ID: 985537581

View in Genome Browser
Species Human (GRCh38)
Location 5:473603-473625
Sequence TGTCCCGGGACCCCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985537581_985537601 29 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537601 5:473655-473677 CCCAGGCCCTGCAGCGCGGGAGG 0: 1
1: 1
2: 6
3: 46
4: 380
985537581_985537594 12 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537594 5:473638-473660 GCGCAGGAAGGTCCCGCCCCAGG No data
985537581_985537591 0 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537591 5:473626-473648 GCGGCCTCCTCGGCGCAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 111
985537581_985537598 26 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537598 5:473652-473674 CGCCCCAGGCCCTGCAGCGCGGG 0: 1
1: 0
2: 4
3: 35
4: 340
985537581_985537590 -4 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537590 5:473622-473644 GACAGCGGCCTCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 101
985537581_985537597 25 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537597 5:473651-473673 CCGCCCCAGGCCCTGCAGCGCGG No data
985537581_985537587 -10 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537587 5:473616-473638 TCCCGGGACAGCGGCCTCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537581 Original CRISPR TGTCCCGGGACCCCCGGCGG GGG (reversed) Intronic
900109733 1:1000387-1000409 GGGCCCGGGACCCCCGGGGCTGG + Intergenic
900203173 1:1420291-1420313 GGGCCCGGGACCCGCGGCAGCGG - Exonic
901459334 1:9382401-9382423 TGTCCAGGGAGCGCCGGCTGCGG - Intergenic
901607701 1:10472298-10472320 TGGCTCGGGACCCCGGGCGAGGG - Intronic
902366211 1:15975929-15975951 AGTCCCGGGAGCCGGGGCGGAGG - Intronic
902520330 1:17011988-17012010 AGTCCCGGCAGCCCCGGCGCGGG - Intergenic
903468464 1:23568448-23568470 GGTCCCGGGAGTCCCAGCGGGGG - Intergenic
903549289 1:24146601-24146623 GGTCCCTAGACTCCCGGCGGAGG + Intergenic
907188923 1:52633007-52633029 TGCCCCGAGACTCCCGGCGCCGG + Intergenic
913680918 1:121186531-121186553 TGGCCCCAGACCCCCGGCCGGGG - Intronic
914032748 1:143974170-143974192 TGGCCCCAGACCCCCGGCCGGGG - Intergenic
914156696 1:145093795-145093817 TGGCCCCAGACCCCCGGCCGGGG + Intronic
920468231 1:206205055-206205077 TGGCCCCAGACCCCCGGCCGGGG - Intronic
1068792903 10:61046822-61046844 TGTCCCGGGAGCCAGGGTGGTGG + Intergenic
1068989246 10:63133728-63133750 TGTCGCGGGGCCCCGGGCGAGGG + Intronic
1075438394 10:122461415-122461437 TGGACCGGGACCGCCCGCGGAGG - Intergenic
1076722153 10:132397406-132397428 GGTCCCGGGTCTCCGGGCGGCGG - Intronic
1077064805 11:636503-636525 GGTCCCGGGACCCCCTGCCCAGG + Intergenic
1077415940 11:2424309-2424331 TGTCCTGGGACCCCTGGGGCTGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083331261 11:61899417-61899439 TGTCAGGGGACCCCCAGCGTGGG - Intronic
1084544424 11:69807609-69807631 TGTCCCTGGAGCCCCTGGGGCGG + Intergenic
1085475041 11:76784032-76784054 TGTCCTGGGACCTCAGGAGGGGG - Intronic
