ID: 985525513

View in Genome Browser
Species Human (GRCh38)
Location 5:399487-399509
Sequence CTCTGTGACTGGAGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985525513_985525521 7 Left 985525513 5:399487-399509 CCATTTGCCCTCCAGTCACAGAG 0: 1
1: 0
2: 0
3: 26
4: 250
Right 985525521 5:399517-399539 GTGCTGCCCTGATCACTGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 128
985525513_985525520 6 Left 985525513 5:399487-399509 CCATTTGCCCTCCAGTCACAGAG 0: 1
1: 0
2: 0
3: 26
4: 250
Right 985525520 5:399516-399538 GGTGCTGCCCTGATCACTGGAGG 0: 1
1: 0
2: 2
3: 17
4: 252
985525513_985525524 14 Left 985525513 5:399487-399509 CCATTTGCCCTCCAGTCACAGAG 0: 1
1: 0
2: 0
3: 26
4: 250
Right 985525524 5:399524-399546 CCTGATCACTGGAGGGTGCCTGG No data
985525513_985525519 3 Left 985525513 5:399487-399509 CCATTTGCCCTCCAGTCACAGAG 0: 1
1: 0
2: 0
3: 26
4: 250
Right 985525519 5:399513-399535 GCGGGTGCTGCCCTGATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985525513 Original CRISPR CTCTGTGACTGGAGGGCAAA TGG (reversed) Intronic
900744978 1:4354962-4354984 CTCTGTGCCTGGTGAGCACAGGG + Intergenic
901679376 1:10904273-10904295 CCCAGTGTCTGGAGGCCAAACGG + Intergenic
901921205 1:12539159-12539181 CACTCTGCCTGGAGGGCAAGTGG - Intergenic
902191824 1:14769101-14769123 CACTGTGAATGGACAGCAAAGGG - Intronic
902220748 1:14963079-14963101 CTCTGTGCCTTGTGGGCTAAAGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905471567 1:38196096-38196118 CTGTGTGACTGGGTGCCAAATGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
910329301 1:86051546-86051568 CTGTGTGATTGGTGGGCAAGAGG + Intronic
910360034 1:86406800-86406822 CTCTGTGACTGTCAGGTAAAAGG - Intergenic
910579843 1:88811131-88811153 CTCAGCAACTGAAGGGCAAATGG - Intronic
912370125 1:109167378-109167400 CTCTGTCAATGGAGAGGAAATGG + Intronic
912518222 1:110228876-110228898 CTCTGGAACCGGAGAGCAAAGGG + Intronic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
917272169 1:173289077-173289099 CTCTGTGAGTTGAGGGGAACAGG + Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920304779 1:205011590-205011612 CTCTGTAGCTGGAGGGCAAGAGG - Intronic
923746092 1:236701471-236701493 CCCTGTGACTGGAGGGCTGTGGG + Intronic
924416183 1:243859136-243859158 CACTAACACTGGAGGGCAAAAGG + Intergenic
1062858459 10:791390-791412 CTCTGTGACTCGCTGGCAACAGG - Intergenic
1063181104 10:3601268-3601290 TTCTGTTACTGGAGCACAAATGG - Intergenic
1063560543 10:7122268-7122290 CTCTGTGACTGCAGGCCACCAGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067925775 10:50506726-50506748 CTCTGTGACAGGAAGTAAAAAGG + Intronic
1069951966 10:72025223-72025245 CTCCCAGACTGGAGGGCAGAAGG + Intergenic
1070634211 10:78110970-78110992 CCTTGTGACTTGAGGACAAATGG - Intergenic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1070931452 10:80263972-80263994 CTCTGGGAATGGAGGGGAAGAGG + Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1073470381 10:103718462-103718484 CCTTATGACTGCAGGGCAAAGGG + Intronic
1074706033 10:116132777-116132799 CTCAATGACTTGAGGGCACAGGG + Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075763655 10:124875911-124875933 CTCTGGCACTGGAGGAGAAAGGG - Intergenic
1077919549 11:6632360-6632382 CTCTGTGGCTCCAGGCCAAAGGG + Exonic
1079133129 11:17761112-17761134 CTCACTGACTGGAGGCCACAGGG + Intronic
