123 AATAGAAGAATATGTGACAGAGG - Intergenic
913387457 1:118274914-118274936 AAGAGAAGAATATGAGATATGGG + Intergenic
915615930 1:157038340-157038362 AAGACATGAATATGTGAGAAAGG - Intronic
916034236 1:160906678-160906700 AAGAAAAGTATCTGTGAAAATGG + Intergenic
916457402 1:164985095-164985117 GAAACAAGACTCTGAGACATTGG + Intergenic
917542087 1:175923930-175923952 GACACATTAATCTGTGACATTGG - Intergenic
917728426 1:177849751-177849773 CAGTCAAGATTCTGTGACCTTGG - Intergenic
919203266 1:194387124-194387146 AAGACAGTAATATCTGACATTGG - Intergenic
919781197 1:201222335-201222357 AGGACAAGATTCTGGGACTTTGG - Intronic
923107391 1:230865228-230865250 AGGACAAGAATCCAGGACATGGG + Intronic
1063861001 10:10307602-10307624 AAGCCAAGAATCTCTGGAATGGG - Intergenic
1064140049 10:12782839-12782861 AAGACAGGAAACTGAGGCATAGG + Intronic
1064506963 10:16041982-16042004 AAAACAAGTATCTGTGAGAGAGG + Intergenic
1064583370 10:16816198-16816220 AAGAAAATAATCTGGCACATTGG + Intronic
1064901574 10:20301455-20301477 GAGGCTAGAATCTGTGACTTAGG - Intergenic
1065397916 10:25261018-25261040 AGGACAAGAGTCTGTGATCTTGG - Intronic
1066323783 10:34332503-34332525 AAGACAAATAGTTGTGACATAGG + Intronic
1066512943 10:36122195-36122217 CATACAAGAAAATGTGACATGGG - Intergenic
1070096046 10:73339387-73339409 AACACAAGAAACTGTAACAAAGG + Intronic
1070237900 10:74649424-74649446 AAGACCAGCCTCTGTAACATAGG + Intronic
1070652193 10:78245517-78245539 AAGAGCAGAACCTGTGACAAAGG + Intergenic
1071189636 10:83084100-83084122 AAAACAAGACTATGTGACATTGG - Intergenic
1071307183 10:84309749-84309771 AAGAAAAGAATCTTTGTCAAGGG + Intergenic
1072401281 10:95104695-95104717 AAGATAAGAATCATTGACCTTGG + Intergenic
1073066374 10:100761791-100761813 CACACAAGAATCTGTCACAAGGG - Intronic
1073161403 10:101399862-101399884 ATGACAAGAAATTGTGAAATGGG - Intronic
1074974250 10:118567452-118567474 AAGCAAAGAATCTTTGTCATTGG + Intergenic
1075448408 10:122529891-122529913 AAGACAACAATCTGTGAACCTGG - Intergenic
1075605974 10:123808623-123808645 AAGAAAAGAATCTTCAACATAGG + Intronic
1075938268 10:126363335-126363357 ATGAAAATAATCTGTCACATTGG - Intronic
1076954631 10:133689961-133689983 AAGACAAGAGTCAGTCACCTGGG + Intergenic
1077797929 11:5510245-5510267 AAGACAGAAAACTGGGACATAGG - Intronic
1078676681 11:13424936-13424958 AAGACATGGAGCTGAGACATTGG + Intronic
1078853086 11:15181625-15181647 AACCCAAGAATCTGGGACTTTGG + Intronic
1080154529 11:29093384-29093406 AAGATAAGCCTCTGTCACATTGG - Intergenic
1080844607 11:36015685-36015707 AAGAAAGGAATCTGTGATGTTGG - Intronic
1082113300 11:48300495-48300517 AAAAAAAGAAGTTGTGACATTGG - Intergenic
1082661140 11:55912815-55912837 AAGAAAAGATTCTTTGAAATGGG - Intergenic
1086040833 11:82476410-82476432 AAGACAAAAATCAGTAAAATAGG - Intergenic
1086102885 11:83119828-83119850 AAGACAAGCACCTGTGATGTGGG + Intergenic
1086345107 11:85888124-85888146 AATACAAGAATATTTGTCATAGG - Intronic
