ID: 985528594

View in Genome Browser
Species Human (GRCh38)
Location 5:420707-420729
Sequence TGCATGGAAGGCGGCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985528586_985528594 8 Left 985528586 5:420676-420698 CCAGGAGGGCGGGATGGCAGCGG 0: 1
1: 0
2: 2
3: 23
4: 310
Right 985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 154
985528585_985528594 11 Left 985528585 5:420673-420695 CCACCAGGAGGGCGGGATGGCAG 0: 1
1: 0
2: 2
3: 20
4: 223
Right 985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 154
985528580_985528594 22 Left 985528580 5:420662-420684 CCTTGTGGTGTCCACCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 156
Right 985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985528594 Original CRISPR TGCATGGAAGGCGGCCCAGA AGG Intronic
900090062 1:916332-916354 AGCATGGACAGCAGCCCAGAGGG - Intergenic
900203865 1:1422835-1422857 TCCAGGGAATGCGGCCCAGCCGG - Intergenic
900836478 1:5008725-5008747 TGGATGGATGGATGCCCAGATGG + Intergenic
901828828 1:11879874-11879896 CGCCTGGAAGGCTGGCCAGACGG + Intergenic
903312470 1:22470444-22470466 TGTATGGCAGATGGCCCAGAAGG + Intronic
905347729 1:37322597-37322619 TGCTGGGAAGGTGTCCCAGACGG - Intergenic
906700914 1:47857427-47857449 TGCCTGGAAGGAGGCATAGAAGG - Intronic
906822490 1:48944159-48944181 AGCATGGAAGGAAGCTCAGATGG + Intronic
909498769 1:76310124-76310146 TGCTTTGAAGGAGACCCAGATGG - Intronic
913087761 1:115455031-115455053 AGCTTGGGAGGCCGCCCAGAGGG - Intergenic
914915429 1:151816351-151816373 TGCATGGGAGCTGGGCCAGAGGG + Intronic
920442836 1:205992735-205992757 TGGCTGGAAGGAGGCCCAGCTGG + Intronic
920789963 1:209080604-209080626 TGCATGGAATGCAAACCAGAAGG - Intergenic
921181644 1:212636362-212636384 TGCCTGGATGGAGGACCAGAAGG - Intergenic
921446494 1:215253264-215253286 AGAATGGCAGGTGGCCCAGACGG + Intergenic
922703633 1:227777301-227777323 TGCAGGGAAGGTGGCGCACAGGG + Intronic
1063048313 10:2416820-2416842 GACATGGCAGGAGGCCCAGAAGG - Intergenic
1070580895 10:77718492-77718514 TGCATGGAGGGCAGGCTAGAGGG + Intergenic
1071394281 10:85206285-85206307 TTCATGGAAGGCAGCCAAGAAGG + Intergenic
1071855282 10:89618158-89618180 TACAAGGCAGGGGGCCCAGAGGG + Intronic
1072661044 10:97363701-97363723 TGCATAGCAGGCGGTCCAGAAGG - Intronic
1074062043 10:109975430-109975452 TGCATGCAAGATGGCCCAGCAGG - Intergenic
1075041823 10:119114076-119114098 TGCCCAGAAGGAGGCCCAGAGGG + Intronic
1075122035 10:119671443-119671465 TGAATAGAAGGTGGCCCAGCAGG + Intronic
1075672361 10:124271151-124271173 TGCATGGAAGGTGGCCCCTGGGG - Intergenic
1075835063 10:125445795-125445817 GGCAGGGAAGGCTGCCCTGAGGG - Intergenic
1076629078 10:131841906-131841928 TGCCTGGAATGTGGCCTAGAGGG + Intergenic
1076820230 10:132935027-132935049 TGGAGGGAAGGAGGACCAGAAGG - Intronic
1078478230 11:11652766-11652788 TGCATAAAAGGCAGCCCAGAAGG - Intergenic
1079652068 11:22942388-22942410 GGCCTGGAAAGCAGCCCAGAGGG - Intergenic
1081899956 11:46619223-46619245 TGCAAAGGAGGCTGCCCAGAGGG + Intronic
1082765628 11:57165345-57165367 TGCATGGCAGGCGGTGCAGAGGG - Intergenic
1084191607 11:67501952-67501974 GGCACGGACGGCGGCACAGACGG - Exonic
1084970897 11:72771597-72771619 TGCATGGAGAGCGGCGGAGAAGG - Intronic
