ID: 985530028

View in Genome Browser
Species Human (GRCh38)
Location 5:428751-428773
Sequence TAACTAGGCGGCCCCATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985530022_985530028 6 Left 985530022 5:428722-428744 CCAGTGGTAGCTCTGAGCTTGTT 0: 1
1: 0
2: 18
3: 24
4: 151
Right 985530028 5:428751-428773 TAACTAGGCGGCCCCATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985530028 Original CRISPR TAACTAGGCGGCCCCATGGC GGG Intronic
No off target data available for this crispr