ID: 985537939

View in Genome Browser
Species Human (GRCh38)
Location 5:475016-475038
Sequence GCGTGCGGGCCCTCTGCGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985537934_985537939 -4 Left 985537934 5:474997-475019 CCGGGAGAGTAGGGAATCTGCGT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985537939 Original CRISPR GCGTGCGGGCCCTCTGCGAG GGG Exonic
900641044 1:3688184-3688206 GAGTGGGGGCTCTCTGGGAGGGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
905584373 1:39105424-39105446 GCGAGCGGGCCGGGTGCGAGCGG + Intronic
919834311 1:201563260-201563282 GCGTCCGGACGCTCTTCGAGGGG - Intergenic
923338286 1:232987983-232988005 GCGGGTGGGCCCCATGCGAGGGG - Intronic
1068783265 10:60944073-60944095 GTGTGCGGGGCCCCTGCGCGCGG + Exonic
1071565018 10:86667304-86667326 GCTTGCTGGCCCTCTTGGAGGGG - Intergenic
1072670641 10:97426521-97426543 AGGTGCCGGCCCTCTCCGAGAGG - Intronic
1075050373 10:119178851-119178873 GTGAGCGGGCCCTCTGCTGGTGG + Intergenic
1076545256 10:131240880-131240902 GCGTGCAGGTCCCCTGCGAGGGG + Intronic
1084035063 11:66504640-66504662 GAGGGCGGGCCCTGTACGAGGGG + Exonic
1090358391 11:126155972-126155994 GCGCCCGGGCCCTCTCCGTGGGG - Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1103694067 12:122799868-122799890 CCTTTGGGGCCCTCTGCGAGGGG + Intronic
1104857116 12:131907565-131907587 GGGTGCGGGCCCTGTGGGACCGG - Intronic
1110364223 13:74663056-74663078 GCTTGCGGGCTCTCAGCCAGGGG - Intergenic
1112417462 13:99215680-99215702 GCAAGCCGGCTCTCTGCGAGCGG + Intronic
1122373658 14:101243659-101243681 GCGTGCCGGGACTCAGCGAGAGG - Intergenic
1126407001 15:48331872-48331894 GCGAGCGGTCCTTCTGCGCGCGG + Intronic
1127884742 15:63189476-63189498 GCGCGCAGGCCTTCTCCGAGAGG + Exonic
1142059344 16:88019590-88019612 GCGTGCGGGATCTCAGCGTGCGG + Intronic
1142059354 16:88019624-88019646 GCGTGCGGGATCTCAGCGTGCGG + Intronic
1149998347 17:61416670-61416692 GCCTGGGGGCGCTCTGCGAGTGG + Intergenic
1156171559 18:34493247-34493269 GCGTGCGCGCCCGCGGAGAGAGG + Intergenic
1160778325 19:866795-866817 GGGTGCGGGCCCGCGGCGGGTGG - Intergenic
1160847123 19:1171543-1171565 GCATGGGGGCCCCCTGGGAGGGG + Intronic
1160879212 19:1311873-1311895 GTGAGCAGGCCCTATGCGAGGGG - Intergenic
930593426 2:53356711-53356733 GCGTGGGAGCCCACTGCGAGGGG - Intergenic
932778737 2:74546385-74546407 TCCTGCGGGCCATCTGGGAGAGG - Intronic
935866504 2:107392663-107392685 GAGTGCGGGCCCACGGCGCGCGG + Intergenic
945445573 2:209933841-209933863 TTGTGCGGACCCCCTGCGAGTGG + Exonic
1175685337 20:61024195-61024217 GGGTGGGGGCTCCCTGCGAGTGG - Intergenic
1179213556 21:39348520-39348542 GAGTGCGGGCCTTCTGCGGGGGG - Intronic
1180228655 21:46413250-46413272 GCGTGAGGCCCCCCTGGGAGAGG + Intronic
1180228694 21:46413370-46413392 GCGTGAGGCCCCCCTGGGAGAGG + Intronic
1183516953 22:38272463-38272485 GCGTCCGTGCCCTGTGCGGGTGG - Intronic
963780392 3:149480633-149480655 GCCTGCAGGACCTCTGCAAGAGG - Intronic
970691954 4:18630649-18630671 GCGTGGGAGCCCACTGCGGGGGG + Intergenic
977694274 4:99949665-99949687 GCAAGCCGGCTCTCTGCGAGCGG + Exonic
985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG + Exonic
993402679 5:87472826-87472848 GCTTGCTGGCCCTGTGGGAGTGG - Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
997356444 5:133265858-133265880 GGGTGGGGGCCCTCTCCTAGGGG + Intronic
998583354 5:143403210-143403232 GCGAGCGGCTCCTCTGCCAGAGG - Exonic
1006096680 6:31660673-31660695 GCGTCCGGGCGCTGTGCGCGGGG + Exonic
1011666354 6:89638547-89638569 GCGTGCGCGCCCTCTGAGATTGG - Intronic
1012475748 6:99613638-99613660 GCGTGCGGGCGCCCCGGGAGCGG + Exonic
1019445909 7:1071128-1071150 GCGTGCGGGGCCTCTATGAGTGG - Intronic
1027189117 7:75987740-75987762 GCCTGCGGGCGCTGGGCGAGCGG - Exonic
1027390172 7:77696399-77696421 GGGGGCGGGCCCTCCGCGAGGGG - Intergenic
1027592555 7:80134752-80134774 GCGGGCGCGCGCTCTGGGAGTGG + Intronic
1029168689 7:98616519-98616541 GCGCGCGAGGGCTCTGCGAGTGG + Intergenic
1034971577 7:155423006-155423028 GCGGGAGGGCCCTCTACCAGGGG - Intergenic
1049211934 8:141390983-141391005 GCTTGCAGGCGCTCTGAGAGAGG + Intergenic
1049787440 8:144457714-144457736 TCGTGGGGGCCCTCAGCCAGGGG - Intronic
1190056732 X:47185504-47185526 GCGTGGGGGCCCTGAGCGGGAGG + Exonic