1085757682 11:79215323-79215345 TGAGTGGAAGGCTGTCCAGAAGG - Intronic
1085758357 11:79220140-79220162 TTTAGGGAAGGCAGCCCAGAGGG + Intronic
1086054331 11:82629204-82629226 AGCATGGAAGGGGACCCAAATGG - Intergenic
1088262819 11:107960389-107960411 GGCAGGGAAGGCTGCTCAGATGG + Intronic
1091005574 11:131950215-131950237 TGTATGGCAGGTGACCCAGAAGG + Intronic
1091290501 11:134436891-134436913 TGCCTGCACGGCTGCCCAGAGGG + Intergenic
1092111079 12:5965294-5965316 TACATGGAAAGGGGCCCTGAGGG - Intronic
1092266339 12:6983613-6983635 GGCATGAAACGCAGCCCAGAGGG + Intronic
1103733319 12:123042854-123042876 TGAATGGGAGGCAGCACAGACGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1108695069 13:52895962-52895984 CTCAGGGAAGGCTGCCCAGAGGG - Intergenic
1110706918 13:78607758-78607780 CCCTGGGAAGGCGGCCCAGAGGG - Intergenic
1111017230 13:82397249-82397271 AGCATGGAAGGGGTCCCAAACGG - Intergenic
1112226784 13:97547304-97547326 TCCATGGAAGGCTGCTCTGAGGG - Intergenic
1112606314 13:100910206-100910228 TGAATTGAAGGCTGGCCAGAAGG + Intergenic
1113836490 13:113331411-113331433 AGCATGGGAGGCGGCCCAGGAGG + Intronic
1114654982 14:24310625-24310647 TGGGTGGAAGGCGCCACAGAGGG - Exonic
1117956245 14:61125782-61125804 TACATAGAAGGCGCCCCACAAGG + Intergenic
1119197031 14:72724678-72724700 TCCATGTCAGGGGGCCCAGAGGG + Intronic
1121554579 14:94826527-94826549 TGAATGGAAGGAGGGACAGATGG + Intergenic
1122871164 14:104639700-104639722 TCCATGGAAGGAGCCCCAGGAGG - Intergenic
1124231635 15:27951391-27951413 GGCATGGTAGGCGGCACAGATGG + Intronic
1124581303 15:30957764-30957786 TGCAAAGAAGGCAGTCCAGAAGG + Intronic
1124855105 15:33380169-33380191 TGGATTGAAGGAGGCCTAGATGG - Intronic
1127619256 15:60717143-60717165 TGAATGGAAGGGTACCCAGATGG + Intronic
1135016765 16:18930113-18930135 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1135322400 16:21505966-21505988 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1135502102 16:23005206-23005228 TGCATGGAAGACGGACTGGAAGG - Intergenic
1136333877 16:29599096-29599118 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1136787252 16:32942293-32942315 TGCATGGGAGCCTGCTCAGAAGG + Intergenic
1139847250 16:69929737-69929759 TGGATGGAGGGCGGCCCGGCTGG + Intronic
1142078818 16:88136281-88136303 TGCCTGTAGGGCGGGCCAGATGG - Intergenic
1142490329 17:274379-274401 TGCCAGGAAGGCTGCCCAGGCGG - Intronic
1145084927 17:19929472-19929494 TGAATGGAAGGGGCCCAAGAGGG + Intronic
1146472453 17:33135347-33135369 TTCAAGTAAGGCTGCCCAGATGG - Intronic
1146562672 17:33884643-33884665 TGCATGGAGGGAGGCCAAGTGGG - Intronic
1148329471 17:46804951-46804973 AGCATGGAAGGCGACCCAAGGGG - Intronic
1152566601 17:81103139-81103161 TGCCAGGAAGGCGCCCCAGATGG - Intronic
1154958659 18:21285725-21285747 TGCTTGGAAGGGGCCCCAAATGG + Intronic
1158472175 18:57746876-57746898 TGCATGGAAGTGAGCTCAGAAGG + Intronic
1158744139 18:60178276-60178298 AGCATGGAAGGGGACCTAGAGGG + Intergenic
1160791297 19:924990-925012 TGCAAGGAAGGCGGTCGGGAGGG - Intergenic
1164241309 19:23391788-23391810 TGCAGGGGAGGCTCCCCAGAAGG + Intronic
1167610538 19:50505948-50505970 TGAGTGGAAGGGGCCCCAGAAGG + Intergenic
1167898029 19:52597728-52597750 TGCCTGGAGGCCGGGCCAGAGGG + Intronic