1079452523 11:20609659-20609681 TCCTGTGACTGCTGGGCAAAAGG + Intronic
1081212837 11:40357297-40357319 CTCTGAGACTGGAGGAGAACAGG + Intronic
1083911343 11:65712100-65712122 CCCTGTGACTCGGGGGAAAACGG - Exonic
1085314434 11:75535824-75535846 CTCTGTGACTGACGGGCTATAGG - Intergenic
1085483470 11:76841984-76842006 CTCTGGAACTGCAGGGGAAATGG - Intergenic
1085638760 11:78178084-78178106 CTCTGTGACTGGATAGGTAAGGG - Intronic
1090398305 11:126433404-126433426 CCCTCTGGCCGGAGGGCAAATGG - Intronic
1092484534 12:8891037-8891059 ATCTGGGAGGGGAGGGCAAAGGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096394723 12:51257110-51257132 GGCTGTGACTGGAGGGGAAAGGG + Intronic
1097025856 12:56054965-56054987 ATGGGTGACTGGAGGGCAAATGG + Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1102570493 12:113824381-113824403 CTCTTTTCCTGGAGGGCCAAGGG - Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1108249726 13:48551985-48552007 CTCTGTGACTGGCTGGCACTTGG + Intergenic
1108294270 13:48997598-48997620 CTCTCTGCCTTGAGGACAAAAGG + Intronic
1109077690 13:57858606-57858628 CTGTGGGATTGGAGGGCAAGAGG + Intergenic
1110904011 13:80862717-80862739 GTGTGTGTCTGGAGGGCTAAAGG + Intergenic
1111838614 13:93421164-93421186 CTGTGAGACTGTTGGGCAAATGG + Intronic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1114364749 14:22014031-22014053 CTCTGGCACTGCAGGCCAAAAGG - Intergenic
1117108287 14:52421188-52421210 CTCTGACACAGGAGGGAAAATGG - Intergenic
1118872155 14:69752480-69752502 ATCTCTGTCTGGAGGGGAAAGGG + Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1119808456 14:77498026-77498048 CTCAGTGACTGGAAGACACAGGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121794962 14:96727230-96727252 CTCTCTGACTGGAATGCAGAAGG - Intergenic
1122856956 14:104564442-104564464 CTCCATCCCTGGAGGGCAAATGG + Intronic
1122862795 14:104590032-104590054 CACCCTGACTGCAGGGCAAAGGG - Intronic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124905656 15:33866156-33866178 CTCTGTGACTGCTGGGAAAGGGG + Intergenic
1129339430 15:74875337-74875359 CCCTGAGACAGGAGGGCACAAGG - Intergenic
1130834664 15:87638114-87638136 AGTTGTGACTGGAGGTCAAATGG - Intergenic
1131300573 15:91196268-91196290 CTCTGTGTCTAGAGGGCGAGAGG + Intronic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1135821524 16:25690899-25690921 AGCTGTGGCTGGGGGGCAAATGG + Intergenic
1136241590 16:28947903-28947925 CTGTGTGACTGTGGGGCAACAGG + Intergenic
1137881753 16:52056375-52056397 CTCTGTTGCTGTAGGGCAAAAGG + Intronic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1139149546 16:64364530-64364552 CTATGTCACTGGATTGCAAAGGG + Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1146427994 17:32762206-32762228 CCCTGTGACTGGAAGGAGAAAGG + Intronic
1146993197 17:37294810-37294832 CTCTGAGACTGGACCCCAAAGGG - Intronic
1147952783 17:44116303-44116325 CTCTGAGGCTGGATGGCGAAGGG - Intronic
1148892813 17:50820169-50820191 CTTTGTGCCTGCAGGGCACAGGG - Intergenic
1148954634 17:51343519-51343541 TTCAGTGACTGGAGGGTGAAAGG - Intergenic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1151030093 17:70727499-70727521 TTCTGTGCCAGGAGGGCACACGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152486993 17:80601009-80601031 GGCTGTGACTGGATGGGAAATGG + Intronic
