ID: 985527188

View in Genome Browser
Species Human (GRCh38)
Location 5:412002-412024
Sequence TCCCGGGGCCATCACCGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985527188_985527198 3 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527198 5:412028-412050 TGCTGCAGGGTGGGGCTGCGAGG 0: 1
1: 0
2: 5
3: 59
4: 520
985527188_985527196 -6 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527196 5:412019-412041 CCGGGAAGCTGCTGCAGGGTGGG 0: 1
1: 0
2: 3
3: 32
4: 264
985527188_985527199 22 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527199 5:412047-412069 GAGGCTCGCTGCTCAAATAAAGG No data
985527188_985527191 -10 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527191 5:412015-412037 GGCCCCGGGAAGCTGCTGCAGGG 0: 1
1: 0
2: 0
3: 56
4: 298
985527188_985527194 -7 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527194 5:412018-412040 CCCGGGAAGCTGCTGCAGGGTGG 0: 1
1: 1
2: 1
3: 42
4: 365
985527188_985527197 -5 Left 985527188 5:412002-412024 CCTCACCGGTGATGGCCCCGGGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 985527197 5:412020-412042 CGGGAAGCTGCTGCAGGGTGGGG 0: 1
1: 0
2: 7
3: 55
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985527188 Original CRISPR TCCCGGGGCCATCACCGGTG AGG (reversed) Intronic
900097903 1:947774-947796 TCCCCAGGCCATCCCGGGTGTGG - Intronic
900243817 1:1628809-1628831 TCCCTGGGCCATCACTGGAGGGG - Intronic
900351627 1:2237845-2237867 TCCCGGGGCCCTCAGGGATGAGG - Intronic
900589430 1:3453218-3453240 TCCCGGAGCCTTGACCCGTGAGG - Intergenic
901832038 1:11898634-11898656 AGCCGGGGCCAGCACAGGTGCGG - Intergenic
902215746 1:14933427-14933449 TTCCAGGACCATCAGCGGTGGGG - Intronic
904541794 1:31238687-31238709 TGCCGGGGCCAGCAACAGTGGGG - Intronic
912013628 1:105004760-105004782 TCCAGGTGCCAGCACAGGTGTGG + Intergenic
922205362 1:223441700-223441722 TCCCGCGGACACCACCAGTGAGG - Intergenic
1063489104 10:6447001-6447023 TCCTGGGGCCAATACCAGTGTGG + Intronic
1069898588 10:71694415-71694437 CCCCGGGGCCACCACAGCTGTGG + Intronic
1071875336 10:89837800-89837822 TTCCGGGGCCGTCACCTGTCGGG + Intergenic
1076819117 10:132930008-132930030 TCCCGGGGCCAGCACAGTTGTGG + Intronic
1078089328 11:8254619-8254641 TCCCAGGGCCAGCCTCGGTGGGG - Intronic
1078345200 11:10541449-10541471 TCCTGGTGCCATCTCCGGAGCGG + Intergenic
1083520881 11:63312020-63312042 ACCGGGGGCCATCACAAGTGTGG + Intronic
1083992754 11:66257249-66257271 TCCCGGGGTCACATCCGGTGGGG - Intergenic
1084312214 11:68323812-68323834 TCCCGGGGGCATAACCTGGGAGG - Intronic
1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG + Intronic
1102256541 12:111418616-111418638 TCCCGGGGGCGGCAGCGGTGTGG - Exonic
1102295398 12:111732768-111732790 TCCCGGGGCCAGTAACAGTGAGG + Intronic
1107837883 13:44426606-44426628 GCATGGGGCCATCACAGGTGTGG + Intergenic
1108501241 13:51071811-51071833 TCCCGGGGCCATCCTCGCAGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115939059 14:38588978-38589000 TCCCAGGACCTTCACCTGTGTGG + Intergenic
1117953741 14:61107211-61107233 TTCAGGGGCCAACACCGGGGTGG - Intergenic
1120746406 14:88156351-88156373 ATCCTGGGCCATCACCTGTGTGG + Intergenic
1121104124 14:91269748-91269770 TCCCGGGGACATCAGGGCTGCGG - Intergenic
1132163578 15:99565168-99565190 CCCCGGGGCGAGCACAGGTGCGG + Intergenic
1132550133 16:550828-550850 GACCGGGGCCATCACCGACGGGG - Intronic
1132743725 16:1428280-1428302 TCCTGGGGCCATCACAGGGCCGG + Intergenic
1135846907 16:25927169-25927191 TCCCTGGGCCATTGCCTGTGAGG - Intronic
1137898531 16:52239429-52239451 TCTTGGGGTCATCACCAGTGTGG + Intergenic
1142201883 16:88765033-88765055 TCCTGGGTCCAGCACCGCTGAGG - Intronic
1142252197 16:88997095-88997117 TCCCAGAGCCAGCACCTGTGGGG + Intergenic