925390004 2:3488160-3488182 TGCATGGATGAAGGCTCAGATGG - Intergenic
925881539 2:8357033-8357055 GGCAATGATGGCGGCCCAGATGG - Intergenic
927917579 2:26946886-26946908 TGCAGGGAAGGAAGCACAGAGGG - Intronic
929788112 2:45006315-45006337 TGCAGGGACGGCAGCCCAGGGGG + Exonic
931413240 2:62055229-62055251 TGCAGGAAAAGAGGCCCAGATGG - Intronic
932476651 2:72010782-72010804 TGAATGGAAGGAGGGCGAGAAGG + Intergenic
937257475 2:120565381-120565403 TGTGTGGAAGGCAGACCAGAGGG - Intergenic
937954817 2:127416245-127416267 GGCTTGGCAGGCTGCCCAGAGGG - Intergenic
938383126 2:130847806-130847828 GGCATGGAAGGCGGCCTTGAAGG + Intronic
944924068 2:204445314-204445336 TGCATAATAGGCGTCCCAGAAGG + Intergenic
945513712 2:210735160-210735182 TGCATGGAAGGGGACCCAAGTGG - Intergenic
948290269 2:236819302-236819324 TGCAGGGCAGGTGGCCCCGAGGG + Intergenic
948491402 2:238315400-238315422 ATCAGGGAAGGCGGCCCAGCCGG + Intergenic
948643423 2:239389255-239389277 AGCATGGAAGGGGACCCAAATGG - Intronic
948718430 2:239881139-239881161 TGCTGGGAGGGCGGCCCAGATGG - Intergenic
1175189920 20:57204607-57204629 TGGATGGAGAGAGGCCCAGAGGG - Intronic
1177897895 21:26875978-26876000 TGGATGGATGCCGGCCCACATGG + Intergenic
1178775466 21:35546035-35546057 TGAATGTAAGGAGGCCCAGGGGG - Intronic
1180189552 21:46155906-46155928 TGCCTGGAAGGCCTCCCAGAAGG - Intergenic
1180824649 22:18854151-18854173 TCCTTGGAAGGCAGCTCAGAAGG - Intronic
1181185371 22:21099620-21099642 TGCATGGAAGGATGCATAGATGG - Intergenic
1181188083 22:21120396-21120418 TCCTTGGAAGGCAGCTCAGAAGG + Intergenic
1181211115 22:21290097-21290119 TCCTTGGAAGGCAGCTCAGAAGG - Intergenic
1181501126 22:23316149-23316171 TCCTTGGAAGGCAGCTCAGAAGG + Exonic
1181651029 22:24259269-24259291 TCCTTGGAAGGCAGCTCAGAAGG - Intergenic
1181706353 22:24651470-24651492 TCCTTGGAAGGCAGCTCAGAAGG + Intergenic
1181822890 22:25489386-25489408 TGCATGGAAGATGTCCCAGGAGG + Intergenic
1182463092 22:30495889-30495911 TGCATGGAAGGCAGGGCAGTAGG + Intronic
1183392986 22:37556410-37556432 TGCATGGAAGGGAGGGCAGATGG + Intergenic
1183928514 22:41223001-41223023 GGCAGGGAAGGCAGCCCAGAGGG + Intronic
1184740062 22:46422844-46422866 TGCATGTAAGAAGGCACAGAAGG + Intronic
1203215830 22_KI270731v1_random:5334-5356 TCCTTGGAAGGCAGCTCAGAAGG + Intergenic
1203274795 22_KI270734v1_random:80057-80079 TCCTTGGAAGGCAGCTCAGAAGG - Intergenic
949449295 3:4167243-4167265 AGCATGGAAGGGGACCCAGGTGG + Intronic
949568244 3:5265500-5265522 TGCATAGAAGGCATTCCAGAAGG - Intergenic
955812792 3:62808725-62808747 TGCATAGAAGGTGGCACTGAAGG - Intronic
960281391 3:115784609-115784631 CGCAGGGAAGGCGGCGCGGACGG - Intergenic
962876902 3:139542066-139542088 TGCCTGGGAGGAGACCCAGAAGG - Intergenic
963913758 3:150839073-150839095 TGCATTGAAGGATGCCTAGATGG - Intergenic
964916282 3:161846091-161846113 AGCATGGAAGGGGTCCCAAACGG + Intergenic
966548330 3:181176822-181176844 TGCATGGCAGCCTGCCAAGACGG + Intergenic
968044276 3:195615016-195615038 TGCAGGTAAGGAGGCCTAGAAGG + Intergenic
968060064 3:195721079-195721101 TGCAGGTAAGGAGGCCTAGAAGG + Exonic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968620842 4:1602859-1602881 TGCTTGGAAGCCGGCCCACCAGG + Intergenic