1152701380 17:81821579-81821601 CTCGGTGAGTGGAAGGCACATGG + Intergenic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1155125086 18:22866353-22866375 CTTTGTGACTGTAGGGCTGAGGG - Intronic
1157719883 18:49915540-49915562 CTCGGTGAGTAAAGGGCAAAGGG - Intronic
1157990101 18:52484849-52484871 TTCTGTGACTGGAGAGAGAAGGG - Intronic
1159137177 18:64350073-64350095 CTCTCTGACAAGATGGCAAAGGG - Intergenic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162265153 19:9567063-9567085 CTCTGTGACTTTATGGAAAATGG - Exonic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165837803 19:38770229-38770251 CACTGTGACGGGAGGGGAAGCGG - Intergenic
1165841763 19:38792468-38792490 CACTGTGACGGGAGGGGAAGCGG + Intergenic
1166571376 19:43799028-43799050 CGCTGAGACTGGAGGGAGAAGGG - Intronic
1167493891 19:49806967-49806989 CTCTGTGCTTGGGGGGGAAAGGG - Exonic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
929394378 2:41505740-41505762 CTCTGTGACAGGAAGCTAAAGGG + Intergenic
929636523 2:43527934-43527956 CTCTGTGCCTGGACTGCAAAAGG + Exonic
929938952 2:46315773-46315795 CTCTGAGGGTGGAGGGCAAGAGG + Intronic
931107721 2:59075082-59075104 ATCTGTGACAGGACTGCAAAAGG - Intergenic
932217566 2:69976701-69976723 CTCTGTGCCTGGAGGGGGAAAGG - Intergenic
932442231 2:71744787-71744809 CTCTGTGATTGCAGTGCACATGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934916645 2:98305653-98305675 CTCCGTGACTTGTGGGTAAAAGG - Intronic
936010153 2:108920358-108920380 CTCTGTTACGGCAGGGCAACGGG + Intronic
937496404 2:122425152-122425174 CTCAGTGAGTGAAGGGGAAAGGG + Intergenic
938317155 2:130337790-130337812 CCCTGTGACTGCAGGAAAAACGG - Intergenic
938777304 2:134553345-134553367 CCTTGTAACTGGAGGGCACAAGG - Intronic
940537502 2:154964863-154964885 CTCTGAGAATGGAGTGTAAATGG + Intergenic
942212625 2:173686653-173686675 CAGTGTGATTGGAGGACAAAGGG - Intergenic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
944063968 2:195599862-195599884 GTCAGTGGGTGGAGGGCAAAGGG - Intronic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
945997217 2:216447736-216447758 CTCTGTGAGTGCAGTGCCAATGG + Intronic
946054371 2:216888075-216888097 CTCTTTCCCAGGAGGGCAAAAGG + Intergenic
946183038 2:217960383-217960405 CTCTGACAGTGGAGGGCAAGGGG + Intronic
946752885 2:222910509-222910531 CTCTTTTACTGGAGGGCCAGAGG + Intronic
1169251181 20:4062633-4062655 TTCTGTGAATAGAGGACAAAGGG + Intergenic
1170318840 20:15071439-15071461 CTCAGTGACTGGAAAGCAGAGGG + Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1173151769 20:40572213-40572235 TTCTGTGTCTTGAGGGCAATGGG - Intergenic
1174285222 20:49468078-49468100 CTCTGTAAATGGAAGGCAAAAGG + Intronic
1175714091 20:61244036-61244058 GCCTGTGTCTGGAGGGGAAATGG + Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177534687 21:22408364-22408386 TTCGGTGACTGGAATGCAAATGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178587214 21:33880587-33880609 TTCTGTGAGTGGAGAGCTAAAGG - Intronic
1181763074 22:25071362-25071384 CTCTGGGACTGGCGGCTAAAAGG - Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184849166 22:47109943-47109965 CTCTGAGAATGGATGGCACATGG - Intronic
1185019257 22:48364256-48364278 CTATGTGCCGGGAGGGCAACCGG + Intergenic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
