ID: 985538547

View in Genome Browser
Species Human (GRCh38)
Location 5:477379-477401
Sequence GTCCACGTTGACCACGTTGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985538546_985538547 2 Left 985538546 5:477354-477376 CCACGGTGGACGATCGTGGCGTG 0: 1
1: 0
2: 1
3: 2
4: 12
Right 985538547 5:477379-477401 GTCCACGTTGACCACGTTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 32
985538545_985538547 5 Left 985538545 5:477351-477373 CCTCCACGGTGGACGATCGTGGC 0: 1
1: 0
2: 1
3: 1
4: 35
Right 985538547 5:477379-477401 GTCCACGTTGACCACGTTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985538547 Original CRISPR GTCCACGTTGACCACGTTGT CGG Exonic
916056602 1:161072837-161072859 CTCCACGCTGACCACGGTGAGGG - Exonic
917506254 1:175629685-175629707 CTCCACTTTGACCATGGTGTTGG - Intronic
1067508062 10:46873171-46873193 GGCCACGTTGACCATGGTGCAGG + Intergenic
1067654189 10:48178674-48178696 GGCCACGTTGACCATGGTGCAGG - Intronic
1070717848 10:78735380-78735402 GTCCACCCTGAGCAAGTTGTGGG - Intergenic
1083777783 11:64902630-64902652 GTGCACGTGTACCACATTGTTGG + Exonic
1157326286 18:46671221-46671243 GTTGAAGTTGCCCACGTTGTGGG + Intronic
1162371126 19:10280055-10280077 GTCCACGCGGCCCATGTTGTGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1168512638 19:56985498-56985520 CTCCAAGTTCACCAGGTTGTTGG + Intergenic
926163090 2:10501810-10501832 GTCCACTTCCACCACGTGGTGGG - Intergenic
926301952 2:11611115-11611137 AGCCACGTTGGCCACGCTGTGGG - Intronic
945116901 2:206416932-206416954 GTCCACATTGTCCACATTGATGG + Intergenic
948923701 2:241080855-241080877 GTCCAGGGTGACCACGGGGTAGG + Intronic
1175585029 20:60132395-60132417 GGGAACGTTGGCCACGTTGTGGG + Intergenic
1178412154 21:32373608-32373630 GTTTTCGTTGACCTCGTTGTTGG - Intronic
968427569 4:533825-533847 GTCCACGGTGGCAATGTTGTTGG - Exonic
985538547 5:477379-477401 GTCCACGTTGACCACGTTGTCGG + Exonic
1004505972 6:16246900-16246922 GTCCATGTTGGCCACGATGATGG - Exonic
1019908260 7:4081264-4081286 GGCCACGTTGCCCAAGTTCTGGG - Intronic
1043891112 8:85653830-85653852 TTCCACATTGACCACATAGTTGG - Intergenic
1043892188 8:85660667-85660689 TTCCACATTGACCACATAGTTGG - Intergenic
1043893375 8:85716673-85716695 TTCCACATTGACCACATAGTTGG + Intergenic
1043896058 8:85738122-85738144 TTCCACATTGACCACATAGTTGG + Intergenic
1043896621 8:85743686-85743708 TTCCACATTGACCACATAGTTGG - Intergenic
1043898944 8:85762053-85762075 TTCCACATTGACCACATAGTTGG - Intergenic
1043900555 8:85774247-85774269 TTCCACATTGACCACATAGTTGG - Intergenic
1043902519 8:85789522-85789544 TTCCACATTGACCACATAGTTGG - Intergenic
1043904129 8:85801715-85801737 TTCCACATTGACCACATAGTTGG - Intergenic
1043905741 8:85813909-85813931 TTCCACATTGACCACATAGTTGG - Intergenic
1043907349 8:85826096-85826118 TTCCACATTGACCACATAGTTGG - Intergenic
1056123416 9:83511800-83511822 GACCACGTTGACAGGGTTGTGGG + Intronic
1201385187 Y:13432655-13432677 TTCCAGGTGGACCACGTGGTGGG - Intronic