1086607165 11:88709632-88709654 TAGACATGAATCTGTGGCACTGG + Intronic
1087367532 11:97239842-97239864 GAGGCAAGTATCTGGGACATAGG - Intergenic
1087773375 11:102235495-102235517 AACACAAAAAGCTCTGACATAGG + Intergenic
1089806183 11:121092952-121092974 GACAACAGAATCTGTGACATTGG - Intergenic
1089843069 11:121435573-121435595 AAGACAGGAAACTGTGAACTGGG - Intergenic
1090014359 11:123072770-123072792 GAGACAAAAATTTGTGACAAAGG - Exonic
1090721903 11:129482985-129483007 AGGACTAAAATATGTGACATTGG - Intergenic
1092176292 12:6410069-6410091 GAGAAAAGAATCAGTGACCTTGG - Intergenic
1092930786 12:13313734-13313756 AAAACAAAAATCTTTAACATGGG + Intergenic
1092944821 12:13442953-13442975 AAGACAAGCACCTCTGACTTTGG - Intergenic
1093526304 12:20107053-20107075 AAGAAAAGATTCTGTGAATTTGG - Intergenic
1094641443 12:32279725-32279747 AATACAAGCATCTGTCCCATGGG - Intronic
1095263689 12:40128468-40128490 AAGACAGAAATCATTGACATTGG - Intergenic
1096911684 12:54990514-54990536 AAGACAGGTATCTATGACTTAGG - Intergenic
1097861325 12:64521366-64521388 AAGAACAGAAACTCTGACATTGG - Intergenic
1099136898 12:78916852-78916874 AAGAAATGAATCTGTGAGAATGG - Intronic
1099138639 12:78941588-78941610 ATGACAAGATTCAGTGAAATAGG - Intronic
1099229601 12:80006730-80006752 AAAAAAAGAATCATTGACATCGG - Intergenic
1099629918 12:85129567-85129589 AAGACCAGGAAATGTGACATTGG + Intronic
1100117533 12:91325859-91325881 AATACAAGAATCTGTCAAAGAGG - Intergenic
1100514752 12:95316531-95316553 AAGCCAAGTATCTGTAAAATGGG - Intergenic
1104651105 12:130534685-130534707 AAGGACAGAATCTATGACATGGG - Intronic
1105524315 13:21162001-21162023 AAGAAAAGAATTTGTTTCATGGG - Intronic
1105629255 13:22145190-22145212 AATACAACAAGCTATGACATAGG + Intergenic
1107663266 13:42662053-42662075 AAGATAAGATTCATTGACATAGG + Intergenic
1112213648 13:97407122-97407144 AAGACATTAAACTGGGACATTGG - Intergenic
1112269098 13:97951944-97951966 AAAAAAAGAACCAGTGACATAGG + Intergenic
1112942822 13:104886043-104886065 CATGCAAAAATCTGTGACATTGG - Intergenic
1113945144 13:114039764-114039786 AACACAAGGGTCTGGGACATGGG + Intronic
1114171523 14:20277652-20277674 AAAACAAGACACTGTCACATGGG - Intronic
1115116856 14:29890935-29890957 ATCACAAGAAACTGTGACCTTGG - Intronic
1115151783 14:30294308-30294330 AAGAATAGAATATGTGACTTGGG + Intergenic
1115420269 14:33185882-33185904 AAGACAAGAGTCCGTGACCTTGG - Intronic
1115757601 14:36544750-36544772 AAAAAAAGGATCTGTGCCATTGG - Intergenic
1115759170 14:36560596-36560618 AAGACAAGTCTCTGTGAGGTTGG + Intergenic
1116203646 14:41832858-41832880 AAGAAAAGAATGTATGACAATGG - Intronic
1116422659 14:44751231-44751253 ATGACAAGTATGTGTGAGATGGG + Intergenic
1117916522 14:60683758-60683780 AAGACAAAAATCTCTGCCCTTGG + Intergenic
1117971224 14:61252815-61252837 GAGAAAAGAATCTGTGGCTTTGG - Intronic
1120076384 14:80163355-80163377 AAAATAAGAATCTTTGAAATGGG - Intergenic
1121288123 14:92752420-92752442 AAGGCAGGAATCTGTGGCCTTGG + Intergenic
