ID: 985535950

View in Genome Browser
Species Human (GRCh38)
Location 5:465878-465900
Sequence GAATCCTGGAGTGGAGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985535944_985535950 20 Left 985535944 5:465835-465857 CCAGACATCAGGTAAGGGATGCA 0: 1
1: 0
2: 0
3: 6
4: 135
Right 985535950 5:465878-465900 GAATCCTGGAGTGGAGCGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985535950 Original CRISPR GAATCCTGGAGTGGAGCGGC AGG Intronic
901755102 1:11436755-11436777 CATTCCTGGAGTGGAGAGGAAGG - Intergenic
902885927 1:19404781-19404803 GAATCCCTGACAGGAGCGGCTGG - Intronic
902902266 1:19526249-19526271 GGATCCTGGAGTTGAGTGTCTGG - Intergenic
903156748 1:21450083-21450105 GAAGTCTGGAATGAAGCGGCTGG + Intronic
904481640 1:30797722-30797744 AAATCCTGGCGGGGAGGGGCCGG - Intergenic
906532429 1:46531475-46531497 GAAGCCAGGAGTGGATGGGCAGG + Intergenic
914362742 1:146949604-146949626 GAAGTCTGGAATGAAGCGGCCGG + Intronic
914488932 1:148137507-148137529 GAAGTCTGGAATGAAGCGGCCGG - Intronic
915352748 1:155236539-155236561 GAATCCTGGAGTTGGGTGACGGG + Intronic
916314853 1:163437849-163437871 GAATGCTGGAGTTGGGGGGCAGG + Intergenic
918439249 1:184549649-184549671 AAATTCAGGAGTGGAGCAGCAGG + Intronic
920366397 1:205450363-205450385 AAAAGCTGGAGGGGAGCGGCAGG - Intronic
921155563 1:212435589-212435611 TAAGCCTGGAGTGCAGTGGCAGG + Intronic
1063679371 10:8172321-8172343 GAATCCAGGAGTGGATGAGCTGG - Intergenic
1063829923 10:9940845-9940867 GATTCCTGGAGTGAAGGGACTGG - Intergenic
1064198966 10:13268644-13268666 GACTCCTAGAGTGGAGAGGGAGG + Intergenic
1064606625 10:17048519-17048541 CAAGGCTGGAGTGGAGTGGCGGG + Intronic
1065306264 10:24372043-24372065 GACTCCTGGAGTGGGGAGGCAGG + Intronic
1065552885 10:26887204-26887226 GAATTCTGGAGAGGAGAGGAAGG - Intergenic
1067435406 10:46273168-46273190 GATTCCTGGGGTGCAGGGGCTGG - Intergenic
1067546728 10:47197182-47197204 GAAGCCAGGAGTGGAGCTGCGGG + Intergenic
1067767882 10:49102179-49102201 GAGTGCTGGAGTGCAGTGGCGGG + Intronic
1071837507 10:89433286-89433308 GAATGCTGCAGTGTAGCTGCCGG + Exonic
1074772486 10:116742766-116742788 GAAGCCGGGAGAGGAGAGGCCGG - Intergenic
1076606391 10:131692336-131692358 CAACCCTGGAGTGGAAGGGCAGG - Intergenic
1076908724 10:133377079-133377101 GGATCCTCCTGTGGAGCGGCAGG - Intergenic
1079344803 11:19642505-19642527 GAATCCAGCAGTGGAACTGCAGG - Intronic
1079726279 11:23883874-23883896 GACTCCTACAGTGCAGCGGCGGG + Intergenic
1081763703 11:45594617-45594639 GCATCCTGGAGTTGAGCAGGTGG - Intergenic
1082964364 11:58950245-58950267 CAAGGCTGGAGTGCAGCGGCGGG - Intronic
1083514256 11:63242183-63242205 GAATCCAGGGGTGGAGGGGGAGG - Intronic
1092024877 12:5232064-5232086 GAACCCTGGGGTGGAGCAGAGGG - Intergenic
1092704210 12:11266801-11266823 GAATACTGGACTCGAGAGGCTGG + Intronic
1092708204 12:11307848-11307870 GAATACTGGACTCGAGAGGCTGG + Intronic
1092716466 12:11394138-11394160 GAACTCTGGAGTGGAGCGCCAGG + Intronic
1095280711 12:40349563-40349585 GAGTGCTGGAGTGCAGTGGCAGG + Intronic
1097120168 12:56725336-56725358 GAAGCCTGGAGCGGAGGGGGTGG + Intronic
1097994857 12:65877213-65877235 GAATGTTGACGTGGAGCGGCAGG + Intronic
