ID: 985530022

View in Genome Browser
Species Human (GRCh38)
Location 5:428722-428744
Sequence AACAAGCTCAGAGCTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 18, 3: 24, 4: 151}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985530022_985530029 7 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530029 5:428752-428774 AACTAGGCGGCCCCATGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56
985530022_985530024 -6 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530024 5:428739-428761 CTTGTTTTCCTGTAACTAGGCGG 0: 1
1: 50
2: 557
3: 557
4: 390
985530022_985530027 5 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530027 5:428750-428772 GTAACTAGGCGGCCCCATGGCGG 0: 1
1: 0
2: 0
3: 2
4: 65
985530022_985530033 13 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530033 5:428758-428780 GCGGCCCCATGGCGGGGGTGGGG 0: 1
1: 0
2: 2
3: 22
4: 277
985530022_985530023 -9 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530023 5:428736-428758 GAGCTTGTTTTCCTGTAACTAGG 0: 1
1: 52
2: 44
3: 45
4: 229
985530022_985530034 14 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530034 5:428759-428781 CGGCCCCATGGCGGGGGTGGGGG No data
985530022_985530026 2 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530026 5:428747-428769 CCTGTAACTAGGCGGCCCCATGG 0: 1
1: 0
2: 0
3: 3
4: 45
985530022_985530038 20 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530038 5:428765-428787 CATGGCGGGGGTGGGGGTGATGG 0: 1
1: 3
2: 25
3: 226
4: 1877
985530022_985530030 8 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530030 5:428753-428775 ACTAGGCGGCCCCATGGCGGGGG 0: 1
1: 0
2: 1
3: 3
4: 38
985530022_985530028 6 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530028 5:428751-428773 TAACTAGGCGGCCCCATGGCGGG No data
985530022_985530032 12 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530032 5:428757-428779 GGCGGCCCCATGGCGGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 242
985530022_985530039 21 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530039 5:428766-428788 ATGGCGGGGGTGGGGGTGATGGG 0: 1
1: 1
2: 11
3: 120
4: 996
985530022_985530031 11 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530031 5:428756-428778 AGGCGGCCCCATGGCGGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985530022 Original CRISPR AACAAGCTCAGAGCTACCAC TGG (reversed) Intronic
901561423 1:10074560-10074582 AGCAACCACAGAGCAACCACGGG - Intronic
902950446 1:19878564-19878586 AACAAGCTGGGAGCTTGCACGGG - Intergenic
903393578 1:22982288-22982310 CAGAAGCCCAAAGCTACCACGGG - Intergenic
903662367 1:24985966-24985988 AACAGGCTCAGAGATGCCAGGGG + Intergenic
905043552 1:34978862-34978884 ACCCAGCTCATAGCTGCCACAGG - Intergenic
906793001 1:48674959-48674981 AAAAAGCTCAGAGTCACCAGAGG - Intronic
909908188 1:81224932-81224954 AAGAAGCTCAGAGCTAACATTGG - Intergenic
909994393 1:82261028-82261050 AACAAGCTCAGGGCTCCCACTGG - Intergenic
911395569 1:97303881-97303903 AACAAGCTCAGTCATACCTCAGG - Intronic
913086071 1:115438081-115438103 ATCCAGCTCAGTGCTATCACAGG + Intergenic
920811318 1:209288545-209288567 ACAGAGCTCAGAGCTTCCACTGG - Intergenic
921158320 1:212454928-212454950 AGCAGGCTCTGAGCTCCCACAGG - Intergenic