1202849180 14_GL000225v1_random:5989-6011 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202850404 14_GL000225v1_random:13721-13743 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202850906 14_GL000225v1_random:18430-18452 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202853120 14_GL000225v1_random:33887-33909 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202854297 14_GL000225v1_random:41009-41031 AAGACAAGAGTCCGTCACGTGGG + Intergenic
1202855680 14_GL000225v1_random:50354-50376 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202856763 14_GL000225v1_random:56717-56739 AAGACAAGAGTCCGTCACTTGGG + Intergenic
1202858852 14_GL000225v1_random:68422-68444 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202861146 14_GL000225v1_random:82173-82195 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202863689 14_GL000225v1_random:101529-101551 AAGACAAGAGTCCATCACATGGG - Intergenic
1202863817 14_GL000225v1_random:102685-102707 AAGACAAGACTCAGTCACCTGGG - Intergenic
1202864638 14_GL000225v1_random:107691-107713 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202864965 14_GL000225v1_random:110688-110710 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1202865067 14_GL000225v1_random:111638-111660 AAGACAAGAGTCTGTCACCTGGG + Intergenic
1202866407 14_GL000225v1_random:121680-121702 AAGACAAGAGTCCATCACATGGG - Intergenic
1202866529 14_GL000225v1_random:122845-122867 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202867063 14_GL000225v1_random:127853-127875 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202867369 14_GL000225v1_random:130578-130600 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202868671 14_GL000225v1_random:139230-139252 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202922455 14_KI270723v1_random:37743-37765 AAGACAAGAGTCCATCACATGGG + Intergenic
1126368274 15:47918464-47918486 AAGAGAAGAATCTGTGTATTAGG + Intergenic
1126898756 15:53288969-53288991 AAGTCAAGTATTTGTTACATAGG - Intergenic
1127060502 15:55178056-55178078 AAGACAAAAATATAGGACATTGG - Intergenic
1127101902 15:55575098-55575120 AAGACACAACTCTGTGACCTTGG - Intronic
1127344932 15:58084866-58084888 AGGACAAGAATGTGTGAAGTTGG - Intronic
1131374832 15:91914987-91915009 AAGACAAGAGTCCTTGTCATGGG - Intronic
1131802508 15:96085751-96085773 ATGACAACAAACTGTGACTTAGG + Intergenic
1134010632 16:10849729-10849751 AAGAGAAGAATCCGAGACAGAGG + Intergenic
1134336058 16:13300677-13300699 GAGACAAGAGTCAGTGACACAGG - Intergenic
1134773002 16:16827112-16827134 AGGACAAGAATATTTGAAATTGG - Intergenic
1135472081 16:22740203-22740225 AAGACAAAAATCTGTATCAATGG - Intergenic
1137577411 16:49609633-49609655 AAAAAAAGAATCAGTGAAATAGG + Intronic
1139228504 16:65256960-65256982 AAAAGAAGATTCTGTAACATGGG + Intergenic
1142381881 16:89737532-89737554 AAGACAAGAATCTGTGGTTAAGG + Exonic