1089432643 11:118436546-118436568 CGACCCGGGACCACCGGGGGCGG + Exonic
1089632861 11:119794322-119794344 TTTCCCGAGACCCCCAACGGCGG - Intergenic
1096372875 12:51083433-51083455 AGTCCCGGGCCCCGCGGCGACGG + Exonic
1100811484 12:98343158-98343180 TGTCCCGGGCTCCCCTGCTGTGG + Intergenic
1101371770 12:104137706-104137728 TGGCCCCGTAGCCCCGGCGGCGG - Intronic
1104961493 12:132490356-132490378 CGGCCTGGGACCCCCGGCGCGGG - Exonic
1107133346 13:36919727-36919749 GGTCCCGGGGCCCGCGGCGCGGG + Intronic
1112439409 13:99415384-99415406 TGACCCGGGAGCCCCAGGGGTGG + Intergenic
1112692993 13:101916966-101916988 CGTCGCAGGAACCCCGGCGGGGG + Intronic
1113955427 13:114097928-114097950 TCTCCCTGGACCCCCTGTGGTGG - Intronic
1119004171 14:70908446-70908468 TCTCCCGGGAGCCCCGGACGAGG - Intronic
1119522197 14:75294445-75294467 TGTCCCGGGACCCACCCAGGCGG + Intergenic
1120210661 14:81630553-81630575 AGGCCCAGGACCCCTGGCGGTGG + Intergenic
1121042213 14:90758569-90758591 GCTCCCGCGACCCCTGGCGGCGG + Intronic
1122550155 14:102545061-102545083 CGTCCCGGCTCCCCGGGCGGGGG + Intergenic
1122940301 14:104978182-104978204 TGGCCCGGAACCCCCGGCAGCGG - Exonic
1123110666 14:105865496-105865518 TCCCCCGGGACCCCGGGCTGTGG - Intergenic
1124892299 15:33744584-33744606 TGTCCCTGGACCCCCGGTACTGG - Intronic
1127290923 15:57570472-57570494 TGTCCCAAGACCCCCAGTGGTGG + Intergenic
1128992503 15:72272544-72272566 CGGCCCGGGACGCCCCGCGGGGG + Exonic
1132500559 16:282940-282962 TGTCCCGGGACCCCCTGGCCTGG + Exonic
1132570435 16:641823-641845 TGACCCCGGACACGCGGCGGAGG - Exonic
1133978466 16:10617063-10617085 TGGCCAGGCACCCCAGGCGGAGG - Intergenic
1135015942 16:18925705-18925727 AGACCCGGGGCTCCCGGCGGTGG - Intronic
1135321562 16:21501530-21501552 AGACCCGGGGCTCCCGGCGGTGG - Intergenic
1135437388 16:22437689-22437711 AGACCCGGGGCTCCCGGCGGTGG + Intergenic
1136333041 16:29594640-29594662 AGACCCGGGGCTCCCGGCGGTGG - Intergenic
1136447736 16:30334728-30334750 AGCCCCGGGGCTCCCGGCGGTGG - Intergenic
1140288642 16:73629047-73629069 TGTCACGGGCACACCGGCGGGGG - Intergenic
1141079240 16:81036047-81036069 TGTCCCCGCGCCGCCGGCGGGGG + Exonic
1142129373 16:88425776-88425798 TGTCCCATGACCCCGGGAGGAGG - Intergenic
1147382205 17:40062753-40062775 CGCCCCGGGACCCCCGCCAGAGG - Intronic
1148734961 17:49860197-49860219 TCTCCCGGGACCTCAGGCTGCGG - Intergenic
1149772435 17:59332075-59332097 GGGCGCGGGACCCCCGGCCGGGG + Intronic
1151328691 17:73394183-73394205 AGTCCCGGGATCCCAGGAGGTGG - Intronic
1151535458 17:74736802-74736824 TGTCTCGGGGCCATCGGCGGAGG + Intronic
1152602774 17:81273290-81273312 TGCCCCAGGACCCCCAGCTGTGG + Intronic
1152654973 17:81515073-81515095 AGTCCCGGGACCGACGGCGGCGG + Intronic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1159452818 18:68624086-68624108 TGTCCCGGGAGCCCAGTCAGTGG - Intergenic
1159844935 18:73447922-73447944 TGGCCCGGGAGCTCCTGCGGAGG + Intergenic
1160769053 19:822135-822157 ACCCCCGAGACCCCCGGCGGTGG - Intergenic