921345860 1:214184575-214184597 AACAAGCTCATTCCTACCTCAGG + Intergenic
922203382 1:223425933-223425955 AACTAGCTCAGAGACAGCACGGG - Intergenic
922331312 1:224579351-224579373 AACATGCTCAGAGTTTCCAATGG - Intronic
923598525 1:235380332-235380354 AACAAAATCATAGATACCACAGG - Intronic
1064104322 10:12488648-12488670 AACAAGCTCAGGGCTCCCACTGG - Intronic
1064119885 10:12609461-12609483 AACAAGCTCAGGGCTGCCACTGG - Intronic
1064825090 10:19389622-19389644 AACAAGCTCAGAGGCATCACAGG - Intronic
1066280558 10:33913697-33913719 AACAAGCTCAGGGCTTCCACTGG - Intergenic
1066458505 10:35593254-35593276 AACAAGCTAAGATCTACAGCAGG - Intergenic
1069049626 10:63778807-63778829 AACAAGCTCAGGGTTCCCACTGG + Intergenic
1070424121 10:76268846-76268868 AACACGCTCAGAGAAAACACAGG - Intronic
1070721825 10:78762284-78762306 ATCAAGCTCAGAGTGGCCACTGG + Intergenic
1071727007 10:88209035-88209057 GAAAAGCTCCCAGCTACCACTGG - Intergenic
1073773284 10:106758970-106758992 AACTGGCTCAGAGATAACACAGG - Intronic
1074095747 10:110310814-110310836 AACAAGCTCAGAAGTAATACAGG + Intergenic
1074139477 10:110659336-110659358 AAGAAGCTAAGTGCTACCTCTGG - Intronic
1074716733 10:116226754-116226776 AACAAGGTCAGGGCTGCCACTGG - Intronic
1074881426 10:117662422-117662444 AACACACTCAAAGCTTCCACTGG - Intergenic
1074901926 10:117824425-117824447 AACAAGCTCAGGGCTCCTGCTGG + Intergenic
1075369135 10:121919996-121920018 AACAAGTTAAGAGCAACCAAGGG + Intronic
1077559056 11:3245716-3245738 AACAAGCTCAGGGCTCCCACTGG + Intergenic
1079421794 11:20298481-20298503 AACAGGCTCAGAGTTACCAAGGG - Intergenic
1081254508 11:40875878-40875900 AACAAGCTCAGGGCTCCCACTGG - Intronic
1085540911 11:77268907-77268929 ATCATGCTCAGACCTACCATGGG + Exonic
1087428402 11:98019301-98019323 ATCAAGCTCAGGGCTTTCACAGG - Intergenic
1090255546 11:125281192-125281214 CACCAGCTCAGAGCCACCTCAGG + Intronic
1090846735 11:130535876-130535898 AACAGGTTCAGAGCAACCGCAGG - Intergenic
1092891836 12:12976127-12976149 AAAAATCTCAGAGCTAACAAAGG + Intronic
1098529268 12:71522003-71522025 AGCAACCTCAGTGCTACCAAAGG - Intronic
1099062034 12:77923785-77923807 ATCAAGCTCAGAGCTTCAAAAGG + Intronic
1102572833 12:113837878-113837900 AACAAACTCAATGTTACCACAGG + Intronic
1103060681 12:117855976-117855998 CACAAACTCAGAGCAAGCACAGG + Intronic
1108515192 13:51194919-51194941 AACAAGCTCAGGGCTCCCATTGG - Intergenic
1110779801 13:79451721-79451743 AACAAGCCCCTAGCAACCACAGG + Intergenic
1112504353 13:99966905-99966927 ATCAAGTTCAGAGATACCAAGGG - Intronic
1113448341 13:110387611-110387633 AACAAGCGCAGGGCTCCCTCGGG - Intronic
1117429245 14:55636480-55636502 AAGAAGTTCAGAGCTACATCAGG + Exonic
1118472674 14:66089553-66089575 AACCAGCTCAGAGCATCCAGGGG + Intergenic
1120684939 14:87527506-87527528 AACAACCTAATAGCTACCAAAGG - Intergenic
1121270842 14:92637194-92637216 AACAAGCTCAGGGCTCCCATTGG - Intronic
1122255007 14:100470188-100470210 AACAAGGACAGAGCTGACACAGG + Intronic
1126146105 15:45474390-45474412 AACCAGCTCAGTGCTACCACTGG + Intergenic
1126450343 15:48801654-48801676 AACAATCACAGAGCTACTTCTGG + Intronic
1126602239 15:50440609-50440631 AACAAGCTCAGGGATACCACTGG - Intronic
1128893575 15:71352679-71352701 AAAGAGCTCAGAGATACCAGGGG + Intronic
