ID: 985537581

View in Genome Browser
Species Human (GRCh38)
Location 5:473603-473625
Sequence TGTCCCGGGACCCCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985537581_985537597 25 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537597 5:473651-473673 CCGCCCCAGGCCCTGCAGCGCGG No data
985537581_985537590 -4 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537590 5:473622-473644 GACAGCGGCCTCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 101
985537581_985537598 26 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537598 5:473652-473674 CGCCCCAGGCCCTGCAGCGCGGG 0: 1
1: 0
2: 4
3: 35
4: 340
985537581_985537591 0 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537591 5:473626-473648 GCGGCCTCCTCGGCGCAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 111
985537581_985537601 29 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537601 5:473655-473677 CCCAGGCCCTGCAGCGCGGGAGG 0: 1
1: 1
2: 6
3: 46
4: 380
985537581_985537587 -10 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537587 5:473616-473638 TCCCGGGACAGCGGCCTCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 160
985537581_985537594 12 Left 985537581 5:473603-473625 CCCCCGCCGGGGGTCCCGGGACA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 985537594 5:473638-473660 GCGCAGGAAGGTCCCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537581 Original CRISPR TGTCCCGGGACCCCCGGCGG GGG (reversed) Intronic