ID: 985541810

View in Genome Browser
Species Human (GRCh38)
Location 5:490893-490915
Sequence GGCGCCAAGGAACCACGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985541800_985541810 24 Left 985541800 5:490846-490868 CCTGGTGGGTGATGCTGGACGGC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 985541810 5:490893-490915 GGCGCCAAGGAACCACGTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985541810 Original CRISPR GGCGCCAAGGAACCACGTGC TGG Intronic
903178916 1:21595695-21595717 GGCGCCAAGGGACCACTTACGGG - Intergenic
903227874 1:21904115-21904137 CAGGCCACGGAACCACGTGCTGG + Intronic
906810947 1:48826451-48826473 GGTGCAAAGGAACCAGGTGGTGG - Intronic
910596994 1:88991830-88991852 GCCGCCAAGGAGCCACGCGTGGG + Intronic
915282017 1:154829281-154829303 AGCGCAAAGGAACCACTTGTGGG - Intronic
918066646 1:181105833-181105855 GGCGCCTAGGAAACACGCCCGGG - Intergenic
1065709729 10:28504212-28504234 GGCCCCAAGAAACCACTGGCAGG + Intergenic
1084455351 11:69265059-69265081 GGCCCCAAGGCACCCAGTGCCGG - Intergenic
1097267794 12:57755736-57755758 GGCGACAAGGAGCCGCGGGCCGG + Exonic
1106309889 13:28544852-28544874 GGAGCCAAAGAATCACTTGCAGG - Intergenic
1115643426 14:35350200-35350222 GGCCCCAAGGAAACACGTGCTGG - Intergenic
1118786829 14:69052992-69053014 GGAGCCAAGGAAGCACCTGCTGG + Exonic
1131972490 15:97906336-97906358 GGCGTCAGGGAACCAAGCGCTGG + Intergenic
1132615823 16:840716-840738 GGGGCCATGGAGCCAGGTGCTGG - Intergenic
1132656598 16:1044211-1044233 GACGCCAGGCAACCACGGGCAGG + Intergenic
1142146559 16:88495261-88495283 GGCCACAAGGAAACAGGTGCAGG + Intronic
1147659783 17:42111400-42111422 GGGGACATGGGACCACGTGCTGG - Exonic
1148021678 17:44557654-44557676 GGCGCCAAGGAGCCGGGTGGGGG + Exonic
1156084653 18:33383381-33383403 GGGGTCAAGGAACCACTTGAGGG - Intronic
1160130849 18:76223634-76223656 GGCGCCCACAAACCACCTGCCGG - Intergenic
1161119588 19:2518082-2518104 GGTGCCAAGGTGCCACGTGCTGG - Intronic
1162452799 19:10764884-10764906 GGCGGCAAGTGACCAGGTGCGGG - Intronic
1162950719 19:14070784-14070806 GGCGCATAGGAGACACGTGCTGG - Intergenic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166382191 19:42360958-42360980 GGCCCCATGGCACCAGGTGCAGG - Exonic
1166765448 19:45250394-45250416 GGTGCGAAGGAACCCTGTGCAGG - Intronic
1168119261 19:54242522-54242544 GGGCCCCAGGACCCACGTGCAGG - Exonic
1168130093 19:54312338-54312360 GGGCCCCAGGACCCACGTGCAGG - Exonic
1168168992 19:54574086-54574108 GGGCCCCAGGACCCACGTGCAGG + Exonic
927918145 2:26949650-26949672 GGCACCAGGGAACCACGTCTTGG + Exonic
1169081552 20:2800491-2800513 GGCGCCCAGGAACTCGGTGCTGG - Exonic
1176138418 20:63535044-63535066 GCAGCCAAAGAACCACCTGCAGG + Exonic
1179786974 21:43735611-43735633 GGCTCCCAGGAACCACAGGCTGG - Intronic
1181810473 22:25400902-25400924 GGCGCCAGGGACCCACTGGCTGG - Intronic
1184442064 22:44523046-44523068 GCCGCCAGGGAAGCAGGTGCTGG - Intergenic
961558306 3:127711682-127711704 GGCACCGAGGAACCACCTTCTGG + Intronic
962520607 3:136195286-136195308 GGCGCCAAGGCCCCATGTGTGGG - Exonic
962847408 3:139284319-139284341 GGCTCCAAGTACCCTCGTGCTGG - Intronic
963008491 3:140748493-140748515 GGGGCCAAGTAACGACCTGCTGG + Intergenic
965934799 3:174094721-174094743 GGAGCCAAGGAACAATGAGCAGG - Intronic
974448491 4:62018193-62018215 GGAGCCAAGGAAGCACCTGCTGG - Intronic
983254133 4:165379274-165379296 GGCGCCCAGGAGCCACCCGCAGG - Exonic
984734842 4:183099336-183099358 GGCGCGGCGGAACCACGCGCGGG - Exonic
985541810 5:490893-490915 GGCGCCAAGGAACCACGTGCTGG + Intronic
998811368 5:145969859-145969881 CAGGCCAAGGAACCACATGCTGG - Intronic
999838805 5:155402322-155402344 GGCACTAAAGAACCATGTGCTGG + Intergenic
1018784616 6:167098462-167098484 GAGGCCAGGGAACCAGGTGCGGG - Intergenic
1019448199 7:1082296-1082318 GGCGCCGCGGAGCCACGCGCTGG - Intronic
1024620973 7:51157428-51157450 GACACCAAGGAACCCCTTGCCGG - Intronic
1036177127 8:6549737-6549759 GGCGTGAGGGAGCCACGTGCAGG + Intronic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1048228258 8:132611737-132611759 GCCGCCAAGGAAGCAGGAGCTGG - Intronic
1056807450 9:89740031-89740053 GGAGACAGGGATCCACGTGCTGG + Intergenic
1059335524 9:113566301-113566323 GGAGCCAAGGGAGCAGGTGCAGG - Intronic
1199217910 X:145282246-145282268 GGCGTCGAGGAACCATGTCCTGG + Intergenic