1160864428 19:1250695-1250717 TGTGCGGCGACCCCGGGCGGGGG - Intronic
1161165573 19:2785507-2785529 TGCCCCGGGAGCGCGGGCGGCGG + Exonic
1161770556 19:6228647-6228669 TCTCCCAGCACCCACGGCGGGGG + Intronic
1162532372 19:11243338-11243360 GGTCCTGGGGCCCCCGACGGCGG + Exonic
1162597395 19:11639905-11639927 TGTCTCGGGAACCCCGGCCTCGG - Intergenic
1162648116 19:12064888-12064910 AGTCTCGGGACTCCCAGCGGGGG - Intronic
1163314426 19:16532455-16532477 TGTCCGGGGACCCCGGGTGGGGG - Intronic
1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG + Intronic
1166297995 19:41897991-41898013 TGCCCCGGGAAGGCCGGCGGCGG - Intronic
1166915610 19:46194156-46194178 TTTCCAGGGACCCCCAGTGGGGG - Intergenic
1168689703 19:58369092-58369114 TGTGCCGGGTCCCCGGGCCGGGG + Exonic
1168721776 19:58558404-58558426 GGTCCCGGGCCCCGCGGCGGCGG - Exonic
929468505 2:42168849-42168871 TGTCCCGGGCCCTGCGGCTGTGG + Intergenic
938496708 2:131801691-131801713 GGGCTCGGGCCCCCCGGCGGAGG - Intergenic
940830071 2:158457042-158457064 TCTCCCACCACCCCCGGCGGCGG - Intronic
943658585 2:190534535-190534557 TAACCCGGGACCGGCGGCGGCGG - Intronic
944743648 2:202635255-202635277 GCTCCCGGGTCCCCCGGCCGTGG - Exonic
947919250 2:233854913-233854935 TGCGCCGGGATCCCAGGCGGAGG - Intergenic
948991897 2:241559657-241559679 GGTCCCGGGACGCCTGGCTGAGG + Exonic
1171190608 20:23156632-23156654 TGTCCCGGGTCACCTGGCTGGGG + Intergenic
1173210649 20:41029145-41029167 CGTCCCGCGACCCCCGGCGCAGG + Intronic
1175432677 20:58917667-58917689 AGTCCCGTGAACCCCGGAGGCGG + Intergenic
1176068772 20:63215546-63215568 AGTCCCGGGACGGCCGGCGCGGG - Intronic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1178487208 21:33026669-33026691 TGTGCCGGGACCCCGCGCTGTGG + Exonic
1179209420 21:39313170-39313192 CCACCCGCGACCCCCGGCGGCGG + Intronic
1179530920 21:42019122-42019144 TGTCCCGGGTCCCCAGGTGTTGG - Intergenic
1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG + Intronic
1180215830 21:46323541-46323563 AGACCCAGGACCCCCGGCCGAGG + Exonic
1182443916 22:30379523-30379545 TGTCCTGGGAGCCCAGGCTGAGG + Exonic
1184403142 22:44285580-44285602 TGAAACAGGACCCCCGGCGGTGG - Exonic
949414388 3:3799860-3799882 GGACCCGGCACCCACGGCGGCGG - Exonic
950447666 3:13047602-13047624 TGTCCTGGGACCACCTGCTGGGG - Intronic
951962959 3:28349131-28349153 TGTCCCGTGAGCCTCCGCGGCGG + Exonic
953980503 3:47410802-47410824 TGCCCCAGGACCCCAGGCTGAGG - Exonic
954450240 3:50567681-50567703 AGGGCCGGGACCCACGGCGGAGG + Exonic
968372848 4:11405-11427 TGCGCCGCGACCCCCGGCGCTGG - Intergenic
968879665 4:3292649-3292671 TGGCCCGGGACACCCTGCGAAGG - Intergenic
969379217 4:6783087-6783109 GGCCCCGGAGCCCCCGGCGGCGG - Intronic
969702317 4:8774269-8774291 TGGCCTGGGACCCCTGGAGGTGG + Intergenic
975342575 4:73258572-73258594 TGTGGCGGGCCCCCCCGCGGCGG - Exonic
976236285 4:82900761-82900783 TGTCGCGGGAACCCCGAAGGTGG + Exonic