1144753919 17:17668241-17668263 TAGACAAGAATTTCTGACGTGGG - Intergenic
1146262864 17:31433150-31433172 AAGAAAAAAATCTGAGACAGTGG + Intronic
1146710720 17:35039205-35039227 AAGAAAAAAATCTGTCATATGGG - Intronic
1148024839 17:44579657-44579679 AATACGAGAAGCTGTGAGATGGG - Intergenic
1150713514 17:67551455-67551477 AACACAAGAAGCTGGGACAGAGG - Intronic
1152965160 18:107815-107837 AAGACAAGAGTCAGTCACCTGGG - Intergenic
1153205020 18:2689814-2689836 AAGACCAGCCTCTGTAACATAGG + Intronic
1153791432 18:8583088-8583110 GATACAAGAATCTGTTACTTTGG - Intergenic
1156329763 18:36109135-36109157 AAGAGAAGAATCTGAGAATTGGG - Exonic
1157848417 18:51025638-51025660 AAGAGAAGAATCTGTAGGATTGG + Intronic
1158972927 18:62685110-62685132 AAGCCAAGAATCTATTACATAGG - Intergenic
1159106761 18:64011141-64011163 AAGACAAAAATCTTTTAGATTGG + Intergenic
1162358617 19:10203356-10203378 AAAAAAAGAATCTTTGACAGTGG - Intronic
1164436134 19:28231378-28231400 AACACAAAAATCTGAGACAAGGG + Intergenic
1164503257 19:28836925-28836947 AAGACAAGAATATGTCACAATGG + Intergenic
1167870810 19:52368813-52368835 GAGACAAAATTTTGTGACATGGG + Intergenic
926731825 2:16041434-16041456 AAGACCAGACTCTGTGTCAGAGG + Intergenic
927323816 2:21779835-21779857 AAGAGCAGAATGTGTGATATGGG + Intergenic
929630034 2:43450326-43450348 AAGATATAAATCTGTGACATCGG + Intronic
930185284 2:48407142-48407164 AAGACAAGCATCTGTCCCACAGG - Intergenic
930740736 2:54830462-54830484 TAGAGAAGACCCTGTGACATAGG + Intronic
933045673 2:77533528-77533550 TACAGATGAATCTGTGACATGGG - Intronic
934219825 2:90072593-90072615 AAGAGAACATTCTGTGTCATGGG - Intergenic
937053946 2:118915195-118915217 AAGACAGGAATGTGGGAAATTGG - Intergenic
937840952 2:126524110-126524132 AAGCCAAGAATCTCTGTCACTGG + Intergenic
940620817 2:156110903-156110925 AAGACAAGCAGACGTGACATGGG - Intergenic
942123438 2:172801107-172801129 AAAACAAGGCTCAGTGACATAGG + Intronic
943792689 2:191952456-191952478 AAGAAAAGAATCTAAAACATAGG - Intronic
944877740 2:203980070-203980092 AATTCAAGAAATTGTGACATTGG + Intergenic
945231631 2:207596057-207596079 AAGAAAACACTCTCTGACATTGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
947134576 2:226964398-226964420 AAGCCAGGAAAGTGTGACATTGG - Intronic
1170833223 20:19861357-19861379 AAGCCAAGAATCTTTGTCAAGGG - Intergenic
1170909344 20:20549244-20549266 AAGGCAACAATCTGTAAAATGGG + Intronic
1171285362 20:23933041-23933063 ATGAGGAGAAACTGTGACATGGG - Intergenic
1172031388 20:31984522-31984544 TAGACAAGAATCAGTTACTTGGG + Intronic
1173025011 20:39299349-39299371 ATGCCAGGAATCTGTCACATGGG - Intergenic
1175061890 20:56251087-56251109 AATATAAGAATTTGTGACAGGGG - Intergenic
1178252644 21:31019336-31019358 AAAGCAAGAAAGTGTGACATGGG - Intergenic
1179214841 21:39358577-39358599 CAGACTAGAACCTGTGATATGGG + Intergenic
1184594468 22:45505411-45505433 AAGATGAGACTCTGTGCCATGGG + Intronic