1131631744 15:94184424-94184446 GACAAGCTCAGGACTCCCACTGG - Intergenic
1134690275 16:16186664-16186686 AGCAAGCTCAGGGCTCCCACTGG + Intronic
1135063466 16:19290180-19290202 AACAAGCTCAGAACTCCCAAAGG + Intronic
1136005642 16:27327019-27327041 AACCAGCCCAGAGCTTCCTCTGG - Intronic
1137660567 16:50202228-50202250 AAGAAGCACAGAACTACCAAAGG - Intronic
1137790251 16:51169053-51169075 ATTAACCTCAGACCTACCACAGG + Intergenic
1138203661 16:55108449-55108471 AACAAGCTCAGGGCTTCCACTGG - Intergenic
1138872647 16:60910580-60910602 AACAAGCTCCAAGATACCACTGG + Intergenic
1139240848 16:65390482-65390504 AACAGGCTCAGCACTACCTCGGG + Intergenic
1140591186 16:76354686-76354708 AACAAGCTCCAACCCACCACTGG + Intronic
1141390648 16:83660267-83660289 AACAAGCTCAGGGATCCCACTGG - Intronic
1143739193 17:8940375-8940397 AACAATCCCAAAGCAACCACCGG + Intronic
1145736197 17:27233488-27233510 AAGAAGCTCAGAGCAAAGACGGG + Intergenic
1148910656 17:50940628-50940650 AGCAGGCTCACAGCTGCCACAGG + Intergenic
1150247754 17:63689076-63689098 AACAAGGTCAGAGTTCCCAGTGG - Intronic
1152691878 17:81722073-81722095 ACAAACCTCAGAGCTCCCACTGG - Intergenic
1153123742 18:1764484-1764506 AACAAGCTCAGGGTACCCACTGG - Intergenic
1153955443 18:10091925-10091947 AACAAGCTCAGGGCTCCCACTGG + Intergenic
1156625647 18:38904574-38904596 AACAAGTTAAAAGGTACCACTGG - Intergenic
1159014854 18:63092956-63092978 AACAAGCTCGGGGCTCCCATTGG + Intergenic
1159246127 18:65807818-65807840 AAGAAGCTCAGTGCTTCCAGTGG - Intronic
1160412138 18:78682301-78682323 AACAATCTCAGGCCTCCCACTGG + Intergenic
1161976296 19:7609703-7609725 AACAAGCTCAGGGCTCCCACTGG - Intronic
1163066531 19:14800643-14800665 AACAAGCTGGGAGCTTGCACGGG + Intronic
1163213542 19:15859347-15859369 AACTAGCGGAGAGGTACCACTGG + Intergenic
925377361 2:3397449-3397471 GACAAGCCCAGAGCTCACACAGG - Intronic
926850745 2:17194083-17194105 CACAAACTCTGAGCTAACACAGG - Intergenic
927095224 2:19743081-19743103 AACAAGCTCTGAGACACCATAGG + Intergenic
928447145 2:31342683-31342705 AACAGTCTAAGAGCCACCACAGG - Intronic
928469425 2:31559031-31559053 AACAAGTTCAGAGGTAGAACTGG - Intronic
929069955 2:38020246-38020268 AACAAGTTCAGGGCTCCCACTGG - Intronic
930657621 2:54022016-54022038 AGCAAGCTCAGTAATACCACTGG - Intronic
936524518 2:113233729-113233751 TACAAGCCCAGAGTAACCACAGG - Intronic
937041453 2:118823894-118823916 TTCAAGCTCAGAGCTGCAACAGG - Intergenic
941145318 2:161836686-161836708 AAGAAGCTCAGGGTTCCCACAGG + Intronic
941193836 2:162421507-162421529 AAAAAGTTCAGAACTAACACTGG + Intronic
947573772 2:231256291-231256313 AGCAAGCTCAGCGCAACCTCCGG - Intronic
947591751 2:231389883-231389905 AAAAAGCTCAGAGCAGCCAATGG + Intergenic
1171417504 20:24992908-24992930 AACCCGCTCAGAGATAGCACCGG + Exonic
1174362957 20:50040031-50040053 TGCAAGCTCAGTCCTACCACAGG - Intergenic
1176060361 20:63169826-63169848 CAGAAGCTCAGAGCTGCCCCAGG - Intergenic
1177539136 21:22468930-22468952 ATCAAGCTCATAGTTACCATAGG - Intergenic
1179227631 21:39469081-39469103 AACAAGCTCAAGGCTGCCATGGG - Intronic
1179405554 21:41122572-41122594 AACAAGCTCAGGGCTCCCACTGG - Intergenic
1180704942 22:17803606-17803628 AGCAAGCTCAGATCTTCCTCTGG + Intronic
1181020124 22:20095795-20095817 AACAAGCTCAGGGCTCCCACTGG - Intronic
