ID: 985537154

View in Genome Browser
Species Human (GRCh38)
Location 5:472088-472110
Sequence CTGTGGGACTTGCCGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985537137_985537154 26 Left 985537137 5:472039-472061 CCACCTCCACCACTTCCACCGTG 0: 1
1: 0
2: 8
3: 90
4: 827
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
985537145_985537154 8 Left 985537145 5:472057-472079 CCGTGCAGGCAGGTTTCAGGTGG 0: 1
1: 0
2: 4
3: 18
4: 202
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
985537140_985537154 20 Left 985537140 5:472045-472067 CCACCACTTCCACCGTGCAGGCA 0: 1
1: 0
2: 1
3: 19
4: 289
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
985537143_985537154 11 Left 985537143 5:472054-472076 CCACCGTGCAGGCAGGTTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 131
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
985537142_985537154 17 Left 985537142 5:472048-472070 CCACTTCCACCGTGCAGGCAGGT 0: 1
1: 0
2: 1
3: 17
4: 141
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
985537138_985537154 23 Left 985537138 5:472042-472064 CCTCCACCACTTCCACCGTGCAG 0: 1
1: 0
2: 1
3: 39
4: 310
Right 985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537154 Original CRISPR CTGTGGGACTTGCCGTCTGA GGG Intronic
901365047 1:8739736-8739758 CTGTGGGACTTGATGACTGGAGG - Intronic
901828455 1:11878085-11878107 CTGATGGTCATGCCGTCTGAGGG - Intergenic
902976189 1:20090301-20090323 CTGGGGGACTCCCAGTCTGATGG - Intronic
904501615 1:30915924-30915946 CTGTGGGCCTTGCCCTATGCTGG - Intergenic
906248166 1:44291704-44291726 GTGTGGGACTCTCTGTCTGAGGG - Intronic
908564879 1:65344180-65344202 CTGTGTGACTTTCCTTCTGCAGG - Intronic
909882632 1:80899348-80899370 CTGGGGGACTTGTCGTCTTCTGG + Intergenic
910235974 1:85036914-85036936 CTGTGGAACTTGCATTCTAATGG - Intronic
911780873 1:101876337-101876359 CTTTTGGACTTGCCGTATGGAGG - Intronic
915608395 1:156969985-156970007 ATGGGGGACTTACCTTCTGATGG + Exonic
916445156 1:164864987-164865009 CTGGGGGGATTGCCATCTGATGG + Intronic
916758639 1:167797109-167797131 GTGTGGGACTTGCTGGCTGCTGG - Intergenic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
922052995 1:222012086-222012108 CTCTGTGACTTGCTGTCTGCTGG + Intergenic
922291166 1:224210088-224210110 CTGTGGGTCTTGGGGTCTGTGGG - Intergenic
1066114537 10:32227840-32227862 CTGAGGAACTTGGAGTCTGATGG + Intergenic
1066467853 10:35669210-35669232 CTGTGGGAGTTGTTGCCTGAGGG + Intergenic
1069706414 10:70461406-70461428 CTGTGGAGCTTGCCATCTGGTGG - Intergenic
1070754413 10:78982697-78982719 CTGTTGGCTTTGCCTTCTGAGGG + Intergenic
1073057408 10:100711240-100711262 ATGGGGCACTTGCTGTCTGAAGG - Intergenic
1073121506 10:101124995-101125017 CTGTGGGACCAGGCCTCTGAGGG - Intronic
1076851199 10:133094140-133094162 GTGTGGGGCTTCTCGTCTGAAGG - Intronic
1077930060 11:6721539-6721561 CTGAGGGACTTGCTGACAGAAGG - Intergenic
1081677841 11:44981258-44981280 CTGTGTGCTTTGGCGTCTGATGG - Intergenic
1086464425 11:87038268-87038290 CTGGGGGACTTGCCTTGTGTCGG + Intronic
1088869840 11:113881161-113881183 CTGTGAGACTTGCCAACTGATGG - Intergenic
1089123464 11:116159653-116159675 CTGTGGGACTAGCAATATGAAGG + Intergenic
1089566554 11:119374800-119374822 TTGTGGGACTTGCCCTGTGATGG + Intronic
1092073291 12:5651239-5651261 CTGTGCTACTTGCTGTCTGGAGG - Intronic
1102565519 12:113794886-113794908 CTGTGGGACCCGCCGTCTTACGG - Intergenic
1103237637 12:119386581-119386603 CTTTAGGAGTAGCCGTCTGAGGG + Intronic
1104435662 12:128754494-128754516 CTGGGTGACTTGCTGTCTGCTGG + Intergenic
