ID: 985537125

View in Genome Browser
Species Human (GRCh38)
Location 5:471871-471893
Sequence GTCCCCATTGAGTCCCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537125 Original CRISPR GTCCCCATTGAGTCCCTGGT GGG (reversed) Exonic