1184622528 22:45692741-45692763 AAGCAAAGAATCTGAGTCATGGG + Intronic
949625570 3:5862966-5862988 GGGAGAAGAATCTGTGAAATTGG - Intergenic
949973812 3:9435547-9435569 AAAACAAGATTCTATGTCATTGG - Intronic
957430019 3:80092223-80092245 AAGCCAAGCATCTCTGAAATTGG + Intergenic
958093380 3:88906243-88906265 ACTACAAGAATCTGGGATATAGG + Intergenic
958488081 3:94737529-94737551 AAGCCTAAAATATGTGACATTGG + Intergenic
958724920 3:97893410-97893432 AAGTCAAGGATTTTTGACATTGG + Intronic
958948941 3:100396515-100396537 AAAAGAAGTATCTGGGACATTGG + Intronic
959019484 3:101172900-101172922 AACACAGGAATCTGAGACAGAGG - Intergenic
959499654 3:107091147-107091169 AAGACAAGGTACTGTGGCATGGG + Intergenic
959858350 3:111188216-111188238 CTGACAAGATTTTGTGACATTGG - Intronic
959984542 3:112558097-112558119 AAGTCAAGGATAAGTGACATAGG + Intronic
960326163 3:116298585-116298607 TAGTCATTAATCTGTGACATAGG + Intronic
961146770 3:124600331-124600353 AAACCAAGGATCTGTGACTTTGG - Intronic
962533653 3:136307094-136307116 AAGGAAAGAATCTGTGACTAAGG + Intronic
966194888 3:177303178-177303200 AAGAAAAGAAACTGTGACTCCGG - Intergenic
966506897 3:180714163-180714185 ATGGAAAGAATCTGTGAGATGGG - Intronic
966798111 3:183735394-183735416 AAGAGAAGCAGCTGTGACGTTGG - Intronic
969047834 4:4350456-4350478 AAGACAAGAATTAATTACATGGG - Intronic
971097340 4:23422671-23422693 ACAACAAGAATATGTGTCATAGG + Intergenic
971174594 4:24269292-24269314 AAGACAAGAATATTTGAGAGTGG + Intergenic
971894162 4:32569053-32569075 AAGAAGAGAATCTTTGACAAGGG - Intergenic
974932129 4:68371466-68371488 TGGACCAGAATCTGTGTCATGGG - Intergenic
975758828 4:77598012-77598034 AAGACAAGAAGCTGAGAAAAGGG + Intronic
976564227 4:86535065-86535087 TGGACATGAATCTGTGGCATTGG - Intronic
976577204 4:86687192-86687214 AATACAACACTCTGAGACATAGG - Intronic
976764117 4:88581179-88581201 AACACAAGAATCCCTGAAATGGG - Intronic
978708636 4:111748726-111748748 ATGAAAAGAAACTTTGACATCGG + Intergenic
980069793 4:128231719-128231741 TAGACAGGAATCTCTGATATAGG - Intergenic
980805244 4:137803919-137803941 AACACATGAATCTCTAACATGGG + Intergenic
981795696 4:148592917-148592939 AAGAGACTCATCTGTGACATAGG - Intergenic
983217358 4:165014306-165014328 GATAGAAGAATCTGCGACATTGG + Intergenic
983448895 4:167887188-167887210 AAGACAAGTATATGTAAAATAGG - Intergenic
985250438 4:188019033-188019055 AAGAATAGAATCTATGAAATTGG + Intergenic
985464315 4:190180073-190180095 AAGACAAGAGTCAGTCACCTGGG + Intronic
985464420 4:190181239-190181261 AAGACAAGAGTCTGTCACCTGGG + Intronic
985524130 5:393287-393309 AAGACAAGAATCTGTGACATCGG - Intronic
986029996 5:3884593-3884615 AGGACAAGTATCTGTCACAGGGG + Intergenic
987369876 5:17183318-17183340 CTTACAGGAATCTGTGACATAGG + Intronic
987858582 5:23454010-23454032 AAGACAACACTCTGTTACAGTGG + Intergenic
988113344 5:26852177-26852199 AAGAGGAGAAGATGTGACATAGG - Intergenic
988143483 5:27273571-27273593 AAGGAAAGAATCTGTGAACTTGG - Intergenic