970913664 4:21307904-21307926 TACAAGGAAGGCAGCCAAGAAGG + Intronic
984908060 4:184648726-184648748 GGCATGGAAGGCAGCAGAGACGG + Intronic
985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG + Intronic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
991950832 5:71945634-71945656 TGCATGGCTGGAGACCCAGAGGG + Intergenic
992755545 5:79902291-79902313 TGCAGGGAGGGCAGCCAAGATGG + Intergenic
997371474 5:133363929-133363951 TTCATAGACGGCGGCTCAGAGGG + Intronic
999639080 5:153653291-153653313 GGCATGTCAGGAGGCCCAGAGGG + Intronic
1001401868 5:171450852-171450874 GGCCTGGGAGGCGGCCCAGGCGG - Intronic
1006945099 6:37779534-37779556 GGCCTGGGAGGCTGCCCAGAAGG + Intergenic
1010625550 6:78133373-78133395 TGCATGGAAGGGGACCCAAGTGG - Intergenic
1015561096 6:134516938-134516960 TGCCTAGTAGGGGGCCCAGAGGG + Intergenic
1019634071 7:2066265-2066287 TGCATGGCAGCCCGCCCAGCTGG - Intronic
1020028851 7:4919191-4919213 TGCCTGGAACGAAGCCCAGAGGG + Intronic
1023151421 7:37204565-37204587 AGCATGGAAGGCGACCCAAAGGG + Intronic
1024254294 7:47528297-47528319 TGCAGGGAAGGAGGCACTGAGGG + Intronic
1024912332 7:54459433-54459455 TGCATGGAAGTCGGCTCTGGGGG - Intergenic
1031732398 7:125315147-125315169 AGCATGGAAGGGGACCCAGTGGG - Intergenic
1035031898 7:155866280-155866302 TGGATGGAAGCCGGTCCAGGCGG + Intergenic
1035245870 7:157561657-157561679 TGAATGGAAGGGGGCCCAAGGGG - Intronic
1043604095 8:81978465-81978487 TTCAAGGAAGGCTTCCCAGAAGG - Intergenic
1045808681 8:106195896-106195918 AGCAGGGAAGGGGGCCAAGAAGG + Intergenic
1047316670 8:123741096-123741118 TGCATGCTTGGAGGCCCAGAGGG + Intergenic
1049391831 8:142375564-142375586 TGCACCGAAGGCTGCCCAGTGGG - Intronic
1050494769 9:6229341-6229363 GGCATGGGAGGGGGCCCAGGAGG + Intronic
1053576494 9:39360435-39360457 TGCATGGAAGCAGTTCCAGAGGG + Exonic
1053841004 9:42188360-42188382 TGCATGGAAGCAGTTCCAGAGGG + Exonic
1054098064 9:60919126-60919148 TGCATGGAAGCAGTTCCAGAGGG + Intergenic
1054119465 9:61194756-61194778 TGCATGGAAGCAGTTCCAGAGGG + Exonic
1054588289 9:66987806-66987828 TGCATGGAAGCAGTTCCAGAGGG - Intergenic
1056162843 9:83914428-83914450 TGGATGGGAGGTGGCTCAGAGGG - Intronic
1056357507 9:85817093-85817115 TGGATGGGAGGTGGCTCAGAGGG + Intergenic
1056813492 9:89782519-89782541 TGCTTGGGAGGCAGCCCAGAGGG - Intergenic
1057141847 9:92731151-92731173 TGCTTGTCAGGAGGCCCAGATGG - Intronic
1060100298 9:120834410-120834432 TACAGGGAAGGCTTCCCAGAAGG + Intronic
1061942392 9:133890737-133890759 TGCATGGAACACGGACGAGATGG + Intronic
1061961173 9:133990171-133990193 TGGATGGTAGGAGGACCAGATGG - Intronic
1062099705 9:134721690-134721712 TGCCTGGAAGGTGGCACAGAAGG + Intronic
1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG + Intergenic
1186104846 X:6194526-6194548 AGCATGGAAGTAAGCCCAGAAGG - Intronic
1189366509 X:40393183-40393205 TTCATGGTAGGCGGCCCAGGTGG + Intergenic
1193082650 X:77421323-77421345 TGCATGACAGGCTGCCCAGTGGG + Intergenic
1195156243 X:102126465-102126487 TGCATGGACAGGGGCCCACAAGG + Intronic
1195157870 X:102141672-102141694 TGCATGGACAGGGGCCCACAAGG - Intronic
1195306257 X:103586311-103586333 TGCATGGACAGGGGCCCACAAGG + Intronic
1198932059 X:141872316-141872338 TGCAAAGAAGACAGCCCAGAGGG + Intronic