1102191000 12:110988228-110988250 GATTCCTGGAGAGGAGGGGCTGG + Intergenic
1104749709 12:131230529-131230551 GACTCCGGGAATGGAGGGGCAGG - Intergenic
1104854902 12:131896926-131896948 GAGCCCTGGAGGGGAGCAGCAGG - Intronic
1104866821 12:131960909-131960931 GAAGCCTGGAGAGGTGGGGCTGG - Exonic
1104885371 12:132104277-132104299 GAAGCCTGGAGAGGTGGGGCTGG - Intronic
1105753550 13:23444270-23444292 GAGTCCTGGAGTCTAACGGCTGG - Intergenic
1105781187 13:23706294-23706316 GAGGCCTGGAGTGGAGCTGCTGG + Intergenic
1113664584 13:112132314-112132336 GAAGCATGAAGTGGAGGGGCAGG + Intergenic
1113936858 13:113999468-113999490 GAAGCCTGGAGTGCAGTGGGTGG + Intronic
1119639290 14:76302722-76302744 CCATCCTGGAGTGCAGTGGCGGG + Intergenic
1120233533 14:81865296-81865318 GCATCCTAGAATGGACCGGCAGG - Intergenic
1123175174 14:106410065-106410087 GACTCCTGGACTAGAACGGCAGG - Intergenic
1202943513 14_KI270726v1_random:5713-5735 GACTCCTGGACTAGAACGGCAGG + Intergenic
1124637089 15:31372196-31372218 GAATGCTGCAGCGGCGCGGCGGG + Exonic
1124710587 15:32006771-32006793 GAACCCTGGAGTGGAGGTCCTGG - Intergenic
1126746376 15:51829934-51829956 GGAGCCTGGAGTCGGGCGGCCGG - Intronic
1128321095 15:66694846-66694868 GATTCATGTAGTGGAGCGGTGGG + Intergenic
1128686308 15:69688500-69688522 GAATCCAGGAGTGGCTTGGCTGG - Intergenic
1129896202 15:79107830-79107852 GAATCCAGGAGTGGTGGTGCAGG + Intergenic
1130362246 15:83200289-83200311 GAAGGCTGGAGTGCAGTGGCGGG - Intronic
1138651646 16:58464330-58464352 GAGACCCGGAGCGGAGCGGCAGG - Exonic
1141609070 16:85171000-85171022 GGATCCTGGAGGGGACCGCCCGG - Intergenic
1142012720 16:87724811-87724833 GATATCTGGAGTGGAGCTGCTGG - Intronic
1143201481 17:5116319-5116341 GAAGCCGGGAGTGGTGAGGCGGG - Intronic
1143379355 17:6486338-6486360 GACTCCTAGAGGGGAGCAGCAGG - Intronic
1143645209 17:8225557-8225579 GGATCCTGGTGTGGAAGGGCAGG - Intergenic
1144058339 17:11560306-11560328 CATTCCTGGAGTCGTGCGGCTGG + Exonic
1145752774 17:27367211-27367233 AAATCCTGGAGTGGATCTGCAGG + Intergenic
1146917926 17:36690053-36690075 AAATCCTGGAGTCCAGGGGCTGG - Intergenic
1148289517 17:46431947-46431969 GACTCCTGAAGTGAAGCGGTTGG + Intergenic
1148311686 17:46649519-46649541 GACTCCTGAAGTGAAGCGGTTGG + Intronic
1150150845 17:62808037-62808059 GAGAACTGGAGCGGAGCGGCGGG + Intronic
1150436383 17:65157473-65157495 GAATCCTTGAGGGGAGCAGGTGG + Intronic
1153044777 18:845699-845721 GAATCCTGGTGTGCAGAGGCTGG + Intergenic
1154193854 18:12252091-12252113 GAATCCTGGAGTGCTGCGCTAGG - Intergenic
1160137640 18:76286106-76286128 GCATCCTGGGGTGGATCGGGTGG + Intergenic
1160551007 18:79693887-79693909 GCATCCTGCAGGGGAGCGGAGGG - Intronic
1161997052 19:7719686-7719708 GAATCTTGGAGTGGAGGGTGTGG + Intergenic
1162958926 19:14114782-14114804 GAACCCTGGAGTGGAGTTGGGGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163427842 19:17248726-17248748 CAGTCCTGGTGTGGAGGGGCAGG + Intronic
1164989574 19:32674673-32674695 GTCTGCTGGAGGGGAGCGGCGGG - Intronic
1166884607 19:45952799-45952821 GAAGCCTGGAGGAGAGCTGCAGG - Intronic
925121725 2:1423411-1423433 TAATCCTGGAGAAGAGAGGCTGG - Intronic