1142305007 16:89280010-89280032 CCCCGGGGTCATAAACGGTGGGG - Exonic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1160753681 19:747220-747242 TCCCGGGGCCCTCTCTGGCGGGG - Exonic
1160957194 19:1699199-1699221 CCCCGGGGCCCTCACCCGGGCGG - Intergenic
1162036119 19:7940480-7940502 TCCTGGGGCCATCGTGGGTGTGG - Intronic
1163311839 19:16519563-16519585 TCCCGGGCCCAGCACGCGTGAGG + Intronic
1163600572 19:18246980-18247002 TCCCAGGCCCATCACCTGAGTGG - Intronic
1165914936 19:39252752-39252774 TCCTGGGGCCAGCATGGGTGAGG + Intergenic
1167500537 19:49844475-49844497 TCTCGGCCCCATCACCTGTGAGG - Intergenic
932728264 2:74198616-74198638 TCCCGGCGCAGTCACCGGCGCGG + Exonic
934475080 2:94588288-94588310 TCCTGGGGCCAGCATGGGTGGGG + Intergenic
934858086 2:97741398-97741420 CCTAGGGGACATCACCGGTGGGG - Intergenic
938262717 2:129906885-129906907 TCCCAGGGCCATCCCCAGGGTGG + Intergenic
1175371480 20:58495856-58495878 TGCCAGGGCCATCAGCGGAGTGG + Intronic
1175999014 20:62823947-62823969 TCCCAGTGCCATCACCTGTACGG + Intronic
1180133329 21:45842756-45842778 TCCTGGGGACACCACCGGTGGGG + Intronic
1182424382 22:30264389-30264411 CCCCGGGGCCTTCCCCAGTGAGG - Exonic
1184104182 22:42357941-42357963 TCCTGGGGCCAGTATCGGTGGGG + Intergenic
1185086647 22:48744462-48744484 TCCCCAGGCCATGACCCGTGTGG + Intronic
950425210 3:12921359-12921381 TCCTGGCCCCATCACCAGTGTGG + Intronic
953518721 3:43621755-43621777 TCCCGGTGCCAGCACCCCTGGGG - Intronic
954335355 3:49913230-49913252 TCCCTGGGCCATTCCTGGTGTGG + Exonic
954883188 3:53849649-53849671 TCCCAGGGCCATCTCCAGAGTGG + Exonic
961676046 3:128567372-128567394 TGCCGGGGCCACCACCAATGTGG + Intergenic
968480673 4:831791-831813 ACCCAGGCCCATCACAGGTGAGG + Intergenic
968480695 4:831862-831884 ACCCAGGCCCATCACAGGTGAGG + Intergenic
968502727 4:958523-958545 TCCCTGGTCCATCTCTGGTGAGG - Exonic
972334269 4:38093004-38093026 GCCCGGGGCCATTATCTGTGTGG - Intronic
972730267 4:41788047-41788069 TCTCAGGGCCATCCCGGGTGAGG - Intergenic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
986367370 5:7046200-7046222 TCCTGTGGCCATCAACGTTGTGG + Intergenic
1001434499 5:171688734-171688756 TCCCAGGGCCTTCACGGGGGTGG - Intergenic
1003792502 6:9562620-9562642 ACCAGTGGCCATCACTGGTGTGG + Intergenic
1007357118 6:41329098-41329120 TCCTGGGGCCAACATTGGTGGGG - Intergenic
1007610098 6:43143613-43143635 TCCAGGGCCCCTCACCGTTGAGG - Exonic
1011791748 6:90906643-90906665 TCCTGGGGCCACCACCACTGGGG + Intergenic
1023982469 7:45078038-45078060 TCCAGGGTCCATCCCAGGTGTGG + Intergenic
1029708205 7:102286495-102286517 TCCCGGGGCCACCACCACCGCGG + Intronic
1029899434 7:104023217-104023239 TCCAGGAGCCAGCACAGGTGCGG - Intergenic
1038373104 8:27012228-27012250 TCCCGGGGCAGGCACAGGTGCGG + Intergenic
1038535216 8:28348861-28348883 TCCTGGGCCCACCACCTGTGTGG - Intronic
1049651673 8:143772490-143772512 TCCCGGGGCCCACACCTCTGGGG - Intergenic
1050523485 9:6525812-6525834 TCCCAGTGGCAGCACCGGTGGGG + Intergenic
1052854972 9:33401474-33401496 TCCTGGGGCCAGCATGGGTGGGG - Intronic
1053682992 9:40497803-40497825 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1053932974 9:43126117-43126139 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054280722 9:63127125-63127147 TCCTGGGGCCAGCATGGGTGGGG + Intergenic
1054296092 9:63333303-63333325 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054394108 9:64637798-64637820 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054428758 9:65143011-65143033 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054501622 9:65878532-65878554 TCCTGGGGCCAGCATGGGTGGGG + Intronic
1062565952 9:137164057-137164079 GCACGGGGGCAGCACCGGTGGGG + Intronic
1062586995 9:137253954-137253976 TCCCGGGGCCTTCACCTGCTGGG + Intergenic
1196852767 X:119954214-119954236 ACCGGGGGCCATCACAAGTGTGG - Intergenic