ID: 985537125

View in Genome Browser
Species Human (GRCh38)
Location 5:471871-471893
Sequence GTCCCCATTGAGTCCCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537125 Original CRISPR GTCCCCATTGAGTCCCTGGT GGG (reversed) Exonic
901448693 1:9323348-9323370 GTCCCCAGTGACTCCATGGAGGG - Intronic
903169316 1:21542259-21542281 GTTGCCCTTGTGTCCCTGGTGGG - Intronic
906484287 1:46222287-46222309 GTCCCCTCTGAGCCCCAGGTTGG - Intergenic
912950504 1:114117403-114117425 GTCCCCACTGCCTGCCTGGTGGG + Intronic
913709972 1:121473078-121473100 GCCCCCACAGAGTCCCTGCTGGG - Intergenic
913797345 1:122639708-122639730 GACCCCTTTGAGTCCTTCGTTGG + Intergenic
913805149 1:122781139-122781161 GACCCCTTTGAGTCCTTCGTTGG + Intergenic
913807823 1:122829088-122829110 GTCCTCATTGAGGCCTTCGTTGG + Intergenic
913841906 1:123438661-123438683 GTCCCCTTTGAGGCCTTCGTTGG + Intergenic
913874745 1:124029534-124029556 GACCCCTTTGAGGCCCTCGTTGG + Intergenic
913895491 1:124400294-124400316 GTCCTCATTGAGGCCTTCGTTGG + Intergenic
913896411 1:124416952-124416974 GACCCCTTTGAGTCCTTCGTTGG + Intergenic
916712671 1:167425586-167425608 GTCCCCATAGTGACCCTGGTTGG - Exonic
923329319 1:232908177-232908199 CTCCCCATTTTGCCCCTGGTTGG - Intergenic
1063433136 10:6008484-6008506 GACCTCATTGAGTTCCTGGAGGG + Intergenic
1066864011 10:40371380-40371402 GACCCCATTGAGGCCATTGTTGG + Intergenic
1066871757 10:40524957-40524979 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066875922 10:40607774-40607796 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066881046 10:40709966-40709988 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066888151 10:40849209-40849231 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066897580 10:41035770-41035792 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066911509 10:41308839-41308861 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066914307 10:41363869-41363891 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066915004 10:41377451-41377473 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066919988 10:41475648-41475670 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1066920094 10:41477686-41477708 GACCCCATTGAGGCCATCGTTGG + Intergenic
1066924260 10:41558836-41558858 GACCCCTTTGAGTCCTTCGTTGG + Intergenic
1070850782 10:79560134-79560156 GGCCCTGCTGAGTCCCTGGTAGG + Intronic
1073664616 10:105516683-105516705 GTCCCCAAAGCATCCCTGGTTGG - Intergenic
1075256309 10:120928368-120928390 ATCCCTATTCAGCCCCTGGTAGG + Intergenic
1076555270 10:131317470-131317492 GTCCAGATTGAGCCCCTGGTGGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081994390 11:47354210-47354232 GACCCAAGTGAATCCCTGGTGGG - Intergenic
1083696351 11:64445352-64445374 CTCCCCACTGAGTCACTGGTGGG + Intergenic
1084055330 11:66628193-66628215 GCCTCCATTTTGTCCCTGGTTGG - Intronic
1087923186 11:103890341-103890363 GTACCAATTTAGTTCCTGGTAGG - Intergenic
1091440656 12:509968-509990 GTCCTCCTTGAGTCCTTGTTTGG + Intronic
1094914343 12:35332372-35332394 GTCCTCTTTGAGTCCTTCGTTGG + Intergenic
1099467026 12:83000699-83000721 GTCCCCATAGAGTCCCCACTGGG - Intronic
1101841476 12:108330657-108330679 GTCCCCACTGGATCCCTGCTGGG - Intronic
1106756472 13:32827349-32827371 ATGCCCATTGAGTCTGTGGTGGG + Intergenic
1113782634 13:112985492-112985514 GTCCCCTGTGAGTCCCTCGCAGG + Intronic
1113791919 13:113033517-113033539 GTCCCCACTGTTTCCCTGTTGGG + Intronic
1114657325 14:24323993-24324015 GTTCCCTTTCAGTCCCTGGCAGG + Intronic
1115435206 14:33364418-33364440 GAGCCCATTATGTCCCTGGTAGG - Intronic
1119003807 14:70907222-70907244 GACCCCATTCTGCCCCTGGTAGG - Intergenic