988222982 5:28373251-28373273 AAAACATGAATCTATCACATGGG + Intergenic
988331498 5:29847106-29847128 GAGAAAAGAATGTGTTACATAGG - Intergenic
988351012 5:30106943-30106965 AAAACAAGAATCAAAGACATTGG - Intergenic
989908981 5:49599870-49599892 AAGACAAGAGTCCGTCACCTAGG + Intergenic
990087962 5:52002302-52002324 AACACAAGAATCTATGGCCTTGG - Intergenic
990532815 5:56690416-56690438 AAGACAAGATTCTGTAGCACAGG - Intergenic
990926852 5:61035634-61035656 AAGACACAAATCTGTGCCAGGGG + Intronic
993024502 5:82630173-82630195 AAGAAATTAATCTGTCACATAGG + Intergenic
993928259 5:93900310-93900332 AAGATAAGAATGTGATACATGGG + Intronic
994510293 5:100694505-100694527 AATGAAAGAATCTGTGAAATGGG - Intergenic
994694626 5:103058630-103058652 AAGCCAAGATTCTGTGAAAATGG - Intergenic
996879561 5:128280275-128280297 AAGCCAGGAATCTGTGAAAATGG - Exonic
997177190 5:131791508-131791530 AAGACAAGAAACAGAGAAATAGG + Intronic
997323269 5:132997037-132997059 GAGAAAAGAATGTGTTACATAGG - Exonic
997827064 5:137115991-137116013 TTGACAAATATCTGTGACATTGG - Intronic
999339165 5:150754031-150754053 AATACAAGAAGCTGTGAAACTGG + Intronic
1000552345 5:162682588-162682610 AAGACAGAAATCTGTAACTTTGG - Intergenic
1005160752 6:22859936-22859958 AAGATAAAAATGTGTGACAGAGG - Intergenic
1005719277 6:28585156-28585178 AAGAAAAGAAACTGTGAGATTGG - Intronic
1007132722 6:39491587-39491609 TAAACAAAAATCTGTAACATTGG + Intronic
1008726844 6:54431900-54431922 AAGACAAGAATATGTGGCCTAGG + Intergenic
1008931626 6:56946427-56946449 AAGAGAAGAGTTGGTGACATAGG + Intronic
1009545563 6:65015280-65015302 AACACAAGCATCTTTGAAATTGG - Intronic
1009888117 6:69649117-69649139 ATTACAAGAATCTGAGACTTGGG - Intergenic
1010161713 6:72864086-72864108 GATACAAGAATTTATGACATGGG - Intronic
1010197027 6:73250093-73250115 AAGACATGGATTTGTGACCTGGG - Intronic
1010370265 6:75099020-75099042 GAGACAAAAATCTCTGACAGAGG - Intronic
1010660498 6:78565267-78565289 GAGAGAAGCATCTGTGACAAGGG + Intergenic
1012390943 6:98739576-98739598 CAGCCAATAAGCTGTGACATAGG + Intergenic
1013713836 6:112933847-112933869 ATGACAAGAAGGTGTGATATGGG - Intergenic
1014489732 6:122046790-122046812 AAGAAAAGAATCAGTGAAGTAGG + Intergenic
1016602873 6:145882571-145882593 AAGACATAATTCTGTGACAAAGG + Intronic
1019271620 7:152413-152435 AAAAAAAAAATCTGTGACAATGG - Intergenic
1021673199 7:23053393-23053415 TAGATGAGAATCTGTAACATAGG - Intergenic
1023324745 7:39042010-39042032 AAGACAAGAGGCTGTGTCATAGG - Intronic
1023811352 7:43914700-43914722 GAGAAAAGAATCTGTGAACTTGG - Intronic
1024434085 7:49328697-49328719 AAATCAAGATTGTGTGACATAGG + Intergenic
1027533095 7:79360447-79360469 AACAAAAGAAGCTGTAACATAGG + Intronic
1031811799 7:126378962-126378984 ATGACAAAAAGCTCTGACATGGG + Intergenic
1033414515 7:141150291-141150313 AAGTCAAGAATATCCGACATTGG - Intronic
1033892682 7:146034575-146034597 AGGGCAAGAATCTGAGATATAGG - Intergenic