925242503 2:2344181-2344203 GAAGGGTGGAGTGGAGAGGCAGG + Intergenic
925969568 2:9096926-9096948 GAAGCCGGGTGTGGAGCGGGAGG + Intergenic
926319548 2:11739345-11739367 GAATCCAGGAGTGGCCCAGCTGG - Intronic
927734359 2:25505251-25505273 GAGGCCTTGAGTGGAGAGGCTGG - Intronic
937878050 2:126840492-126840514 GAATCCTGGATTGGAGGTCCTGG - Intergenic
938725957 2:134109290-134109312 GGATCCTGCAGCGGGGCGGCAGG + Intergenic
941713886 2:168744047-168744069 GAAGGCTGGAGTGCAGTGGCGGG + Intronic
942523582 2:176829791-176829813 GACACCTGGAGAGGAGTGGCAGG + Intergenic
943840286 2:192571962-192571984 GAATCCTGGATTGGATTGACTGG - Intergenic
947745865 2:232506969-232506991 GAAGCCTGGAGAGAAGAGGCTGG + Intergenic
948635048 2:239329464-239329486 GAAAGCTGGAGAGGAGCTGCTGG - Intronic
948635162 2:239329997-239330019 GAAAGCTGGAGAGGAGCTGCTGG + Intronic
948795945 2:240402165-240402187 GAATCCTGGGGTGCAGGGACAGG - Intergenic
1168826536 20:818199-818221 GAATCCAGGGGTGCAGCGGATGG + Intergenic
1169358614 20:4928579-4928601 GAATCATGGGATGGAGCTGCTGG - Intronic
1170540522 20:17382851-17382873 GAATCCTGGATTGTAGAGTCTGG - Intronic
1170601713 20:17846400-17846422 GAAGCCTGGAGGGCAGAGGCGGG - Intergenic
1172302525 20:33860083-33860105 GTCACCTGGAATGGAGCGGCAGG + Intergenic
1174917866 20:54672144-54672166 CAAGCCTGGAGTGCAGTGGCAGG + Intergenic
1175744916 20:61449401-61449423 GACTCAGGGAGTGGAGCTGCCGG - Intronic
1175941221 20:62538368-62538390 GAATCCCGGCCTGGCGCGGCAGG + Intergenic
1177638694 21:23818650-23818672 GAGTGCTGGAGTGCAGTGGCAGG - Intergenic
1180080282 21:45483524-45483546 GAACCCTGCAGAGGAGGGGCTGG + Intronic
1180650154 22:17370121-17370143 GGATCCTGGGGTGGAGGAGCAGG + Intronic
1181084171 22:20431684-20431706 GAATCCTGGAGAGATGGGGCGGG - Intronic
1181779756 22:25184160-25184182 GAACCCTGGAGTTGGGCTGCGGG + Intronic
1183099314 22:35574284-35574306 GAATCCTGGGCTTGAGGGGCTGG - Intergenic
1183677467 22:39307503-39307525 GACTCTTGGAGTGGCGAGGCGGG - Intergenic
1183914814 22:41109208-41109230 CCAGCCTGGAGTGGAGCGACGGG - Intronic
1184997059 22:48215064-48215086 GCTTCCTGGAGTGAAGGGGCAGG - Intergenic
1185406629 22:50655910-50655932 GGGTCCTGGATTGGAGGGGCTGG + Intergenic
951549880 3:23866250-23866272 GGATCCTGCAGTGGAGAGGGAGG + Intronic
958154886 3:89743863-89743885 GGATCCAGGAGTGCTGCGGCAGG - Intergenic
968060143 3:195721729-195721751 TAAACCTCGAGTGGAGAGGCCGG + Intronic
969271231 4:6104785-6104807 GAGTCCTGGAGTGAAGGGGGAGG - Intronic
969500975 4:7552750-7552772 GGGTGCTGGAGTGGAGAGGCAGG - Intronic
969704684 4:8785336-8785358 GAACCCTGAAAAGGAGCGGCAGG + Intergenic
972954201 4:44369017-44369039 GAATACTTGAGTGGAGTTGCTGG - Intronic
973790549 4:54374280-54374302 GGCTCCTGGAGTGGAGCAGTAGG + Intergenic
973922597 4:55703603-55703625 GATTCTTGGAGTGGGGCAGCAGG + Intergenic
976290641 4:83413964-83413986 GAATTCTGGAGGGGTGCAGCTGG - Intronic
978214574 4:106183381-106183403 GAAACCTGAAGTGGATGGGCTGG - Intronic
979366478 4:119830603-119830625 GGATGCTGCAGTGGAGCAGCTGG + Intergenic
981141738 4:141277440-141277462 GAATCCTGGAGTGGCTCACCTGG + Intergenic