985462548 4:190121162-190121184 TGCGCCGCGACCCCCGGCGCTGG + Intergenic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
995342263 5:111073044-111073066 TGTCCCCTTTCCCCCGGCGGCGG - Intronic
995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG + Intronic
997479747 5:134176478-134176500 TGTCCCGGGGACCAGGGCGGGGG - Intronic
997980512 5:138465214-138465236 GGTCCCGGAGGCCCCGGCGGCGG + Intergenic
1005959876 6:30687115-30687137 GGCCGCGGGACCCCCGGGGGAGG + Exonic
1007774537 6:44217582-44217604 TGTCCTGGGAGCCCAGGCGGCGG - Intergenic
1011734125 6:90295896-90295918 TGGTCCGGGCCACCCGGCGGCGG + Intronic
1019062609 6:169266867-169266889 TGTCCCAGGGCCCCCAGGGGTGG + Intergenic
1024300619 7:47884850-47884872 TGCCCCGGGGCCCCAGGAGGAGG + Intronic
1027138070 7:75638811-75638833 TCTCCCGGGCAGCCCGGCGGCGG + Intronic
1027374725 7:77537855-77537877 CGTCCCGGGAACCCGCGCGGGGG - Intronic
1029640315 7:101816152-101816174 CAGCCCGGGGCCCCCGGCGGAGG - Intronic
1032614660 7:133454742-133454764 TGTGCCAGGACCCCCAGTGGAGG + Intronic
1035266681 7:157693285-157693307 GTTCCCGGGACTCCCCGCGGGGG + Intronic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1042714621 8:71759149-71759171 TGTTCCAGGACCCCCAGCAGCGG - Intergenic
1044230902 8:89776650-89776672 GGTCCAGGGACCCCTGGCGGGGG - Intronic
1048244221 8:132775684-132775706 CGTCCCGGGCGGCCCGGCGGGGG - Intronic
1049145966 8:141001229-141001251 TGGTCCGGGACCGGCGGCGGCGG + Intronic
1050356913 9:4792647-4792669 TGGCCAGGGAACCCCGGCGCGGG - Intergenic
1055757615 9:79572639-79572661 TGTCACGCGAGACCCGGCGGGGG + Exonic
1057168724 9:92947992-92948014 GGTCCTGGGACCCCCGGCTCGGG + Intronic
1057204695 9:93164240-93164262 TGTCCGGTGGCTCCCGGCGGCGG - Intergenic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1061570878 9:131476801-131476823 TGTCCCTGGAGCCCCGCCGAGGG + Intronic
1062435390 9:136544691-136544713 TGTCCCGGTGCCCCTGGAGGCGG - Intronic
1062558816 9:137130066-137130088 GGTTCCGGGACCCGCGGCGCGGG + Intergenic
1062678017 9:137759770-137759792 TGGCCCGGGACCCCAGAGGGAGG + Intronic
1191141639 X:57121250-57121272 AGGCCCGCGATCCCCGGCGGTGG - Exonic
1191143280 X:57137217-57137239 AGGCCCGCGATCCCCGGCGGTGG - Intronic
1192510422 X:71717802-71717824 TGTCCCTGGACGCTGGGCGGCGG + Exonic
1192516275 X:71763751-71763773 TGTCCCTGGACGCTGGGCGGCGG - Exonic
1192529549 X:71872935-71872957 TGTCCCTGGACGCTGGGCGGCGG + Intergenic
1198051872 X:132958312-132958334 TGTCCCGGGGCCGCCGCAGGCGG - Exonic
1200092938 X:153644266-153644288 AGGCCCGGGGCGCCCGGCGGGGG + Intronic
1200115354 X:153767571-153767593 GGGCCCGGGCCCCGCGGCGGCGG - Exonic
1200181628 X:154154509-154154531 TGACCCAGGACCCCCGGCCCAGG - Intronic
1200187276 X:154191623-154191645 TGACCCAGGACCCCCGGCCCAGG - Intergenic
1200192925 X:154228763-154228785 TGACCCAGGACCCCCGGCCCAGG - Intronic
1200198680 X:154266567-154266589 TGACCCAGGACCCCCGGCCCAGG - Intronic
1200233615 X:154458195-154458217 CGTCCGGGGACGCCCGGCCGAGG - Intergenic