1185310613 22:50152249-50152271 GTCAGTGACAGGAGGGCAGAGGG + Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950894656 3:16437814-16437836 CTCTGGGACAAGAGGACAAAAGG - Intronic
951083188 3:18476982-18477004 TTCTGTACTTGGAGGGCAAAAGG - Intergenic
951447436 3:22798960-22798982 CTCTGTGTCTGGAGGCAAAGTGG - Intergenic
952357158 3:32595003-32595025 CACTGTGCCTGGCTGGCAAATGG + Intergenic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955736090 3:62039832-62039854 CTCTGTGGCTGGGGGAAAAAAGG - Intronic
956033630 3:65066722-65066744 CTCTGAGGCTGGAGGGTACAGGG - Intergenic
956278640 3:67531529-67531551 TACTTTGACTGGAGGTCAAATGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957794823 3:84990542-84990564 CTATATCACTGAAGGGCAAAAGG - Intronic
959166145 3:102780781-102780803 TCCTGTGACTGGAGAGGAAATGG - Intergenic
961100596 3:124195393-124195415 CTTTGTTACTGGTGGGGAAAGGG + Intronic
962482623 3:135810840-135810862 CACTGAGACAGGAGAGCAAAAGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
966953419 3:184846657-184846679 CTCTGTGCCTGGAAGGCAAGCGG + Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
968474143 4:795259-795281 GTCTGTGCCGGGAGAGCAAATGG - Intronic
969241882 4:5904320-5904342 CTCTTTAACTGCAGAGCAAAAGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969840162 4:9875721-9875743 CTTTGTCACTGGGGGGAAAAGGG - Intronic
971443395 4:26715365-26715387 CACTGTGACGGCAGGGCCAACGG - Intronic
972782328 4:42296886-42296908 CTCAGTGCCTGGTGAGCAAATGG - Intergenic
976888917 4:90020974-90020996 CTCAGCTACTGGAGGGCACAGGG + Intergenic
979904527 4:126270163-126270185 CTCTGTCACTGTAGTGCAAAAGG + Intergenic
980521374 4:133940285-133940307 TTCTGTCACTGGAGGACACATGG - Intergenic
981293029 4:143098618-143098640 TTCGGTGACTTGAGGGGAAAGGG - Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
983391370 4:167134400-167134422 CGTTGTTACTGGAGGGCAAATGG + Intronic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
984227269 4:177050441-177050463 CTCTATGACTCCAAGGCAAAAGG - Intergenic
984584907 4:181552647-181552669 CTCAGTTACTGGGGGGAAAATGG + Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
986757536 5:10852165-10852187 CTCTGTGACGGGAAAACAAATGG + Intergenic
988491983 5:31712669-31712691 CTCTGTGACTGCTCGGCCAATGG - Intronic
988981611 5:36575192-36575214 CTATGGGACTGAAGGGCAAGGGG + Intergenic
989435794 5:41411500-41411522 CTGTGAGATTGGAGAGCAAAAGG - Intronic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
996293321 5:121880229-121880251 CTCTGTGATTTTAGAGCAAATGG - Intergenic
997305948 5:132836575-132836597 CACAGAGACTGGTGGGCAAAGGG - Intergenic
997786113 5:136715511-136715533 GTCTGTGAATGGAGGGGAAGGGG - Intergenic
1000463219 5:161547476-161547498 CTCTGGGAATAGGGGGCAAAGGG - Intronic
1001131463 5:169067489-169067511 CTCTGTGCCTCCACGGCAAAAGG + Intronic
1001483346 5:172103257-172103279 CTCTCTCACTGGAGAGGAAAAGG + Intronic
1001667995 5:173449291-173449313 AACTGTGACTGGTGGGCTAATGG + Intergenic
1001866632 5:175111754-175111776 CCCTGTGACTGGAGGGAATGTGG + Intergenic
1002135212 5:177103544-177103566 CTATGTGACTGGTTGGAAAAAGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1004704538 6:18112004-18112026 CTCTATGCCTGGTGGGCACATGG + Intergenic
1006046804 6:31305813-31305835 CTCTGTGCCTGGAGAAGAAAGGG + Intronic