1181048406 22:20227421-20227443 AACCAGCTCAGGGCTGCCAGGGG - Intergenic
1182227217 22:28808273-28808295 AACAAGAACCCAGCTACCACAGG - Intergenic
1182760952 22:32721980-32722002 AACAAGCTCCTTCCTACCACAGG - Intronic
1183109340 22:35637601-35637623 AGGAAGCTCAGATCTCCCACTGG - Intronic
1184099951 22:42336726-42336748 GACAAACTCAGACCTGCCACAGG + Intronic
950132916 3:10559785-10559807 AACACGTGCAGAGTTACCACTGG - Intronic
952704819 3:36366577-36366599 AGCAAGCTGAGAGCTTGCACAGG - Intergenic
953574773 3:44104259-44104281 AACAAGCCCAGAGTGAGCACTGG + Intergenic
954735721 3:52705490-52705512 ACCAGGCTCAGAGATACCCCTGG + Exonic
958195446 3:90236911-90236933 AACAAGCTGAGACCTACAATTGG + Intergenic
958418869 3:93908311-93908333 AACAAGCTGAGACCTACAATTGG + Intronic
959869554 3:111310849-111310871 AAGAGACACAGAGCTACCACAGG + Intronic
960916270 3:122698143-122698165 ATAAAGCTCAGGGCTGCCACAGG + Intronic
961495087 3:127285424-127285446 AACTAGCTTATAGCTACCCCAGG - Intergenic
961627386 3:128273469-128273491 AACAAGCTCCAAGCTTCCACAGG - Intronic
964165815 3:153704117-153704139 AACAAGTTCAGGGCTTCTACTGG - Intergenic
964449665 3:156800029-156800051 GACAAGCTCATTGCTACCTCAGG - Intergenic
966101392 3:176273239-176273261 GATAAGCACGGAGCTACCACAGG - Intergenic
967313060 3:188124739-188124761 AACAAGCTGAAAGATACAACTGG + Intergenic
968048761 3:195639282-195639304 TGCAACTTCAGAGCTACCACAGG - Intergenic
968098642 3:195950342-195950364 TGCAACTTCAGAGCTACCACAGG + Intergenic
968305857 3:197650642-197650664 TGCAACTTCAGAGCTACCACAGG + Intergenic
969564898 4:7971774-7971796 ACCAAGCTCAGAGGTACCCCTGG + Intronic
971822513 4:31576448-31576470 AAAAAACTCAGAACTACCAATGG - Intergenic
972660453 4:41110959-41110981 AACAAGCTCAGGGTTCCCACTGG - Intronic
972706436 4:41548704-41548726 AACAAGGTGAGAGCAGCCACTGG - Intronic
977585601 4:98772447-98772469 AACAGGCTCAGATTTACGACTGG + Intergenic
978794200 4:112692582-112692604 TTCAAGCTCACAGATACCACGGG - Intergenic
979623193 4:122818640-122818662 AACAAGCTCAGGGTTCCCACTGG - Intergenic
979814212 4:125079528-125079550 AACTTGCTCAGATCTTCCACTGG + Intergenic
979954997 4:126941549-126941571 GACAAGTTCAGGGCTTCCACAGG + Intergenic
980326076 4:131348364-131348386 AATAAGTTCAGAGCAACTACAGG + Intergenic
980643074 4:135604296-135604318 AGCAAGCTGAGAGCTTGCACAGG + Intergenic
981315315 4:143335905-143335927 CACAAGCTCCGAGCTGGCACCGG + Intergenic
985140087 4:186831110-186831132 AACAAGGAAAGAGCTAACACAGG - Intergenic
985530022 5:428722-428744 AACAAGCTCAGAGCTACCACTGG - Intronic
986813895 5:11386970-11386992 TTCATGCTCAGAGCTGCCACTGG - Intronic
988787358 5:34577344-34577366 GCCCAGCCCAGAGCTACCACAGG - Intergenic
994221032 5:97194954-97194976 AACAAGCACAGAACTAAAACAGG - Intergenic
995415708 5:111910692-111910714 AACAAACTCAAAGCTCCCCCAGG + Intronic
996118362 5:119644006-119644028 AACAACCTCAGAACTCCCCCAGG - Intergenic
998269455 5:140693519-140693541 AACAGGGTCAGAGATGCCACAGG + Intronic
999450797 5:151676457-151676479 CTCCAGCTCAGAGCTTCCACAGG + Intronic
1000706928 5:164523970-164523992 AACAAACTCAGGTCTCCCACTGG + Intergenic
1001996442 5:176163927-176163949 ATTAAGCATAGAGCTACCACAGG + Intergenic