1106302208 13:28478462-28478484 CTGTGAGACTTTCCTTCTAAGGG - Intronic
1115743203 14:36409719-36409741 GTGTAGGACCTGCCGTCTGCCGG - Intergenic
1119109215 14:71955954-71955976 ATGAGGGACTTGCCTTCTGCTGG + Intronic
1119485646 14:74984915-74984937 CTGTGGGACTTGGGGACTGAGGG + Intergenic
1122079281 14:99255914-99255936 CTCTGGGCCTTGCCTTCTGATGG - Intronic
1124439133 15:29674610-29674632 CTGTGAGACCAGCCGCCTGAGGG + Intergenic
1126423300 15:48498759-48498781 CTGTGGGACTTGGCCACTGAGGG - Intronic
1127679399 15:61278113-61278135 CTGAGGGACTTTCTGTCTGCAGG - Intergenic
1127993602 15:64138410-64138432 CTCTGAGTCTTGCCCTCTGATGG + Exonic
1132345893 15:101108612-101108634 CTGTCGGAGTTGGGGTCTGAAGG - Intergenic
1137704624 16:50526155-50526177 CTGTAGGAGTTGCAGTCTGGGGG - Intergenic
1140986557 16:80163459-80163481 CTGTGGGAATTCCCTTCTGGAGG - Intergenic
1145289955 17:21535045-21535067 CTGTGGAACTTGGAGTCTCAGGG - Exonic
1146977279 17:37124772-37124794 CTGTGGGATTTGCCCTCTGATGG + Intronic
1147842671 17:43383041-43383063 CTCTGGGACTTGATGACTGAAGG + Intergenic
1152394806 17:80025863-80025885 CTGTGGGGCTTCCTGTCTCATGG - Intronic
1153748743 18:8208375-8208397 TTGTGGGGCTTGCTTTCTGATGG + Intronic
1154095895 18:11414509-11414531 CTGTGGGACTTCCCTCCTGCTGG + Intergenic
1157551024 18:48582052-48582074 CTGTGCGATTTGGTGTCTGAGGG + Intronic
1163475728 19:17525090-17525112 CTGGGGATCTTGCCATCTGAGGG + Intronic
1163491690 19:17620594-17620616 CTGTGGTTCGTGCCGTCCGAGGG - Intronic
1164780144 19:30885239-30885261 CTGTTGGGCTTTCCCTCTGAGGG - Intergenic
1165851568 19:38852579-38852601 CTGCGTGACTTTCCGTCTGCGGG - Intergenic
1165865566 19:38935021-38935043 GTGGGGGACTTGGCCTCTGATGG + Intronic
1167257431 19:48439465-48439487 CTGGGGGTCTTGCAGTCTCATGG + Intronic
1167425190 19:49426547-49426569 CTCTGAGACTTCCCCTCTGAAGG + Exonic
927313275 2:21653841-21653863 CTAAGGGAAATGCCGTCTGAAGG + Intergenic
927518462 2:23685661-23685683 CTTTGGGACTTCCCATCTCATGG + Intronic
931637632 2:64355111-64355133 CTGTGGGACCAGCCCTCAGAAGG - Intergenic
933946808 2:87293929-87293951 CTTTGGGCCTTGAAGTCTGATGG - Intergenic
936333381 2:111567626-111567648 CTTTGGGCCTTGAAGTCTGATGG + Intergenic
946284462 2:218692673-218692695 CTGTGGGACTGCCCGACTGCTGG + Exonic
946970510 2:225085904-225085926 GGGTTGGCCTTGCCGTCTGAGGG - Intergenic
949021032 2:241741593-241741615 GTGTGGGACTTGCTGTCTCCAGG + Intronic
949021061 2:241741763-241741785 GTGTGGGACTTGCTGTCTCCAGG + Intronic
1171816187 20:29787783-29787805 CTGTGGGACTCGCATTCTGGAGG - Intergenic
1171970259 20:31560240-31560262 CAATGGGACTTGCCGTCAGCAGG + Intronic
1175860535 20:62147950-62147972 AAGTGGAACTTGCTGTCTGAAGG + Intronic
1176176795 20:63731158-63731180 CTGTGGGAGCTGCTGTCAGAAGG + Intronic
1177896812 21:26862854-26862876 CTGTAGGACATGCCTTTTGAGGG + Intergenic
1178487709 21:33029464-33029486 CTTTGGGACTTGCAGGGTGAGGG + Intergenic
1179544036 21:42102558-42102580 CTGTGGAACCTTCTGTCTGAGGG + Exonic
1180086409 21:45509756-45509778 CCCTGGGACTTGCCCTCTGGTGG + Intronic
1180621632 22:17166472-17166494 CTGTGGTTCTTGCCTTCAGAAGG - Intergenic
1181003490 22:19998784-19998806 CTGTCTGACCTGCCGTCTCACGG - Intronic
1182478262 22:30588833-30588855 CTGTGGGCCCTGCCCTCTGGCGG - Intronic
1184739734 22:46420957-46420979 CTCTGGGACGTGCCATCCGAGGG - Intronic
949426408 3:3921790-3921812 CTCTAGGACATGCCGCCTGAGGG - Intronic
954201520 3:49026030-49026052 CTGTGGGACTTTATGTCTGGAGG + Intronic
956727141 3:72165270-72165292 CTCTTGGACTTGCAGTCTGTGGG + Intergenic
