ID: 985537425

View in Genome Browser
Species Human (GRCh38)
Location 5:473104-473126
Sequence GAGTGCGCACGCGCGTTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985537425_985537433 15 Left 985537425 5:473104-473126 CCGCCGAACGCGCGTGCGCACTC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 985537433 5:473142-473164 TCCGGCCCCGCCCCCGGCGCAGG 0: 1
1: 1
2: 16
3: 171
4: 706
985537425_985537429 -3 Left 985537425 5:473104-473126 CCGCCGAACGCGCGTGCGCACTC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 985537429 5:473124-473146 CTCGGCAGCCCTCGGCGCTCCGG 0: 1
1: 0
2: 4
3: 12
4: 123
985537425_985537441 27 Left 985537425 5:473104-473126 CCGCCGAACGCGCGTGCGCACTC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 985537441 5:473154-473176 CCCGGCGCAGGCCCCGCCCCCGG 0: 1
1: 0
2: 13
3: 212
4: 830
985537425_985537432 9 Left 985537425 5:473104-473126 CCGCCGAACGCGCGTGCGCACTC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 985537432 5:473136-473158 CGGCGCTCCGGCCCCGCCCCCGG 0: 1
1: 2
2: 13
3: 87
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537425 Original CRISPR GAGTGCGCACGCGCGTTCGG CGG (reversed) Intergenic