1007972527 6:46067218-46067240 AACAAGCTCAGTGCCCCCACAGG + Intronic
1008927877 6:56906374-56906396 AGCAAGCTGAGAGCTTTCACAGG + Intronic
1009441172 6:63680373-63680395 AACCAGCTCAGAGTTACTAGTGG - Intronic
1011513405 6:88126272-88126294 AACCTGCCCAGAGCTGCCACAGG + Intergenic
1013045241 6:106478944-106478966 AAGAAACTCAGGGCTTCCACTGG + Intergenic
1015985630 6:138881599-138881621 AACAAGCTCAGGGCTCCCACTGG - Intronic
1016288638 6:142503448-142503470 ATCAAGCTGACAGCTACCTCAGG - Intergenic
1021754213 7:23835197-23835219 ATCAAGCCCAGAGCTGTCACTGG - Intergenic
1024198539 7:47083609-47083631 AACAAGTCCAGAGCAATCACAGG + Intergenic
1026129826 7:67611028-67611050 AAGAAAATCAGAGCTCCCACGGG + Intergenic
1026966650 7:74444351-74444373 GACAAGCTCAGAGATACCCCAGG + Intergenic
1027356485 7:77361100-77361122 AATAAGCCCAGAGCAACTACTGG - Intronic
1029978241 7:104853659-104853681 AACAAGATGAGAGGGACCACAGG + Intronic
1030143228 7:106326741-106326763 AACAAGCTCTGAGCAGCCAGTGG + Intergenic
1030939540 7:115629229-115629251 AACAAGCTCAGGGATCCCACTGG + Intergenic
1031347324 7:120684934-120684956 AACAAGCTCAGGGCTCCCACTGG + Intronic
1034710339 7:153185580-153185602 AACAACCTGAGAGCAGCCACAGG - Intergenic
1036041545 8:5087807-5087829 AACAAGCTCAGTGCTCACCCTGG - Intergenic
1037251106 8:16895226-16895248 TACACCCTCAAAGCTACCACAGG + Intergenic
1037601053 8:20394377-20394399 ACCAAGCTCAGTGCAAGCACTGG + Intergenic
1038166805 8:25093382-25093404 AACAAGCTCAGGGCTCCCACAGG + Intergenic
1043037473 8:75216225-75216247 AACATGCTCAGAGATATCAGAGG + Intergenic
1043115117 8:76241337-76241359 GACAAGATCAGAGCTTTCACTGG - Intergenic
1043935798 8:86140902-86140924 AACAAGCTCAGGGCTCTCACTGG - Intronic
1044031737 8:87246910-87246932 AACAAGCTCAGGGCTCCCATAGG - Intronic
1045739081 8:105333128-105333150 AACAACCTCTGAGCTAACAATGG + Intronic
1046154675 8:110272455-110272477 AACAAGCACAGTCCTACCAGAGG - Intergenic
1051849917 9:21494494-21494516 AGCAAGCTCAGGGCTCCCACTGG - Intergenic
1053398780 9:37800087-37800109 AACAAGTTCAGGGTGACCACAGG - Intronic
1053420556 9:37974913-37974935 CACAAACTCAGAGCTGCCAGCGG + Intronic
1056512648 9:87320475-87320497 AACAAGCTCAGGGCTCCCACTGG - Intergenic
1058485247 9:105437041-105437063 AACAAGCCCAGAGCCACTGCAGG - Intronic
1058504936 9:105657367-105657389 CACAGGCTCACAGCTAACACTGG - Intergenic
1061489287 9:130936375-130936397 AACAAGCCCAGAGCTGGCACAGG + Intronic
1062016700 9:134294697-134294719 AACACGCTCAGGGCGACCTCTGG + Intergenic
1062233955 9:135499338-135499360 AGCCAGCTCTGAGCTGCCACAGG - Intronic
1185834274 X:3330368-3330390 AACAAGCTGAGAGTGATCACAGG - Exonic
1185927178 X:4160552-4160574 AACAAGCTCAGAGTTACCCTGGG - Intergenic
1186068878 X:5795976-5795998 AACAAGCTCAGGGCTCCCACTGG - Intergenic
1186154048 X:6707464-6707486 AGCAAGCTTAGGGCTCCCACTGG - Intergenic
1187583086 X:20630411-20630433 AAGTAGCTCTGAGCTACCAATGG - Intergenic
1189741518 X:44121987-44122009 ACCATGCCCAGAGGTACCACAGG + Intergenic
1189902996 X:45727255-45727277 AACAAGATCGGAGCCACCCCAGG + Intergenic
1192904685 X:75538480-75538502 ATCAAGTTTAGATCTACCACAGG - Intergenic
1195675291 X:107503070-107503092 CACAGGCACATAGCTACCACTGG + Intergenic
1197814162 X:130479417-130479439 AACAATCTCAGAGCTAACTTTGG - Intergenic