957465567 3:80586059-80586081 CAGTGGGACTTCTCCTCTGAAGG - Intergenic
959381816 3:105650212-105650234 CTGAGGGACTTACTGTCTAATGG - Intergenic
960602841 3:119475090-119475112 CTCAGGGACTAGCAGTCTGAGGG - Intronic
965101536 3:164305712-164305734 CTGTGAGCCTTGCTTTCTGAGGG + Intergenic
970232203 4:13922334-13922356 CTCAGGGGCTTGCCTTCTGAGGG - Intergenic
977745818 4:100545938-100545960 CTGTTGGACTTGTGGTCTCATGG + Intronic
978436359 4:108688985-108689007 CTGTGGGACTTGAAGTGTGTTGG - Intergenic
980792909 4:137642650-137642672 CTGTGGAACTTGGGGTGTGAGGG + Intergenic
985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG + Intronic
985922950 5:2993867-2993889 CAGTGGGACTAGCACTCTGATGG + Intergenic
986501901 5:8409572-8409594 ATGTGGGACTAGCCAGCTGAAGG - Intergenic
986595360 5:9416388-9416410 GTGTGGGACCTGCCCTTTGATGG - Intronic
988160910 5:27517571-27517593 CTGCAGGACTTGCCAGCTGAAGG + Intergenic
988721636 5:33884692-33884714 GTGTGGGACTTGCAGGGTGATGG - Intronic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
998543601 5:143006533-143006555 CTGTTGTACTTGCTGTCTTAGGG - Intronic
1001576098 5:172764854-172764876 CTTTGTCACTTGCCGTCTCATGG - Intergenic
1002322725 5:178385133-178385155 GTGTGGGACTTGCTGTCTCCTGG + Intronic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1008685701 6:53924241-53924263 CTGTGGGACTTGCATTCACATGG + Intergenic
1010260994 6:73816684-73816706 TTGTGGAACTTGCTGTTTGAGGG + Intronic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1017032517 6:150236756-150236778 CTGTGCGACCTCCCGTCTCAAGG - Intronic
1018110501 6:160532623-160532645 CTTTGGGACTGGCCTTCTCAAGG - Exonic
1021434519 7:20599187-20599209 CTGTGGGCTTTGGCTTCTGAGGG + Intergenic
1024871318 7:53964506-53964528 CTGTGAAACTTGCCCTCAGAGGG + Intergenic
1026537171 7:71248372-71248394 CAGTTGGTCTTGCCGTCTCAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1036782470 8:11659045-11659067 ATGTGGCACTTGCAGTCTAAAGG - Intergenic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1038237789 8:25777543-25777565 CTTAGGGATTTGCCGTTTGAGGG + Intergenic
1039110366 8:34035083-34035105 CTGTGGTAGATGCCTTCTGATGG + Intergenic
1042044592 8:64634989-64635011 CTGTTGGACTTGACAACTGAAGG + Intronic
1043509356 8:80934163-80934185 CTGGAGGACTTGCCGTCTGGGGG + Intergenic
1044393154 8:91676884-91676906 GTGTTGGACTTGCTGTCTTAGGG - Intergenic
1044538499 8:93384285-93384307 CTGTGGGGCTTGGAGTCTAAAGG - Intergenic
1047664020 8:127070205-127070227 GTGTGGGCCTTGCTGTCTCAGGG - Intergenic
1049058294 8:140256245-140256267 CTGAGTGACTTACCGTCTAAAGG - Intronic
1051575398 9:18609600-18609622 CTGTGGGACTTGGAGTCTACAGG + Intronic
1053161670 9:35817746-35817768 CTGTGGAAGTTCCCCTCTGATGG - Exonic
1058225453 9:102356157-102356179 CTCTGGGACTGTCTGTCTGATGG + Intergenic
1059163696 9:112059152-112059174 ATGTGGGATTTACAGTCTGATGG + Intronic
1060873357 9:127060664-127060686 CTTTGGGACTTGCTGTCTCTGGG + Intronic
1061178272 9:129010005-129010027 CGGTGGGACTTGCTCTGTGAGGG + Intronic
1062482115 9:136757364-136757386 CTGTGGGCATTGCTGTCTGATGG - Intronic
1186812613 X:13205139-13205161 CGGTGGGTCTTGCTGTCTCAGGG + Intergenic
1187912696 X:24125307-24125329 CTGTGGGACTTGGAGACTTAGGG + Intergenic
1189393729 X:40601784-40601806 GTGTGGGACTTGGAGTCGGAAGG + Intronic
1199041093 X:143116265-143116287 CTCTGGGACTTGCTGTCTTCAGG - Intergenic
1199418383 X:147613997-147614019 GAGTTGGTCTTGCCGTCTGAGGG - Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1202047638 Y:20750527-20750549 CTGTGGGACTAGCCCCCAGAAGG - Intergenic