985535950 5:465878-465900 GAATCCTGGAGTGGAGCGGCAGG + Intronic
986673802 5:10166667-10166689 GGATGCTGGGGTGGAGGGGCTGG - Intergenic
987538549 5:19222211-19222233 GAAGGCTGGATTGGAGCTGCAGG + Intergenic
988460030 5:31426832-31426854 GAATGATGGACTGGAGCGGTGGG + Intronic
992269348 5:75050491-75050513 GAATCCTGGGGTGGATGGGGTGG - Intergenic
995555417 5:113323233-113323255 GAATCCAGGAGTGGCTTGGCTGG - Intronic
995610003 5:113899132-113899154 GAAGCAAGGAGTGGAGAGGCAGG + Intergenic
997345745 5:133190758-133190780 GAATACTGGAGTGCGGGGGCGGG - Intergenic
997401997 5:133611092-133611114 GACACCTAGAGGGGAGCGGCGGG + Intronic
997888097 5:137649553-137649575 GAATCCTGGAGTGGCTTAGCTGG - Intronic
1001083772 5:168685795-168685817 GAAGCCTGGTGGGCAGCGGCAGG + Exonic
1005166641 6:22929733-22929755 ATAACCTGGAGTGGAGCTGCTGG + Intergenic
1005923149 6:30418276-30418298 CAATCCTGGAGTGCAGAGGGTGG + Intergenic
1013152616 6:107460264-107460286 CAATCCTGGAGTTGAGCTCCAGG - Intergenic
1019576392 7:1739673-1739695 GGATGCTGGAGTGGAGAGGGCGG + Intronic
1021664968 7:22968140-22968162 GTAGTCTGTAGTGGAGCGGCTGG - Intronic
1024083579 7:45875704-45875726 GAATACTGGAGTGAAGCAGCGGG + Intergenic
1024443908 7:49454052-49454074 GGATCCTGCACTGGAGCTGCAGG - Intergenic
1026215271 7:68342911-68342933 GAATCCTGGACTCTAGCGGCTGG - Intergenic
1029505728 7:100963041-100963063 GGATCTTGGAGGGGAGCAGCAGG + Intronic
1035279671 7:157769812-157769834 GAATCCAGGTGAGGAGCGCCTGG - Intronic
1036294676 8:7526397-7526419 GAATTCTGGTGTGGAGCTCCTGG - Intergenic
1036327886 8:7794594-7794616 GAATTCTGGTGTGGAGCTCCTGG + Intergenic
1038418877 8:27419311-27419333 GATTCATGGAGTGGTGGGGCTGG - Intronic
1040373904 8:46804032-46804054 GACTCCTGAAGTAGAGTGGCTGG + Intergenic
1040551357 8:48439928-48439950 GAACTCTGCAGTGGAGCCGCGGG - Intergenic
1040851101 8:51900703-51900725 GCATTCTGGAGTAGAGCTGCGGG + Intergenic
1042066318 8:64880946-64880968 GACTCCTGGAGTGGAGGTGGGGG + Intergenic
1047151710 8:122271457-122271479 GCATCCAGGAGTGGAGGAGCGGG + Intergenic
1048919316 8:139213470-139213492 GAATCCTGGAGTGGATGCTCTGG + Intergenic
1049219291 8:141421572-141421594 GAGTCCTGGAGTGGGGCAGGGGG - Exonic
1056855374 9:90124074-90124096 GAGTGCTGGAGTGCAGTGGCGGG + Intergenic
1057155597 9:92836200-92836222 AAATACTGGAGTGGAATGGCTGG + Intergenic
1057606804 9:96504303-96504325 GAATCGTGGAGTGCGGAGGCAGG - Intronic
1058895658 9:109398529-109398551 GGATGCTGAAGTGGAGGGGCCGG + Intronic
1059924898 9:119199230-119199252 GACTCCTGCAGTGGGGCGGAGGG - Intronic
1060068243 9:120523955-120523977 GAAACCTGGAGAGGAGCAGCTGG + Intronic
1060958624 9:127663270-127663292 GAATCCTATACTGGAGCGCCTGG + Exonic
1061006427 9:127930790-127930812 GATTCCTGCAGCGGGGCGGCGGG - Exonic
1061056584 9:128225929-128225951 GAATCCAGGGGTGGAGAGGATGG - Intronic
1188248010 X:27857250-27857272 GACTTCTGGAGTGAAGCCGCAGG + Intergenic
1190888681 X:54551062-54551084 GAATTGTGGAGTGGAGGAGCAGG - Intronic
1193657959 X:84221572-84221594 GAATACTGGATTGGAGTGGGTGG + Intergenic
1194049485 X:89052031-89052053 GAATTCTGGAGTGGCTTGGCAGG + Intergenic