1006262384 6:32885897-32885919 GTCTGAAACTGAAGGGCAAAAGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1007753667 6:44084835-44084857 CTTTGTGAGTGGATGGCACAGGG - Intergenic
1012623271 6:101375574-101375596 CTTTGTGATTGGAGGCAAAATGG + Intergenic
1013043867 6:106464006-106464028 ATGTGTGAGTGGAGGACAAATGG + Intergenic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1017242218 6:152183198-152183220 CTCTGTGAATGAAAGGGAAAAGG - Intronic
1018699827 6:166417541-166417563 GTCTGTGACTGCAGGGCAGCCGG - Intronic
1019698490 7:2460885-2460907 CTCCGTGACTGGCGGGAAATGGG + Intergenic
1022237791 7:28478502-28478524 TTCTGTGAGCGGAGGGCTAATGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022520951 7:31006600-31006622 CTCTGAGGCAGGAGGGAAAAGGG - Intergenic
1023102799 7:36736225-36736247 CTCTGTATCTGGAGGGCAAGGGG - Intergenic
1025096540 7:56100036-56100058 CTTTCTGACTTTAGGGCAAAAGG + Intergenic
1028235116 7:88351787-88351809 CTTTGTGAGTGAAGGGCAAGCGG - Intergenic
1031064055 7:117085130-117085152 CTCTGTGACAGAAGAGAAAAAGG + Intronic
1032383579 7:131506560-131506582 CACAGTGAGTGGAGGGCAAGGGG - Exonic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033961115 7:146914193-146914215 CTCTTTGACTGGTGGGCATTTGG + Intronic
1034878086 7:154742862-154742884 CTCTGGGACTTACGGGCAAAGGG + Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038489840 8:27962858-27962880 TTCGGTGAGTGCAGGGCAAAGGG - Intronic
1042502646 8:69526222-69526244 CTCTGTGACTGGATAGGAGAGGG - Intronic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1045140949 8:99281588-99281610 CTGTGAGACTTGTGGGCAAAGGG + Intronic
1045634029 8:104161969-104161991 TTCTCTGACTGGAAGGCAGAAGG - Intronic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1053186568 9:36021579-36021601 CTCTATGACTGGATAGCAAGGGG - Intergenic
1053532080 9:38892440-38892462 ATCTGTGAGGGAAGGGCAAAGGG + Intergenic
1054204303 9:62116849-62116871 ATCTGTGAGAGAAGGGCAAAGGG + Intergenic
1054634058 9:67471515-67471537 ATCTGTGAGGGAAGGGCAAAGGG - Intergenic
1055360817 9:75488567-75488589 CTCTCTGACCAGAGGCCAAAGGG - Intergenic
1056579252 9:87878461-87878483 CTCTGTGACTCGGAGGCAATTGG - Intergenic
1056623765 9:88237078-88237100 CTCTGTGCCTGGAGAACAAGAGG - Intergenic
1057547432 9:96028541-96028563 CTCTGAGACAGAAGGGCAAGTGG - Intergenic
1057880885 9:98791913-98791935 CTCTGGGAGTGGAGGTCAAGAGG - Intronic
1057910077 9:99013309-99013331 CTGGGTGACTGGAGGGCAAGTGG - Intronic
1059275873 9:113096805-113096827 TTCTGTGAGTAGAAGGCAAAGGG - Intergenic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1060191215 9:121594275-121594297 CGCCGAGGCTGGAGGGCAAATGG + Intronic
1060205633 9:121681196-121681218 CTCTGTGACTCCAGGGCATGAGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062407630 9:136404330-136404352 CTCTGGGACTGGGGGCCTAATGG + Intronic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1188114992 X:26231955-26231977 CTATGTGCCTGCAGGCCAAAGGG + Intergenic
1189756663 X:44278778-44278800 AACTGTGACTGGAGGACAAAAGG - Intronic
1189911183 X:45811904-45811926 CTCTCTGACTTGTGGGCATATGG - Intergenic
1196108179 X:111918196-111918218 CTCAGAGACTGGAGGAAAAAAGG + Intronic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1200285611 X:154819563-154819585 CTGGGTGACTGGAGGCCAAGTGG - Intronic