ID: 985541308

View in Genome Browser
Species Human (GRCh38)
Location 5:488882-488904
Sequence GGGCGCGGCCAGGGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985541294_985541308 4 Left 985541294 5:488855-488877 CCCGGAGCCGGGACACACAGCAC 0: 1
1: 0
2: 0
3: 12
4: 175
Right 985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG No data
985541298_985541308 -3 Left 985541298 5:488862-488884 CCGGGACACACAGCACCCAGGGG 0: 1
1: 0
2: 2
3: 42
4: 369
Right 985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG No data
985541291_985541308 15 Left 985541291 5:488844-488866 CCCAGGACGGGCCCGGAGCCGGG 0: 1
1: 0
2: 0
3: 29
4: 385
Right 985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG No data
985541293_985541308 14 Left 985541293 5:488845-488867 CCAGGACGGGCCCGGAGCCGGGA 0: 1
1: 0
2: 1
3: 15
4: 217
Right 985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG No data
985541295_985541308 3 Left 985541295 5:488856-488878 CCGGAGCCGGGACACACAGCACC 0: 1
1: 0
2: 3
3: 18
4: 226
Right 985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985541308 Original CRISPR GGGCGCGGCCAGGGAGGGGC AGG Intronic
No off target data available for this crispr