1034944352 7:155252336-155252358 AAAACAAGAAGCTGGGACCTTGG + Intergenic
1036429493 8:8676562-8676584 ATGACAAGAGTCTGTGAGAATGG + Intergenic
1036542299 8:9728898-9728920 AAGACAAGAAGCTTTCACACAGG - Intronic
1038148466 8:24919848-24919870 AAAATGAGATTCTGTGACATAGG + Intergenic
1038561987 8:28588792-28588814 AAAAAAAGAATCTGTGATGTGGG - Intergenic
1038873385 8:31520580-31520602 TAGATAAGAATCTGTGCCCTGGG + Intergenic
1039652558 8:39358088-39358110 AAAGAAAGAATCTGTGAAATAGG + Intergenic
1040589497 8:48777562-48777584 AAGAAAAGTCTGTGTGACATAGG - Intergenic
1043531543 8:81156701-81156723 AGCCCAAGAAGCTGTGACATGGG - Intergenic
1043784187 8:84376505-84376527 AAGACAGAAATCTGTGTTATGGG + Intronic
1044925793 8:97207816-97207838 AAGGCTAGAATGTATGACATGGG + Intergenic
1046174020 8:110551133-110551155 AAGACAAGCTTGGGTGACATAGG + Intergenic
1047645557 8:126866312-126866334 AAGAGAAGAATCTGTCCCAAGGG - Intergenic
1051496197 9:17726004-17726026 ATGGCAAGAATCTGTGGCACTGG - Intronic
1054996300 9:71394672-71394694 GAGAAAAGATTGTGTGACATAGG - Intronic
1055308745 9:74956359-74956381 AAGACTACAATCAGTGACCTAGG - Intergenic
1058592567 9:106581378-106581400 AAGAGAAGAATCTGTCTTATAGG + Intergenic
1203735888 Un_GL000216v2:139032-139054 AAGACAAGAGTCTGTCACCTGGG + Intergenic
1203736103 Un_GL000216v2:141025-141047 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1203737373 Un_GL000216v2:149486-149508 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1203737589 Un_GL000216v2:151399-151421 AAGACAAGAATCCGTCACCTGGG + Intergenic
1203737812 Un_GL000216v2:153449-153471 AAGACAAGAGTCCGTCACCTGGG + Intergenic
1203739261 Un_GL000216v2:164387-164409 AAGACAAGAGTCTGTCACCTGGG - Intergenic
1203739687 Un_GL000216v2:168326-168348 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1203740507 Un_GL000216v2:173328-173350 AAGACAAGACTCAGTCACCTGGG + Intergenic
1203740630 Un_GL000216v2:174484-174506 AAGACAAGAGTCCATCACATGGG + Intergenic
1185664613 X:1755761-1755783 AAGACAAGTATCTGTCTCTTTGG + Intergenic
1187942719 X:24397820-24397842 ATGACAAGCATCAGTTACATGGG - Intergenic
1188661009 X:32758624-32758646 AAGGCAAGAATCTCAGACTTCGG + Intronic
1189422221 X:40866373-40866395 AAGACCAGAATATTTAACATAGG + Intergenic
1189615881 X:42783718-42783740 AAAACAAGGATTTGTGACATGGG + Intergenic
1197626822 X:128811317-128811339 AATCCAAGAGTCTGTCACATAGG + Intergenic
1201125057 Y:10905396-10905418 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1201177728 Y:11320184-11320206 AAGACAAGAGTCCGTCACATGGG + Intergenic
1201178804 Y:11326682-11326704 AAGACAAGAGTCCGTAACCTGGG + Intergenic
1201179086 Y:11329280-11329302 AAGACAAGAGTCTGTCACCTGGG + Intergenic
1202623852 Y:56837600-56837622 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202624704 Y:56845510-56845532 AAGACAAGAGTCCGTCACCTGGG - Intergenic
1202625034 Y:56848389-56848411 AAGACAAGAGTCCGTCACCTGGG - Intergenic