1119774953 14:77242559-77242581 GTCCCCTTGGAGTCTCTGTTGGG - Intronic
1121235997 14:92391626-92391648 TCCCCCATTGAGTCCCTGCCTGG + Intronic
1121838639 14:97114800-97114822 AACCCCATTGTGTGCCTGGTGGG + Intergenic
1122272687 14:100575429-100575451 GTCCCCATGGAGACACTGGGGGG + Intronic
1123129007 14:105970764-105970786 GTCTGCAGAGAGTCCCTGGTGGG + Intergenic
1202868151 14_GL000225v1_random:136144-136166 GTCCCAGGTGAGTCCGTGGTGGG - Intergenic
1123409523 15:20046929-20046951 GTCTGCAGAGAGTCCCTGGTGGG + Intergenic
1123518853 15:21053637-21053659 GTCTGCAGAGAGTCCCTGGTGGG + Intergenic
1126330146 15:47523030-47523052 ATCCCCACTGCCTCCCTGGTGGG - Intronic
1131510015 15:93044674-93044696 GTTCCCAGTGTGTCTCTGGTGGG + Intronic
1132101877 15:99029459-99029481 TTACCCAGTGAGTCCCTGGAGGG + Intergenic
1133358120 16:5151965-5151987 GACCACTTTGAGTCCTTGGTGGG + Intergenic
1136707762 16:32202892-32202914 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136760147 16:32726519-32726541 GTCCACATGCAGTCCCTGGGGGG + Intergenic
1136807957 16:33143867-33143889 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136871276 16:33810107-33810129 GTCTGCAGAGAGTCCCTGGTGGG - Intergenic
1203100896 16_KI270728v1_random:1305951-1305973 GTCTGCAGAGAGTCCCTGGTGGG + Intergenic
1144781737 17:17811773-17811795 GTCCCCATCAGGTCCCTGGGTGG - Intronic
1144847241 17:18226328-18226350 GGCTCCATTGCGTCCCTGCTCGG + Intronic
1145688725 17:26708756-26708778 GTCCTCTTTGAGTCCTTTGTTGG + Intergenic
1147163069 17:38578940-38578962 TTCCCCCTTCAGTCCCTAGTGGG - Intronic
1147331894 17:39704274-39704296 GTCCCCGTTGATTTCCTGGGGGG - Intronic
1149548573 17:57522719-57522741 GTCCTCAGTGAGATCCTGGTGGG + Intronic
1152881423 17:82818263-82818285 GCCCCCATTCTGTTCCTGGTGGG + Intronic
1155991596 18:32284587-32284609 GTCCCCACTGTGTGCCAGGTAGG + Intronic
1160888920 19:1366651-1366673 GGCCCCAGTGAGTGTCTGGTTGG - Intronic
1161162658 19:2769672-2769694 GTCCCCAAGAAGTCCCTGGGGGG - Intronic
1162494221 19:11014140-11014162 GGTCCCAATGAGTGCCTGGTTGG - Intronic
1163394070 19:17048864-17048886 GTCCCCAGTGAGTCCAGGTTGGG - Intergenic
1164534325 19:29073828-29073850 GTCCCCATTGCTGCCTTGGTGGG - Intergenic
1165425962 19:35745537-35745559 CTCCCCATAGACTCCCCGGTAGG + Exonic
929820853 2:45272284-45272306 ATCCCCATTGTGTCCCAGGCAGG + Intergenic
934490391 2:94758520-94758542 ATCCCCAAGGAGTGCCTGGTGGG - Intergenic
936340793 2:111630913-111630935 GTCCCCACTAGGTCTCTGGTTGG + Intergenic
942705396 2:178765943-178765965 GTCCTCTTTGAGACCCTGGAAGG - Intronic
943447607 2:188007519-188007541 GTCCCCTTTAAGTTGCTGGTTGG - Intergenic
944899125 2:204196491-204196513 GTCTCAATAGAGTCCCTGGAAGG - Intergenic
946147884 2:217744538-217744560 TTCCCCAGTGTGTGCCTGGTTGG + Intronic
948937970 2:241180738-241180760 GTCCACATGGAGGCACTGGTCGG + Intronic
1169039639 20:2482477-2482499 GTCCCCGTTGAGTCAAGGGTTGG + Exonic
1179672918 21:42962408-42962430 GTCCCCAGTGAGAACCTGGAAGG + Intergenic
1180054617 21:45351378-45351400 GTCCCCGCTGAGCCCCAGGTAGG - Intergenic
1182122601 22:27797455-27797477 GACCTCATTGGGTCCCTGGACGG - Exonic
1182441401 22:30366357-30366379 GTCACCATTGAGTACCTGTCGGG + Intronic
1182895220 22:33853961-33853983 GTCCCAACTGAGTCCCTACTGGG + Intronic
1183688700 22:39376238-39376260 TTCCCCACTGAGCCCCTGGATGG + Intronic
1184649686 22:45913847-45913869 GTGCCCATTGAGTCACTGAGAGG + Intergenic
1184804277 22:46782429-46782451 GACCCCATTGTGTCCCAGGAAGG - Intronic
949644436 3:6076700-6076722 GTCCCCTTTGTGTCCCTGCCTGG + Intergenic
950170000 3:10832293-10832315 ATCCCCAGTGCCTCCCTGGTGGG - Intronic
950313319 3:11978099-11978121 CTCACCATTGAGCCACTGGTTGG + Intergenic
950419926 3:12892667-12892689 GTCCCCATGGAGGTCCTGGGTGG - Intergenic
950477585 3:13223661-13223683 GTCCCCAGTGTGTCTCTTGTGGG - Intergenic
956376176 3:68615922-68615944 GTATCCATTTGGTCCCTGGTTGG - Intergenic
957062639 3:75494560-75494582 GTCCACTTTGAGTCCTTGGTTGG + Intergenic
961290761 3:125844856-125844878 GACCACTTTGAGTCCATGGTTGG - Intergenic
961613331 3:128159131-128159153 TTCCCCATTGAGTGCCTGCTCGG + Intronic
966733884 3:183173449-183173471 CTCCCCACTGAGCCCATGGTGGG - Intergenic
967125660 3:186421897-186421919 GTTACCAATGTGTCCCTGGTGGG + Intergenic
969006539 4:4024685-4024707 GACCACTTTGAGTCCTTGGTTGG + Intergenic
976080086 4:81345946-81345968 GTCCCAAGGGAGGCCCTGGTGGG + Intergenic
977876363 4:102155128-102155150 GTCTCCATTGTGTCCATCGTGGG - Intergenic
978756954 4:112313050-112313072 GTTCACATTGAACCCCTGGTTGG - Intronic
980468139 4:133213121-133213143 GACATCATTAAGTCCCTGGTAGG - Intergenic
985537125 5:471871-471893 GTCCCCATTGAGTCCCTGGTGGG - Exonic
985990611 5:3557454-3557476 GCCCTCATGGAGTCCCTTGTGGG + Intergenic
987205374 5:15619829-15619851 GTTCACATTGCTTCCCTGGTTGG + Intronic
989966896 5:50475374-50475396 GCCCCCACAGAGTCCCTGCTGGG + Intergenic
998081259 5:139276714-139276736 GCCCCCTTTGAGCCCTTGGTAGG - Intronic
1002009301 5:176264263-176264285 GCCCCCATAGAGTCCCTACTGGG - Intronic
1002217425 5:177648020-177648042 GCCCCCATAGAGTCCCTACTGGG + Intergenic
1003349547 6:5303196-5303218 TTCCCCACTGAGTCCCTGCCAGG - Intronic
1005947097 6:30602669-30602691 GTCCCCATGGAGGCCCTGGTGGG - Exonic
1006078304 6:31548380-31548402 GTCCCCATGGCGGTCCTGGTGGG - Exonic
1009832975 6:68962970-68962992 GTCTGAATTGAGTCCCAGGTAGG - Intronic
1013467572 6:110430796-110430818 GTTCCCACTGAGTGCCTGCTGGG - Intronic
1013940370 6:115653707-115653729 GTCCACATTGAGTCTCAGCTTGG - Intergenic
1015796400 6:137016240-137016262 GTCCCCATGGAGCCCCAGCTGGG - Intronic
1015978549 6:138815964-138815986 CTCCCCATGGAGTCACTGGAAGG + Intronic
1019064773 6:169287913-169287935 GTCCCCATGGAGCCTCTGGAGGG - Intergenic
1022842541 7:34178542-34178564 GGCCGCATTCAGTTCCTGGTGGG + Intergenic
1023899896 7:44467576-44467598 GTCCCCATTGAGGCCCGGCAGGG + Intronic
1023908600 7:44538801-44538823 GTGCCAAGTGAGTCCATGGTGGG - Exonic
1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG + Intergenic
1025370168 7:59003630-59003652 GACCGCATTGAGGCCTTGGTTGG + Intergenic
1025388186 7:59323509-59323531 GACCCCATTGAGGCCTTCGTTGG + Intergenic
1029650854 7:101890355-101890377 GTCCCCATTTTGACCATGGTTGG - Intronic
1030455151 7:109762861-109762883 CTCCTTATTGACTCCCTGGTTGG + Intergenic
1030559078 7:111063025-111063047 GTCCCCACAGAGTCCCTACTGGG - Intronic
1035203550 7:157280785-157280807 GTGCCCATTGTGCCCTTGGTGGG + Intergenic
1040142807 8:43945359-43945381 GACCGCTTTGAGTCCTTGGTTGG + Intergenic
1040271471 8:45951556-45951578 GACCGCTTTGAGTCCTTGGTTGG + Intergenic
1049245719 8:141561271-141561293 GTGCCCATGGAGGCCCTGGATGG + Intergenic
1051291713 9:15552467-15552489 GTCCCCATTGTATCCCAGCTGGG - Intergenic
1052860723 9:33436328-33436350 GTCCCCAAGCCGTCCCTGGTTGG - Intergenic
1057259410 9:93575889-93575911 TTCCCCACTGAGTTTCTGGTTGG - Intergenic
1060492792 9:124097330-124097352 GGCCCCACAGAGTCCCTGCTGGG - Intergenic
1203736627 Un_GL000216v2:144124-144146 GTCCCAGGTGAGTCCGTGGTGGG + Intergenic
1185726397 X:2425532-2425554 ATCCCCTGTGAGTCCCTGGCAGG + Intronic
1187125233 X:16448279-16448301 TTCCCCATTGGGTTCCTGATTGG + Intergenic
1190372516 X:49756494-49756516 GTCCCCGTTGTTTCCCTGGGAGG - Intergenic
1199655356 X:149989489-149989511 GTCCCCATTGAATCCTGGGAAGG - Intergenic