ID: 985542340

View in Genome Browser
Species Human (GRCh38)
Location 5:492771-492793
Sequence AGGCTCTGGCCACAACGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985542340_985542350 20 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542350 5:492814-492836 GTGTTTCAGACCCCTCCGGAGGG No data
985542340_985542343 -9 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542343 5:492785-492807 CCAGAGCCTGCTCCCACTTGAGG No data
985542340_985542351 21 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542351 5:492815-492837 TGTTTCAGACCCCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 74
985542340_985542349 19 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542349 5:492813-492835 TGTGTTTCAGACCCCTCCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 67
985542340_985542344 -5 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542344 5:492789-492811 AGCCTGCTCCCACTTGAGGCTGG No data
985542340_985542348 16 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542348 5:492810-492832 GGCTGTGTTTCAGACCCCTCCGG No data
985542340_985542352 29 Left 985542340 5:492771-492793 CCCTGACGTTGTGGCCAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 985542352 5:492823-492845 ACCCCTCCGGAGGGGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985542340 Original CRISPR AGGCTCTGGCCACAACGTCA GGG (reversed) Intronic
900647181 1:3714294-3714316 AGTCTCTGGCCACAGCTTCCTGG - Intronic
901104609 1:6745486-6745508 AAGCTCAGGCCACTACATCATGG - Intergenic
901475222 1:9484940-9484962 GGGCTGTGGCCACAAAATCAGGG - Intergenic
902360135 1:15937880-15937902 CGTCTCTGGCAACAACGTCCTGG + Exonic
902536516 1:17121993-17122015 AGGCTCTGGGCCCAACATGATGG - Intergenic
903771158 1:25765317-25765339 AGGCCCTGGTCACATGGTCATGG + Intronic
912688517 1:111786010-111786032 AGGCTCTGGCCATAACCCCTGGG + Intronic
920454212 1:206085942-206085964 TGGCTCTGGTCACCATGTCAGGG - Intronic
921970785 1:221147053-221147075 AGGCTCTAGCCACTACGCCCAGG - Intergenic
922507485 1:226134938-226134960 AGGCTCTGTGCACATCTTCACGG + Intergenic
922983812 1:229850827-229850849 AGGCTCTGGCCTCCCCGTGAAGG - Intergenic
924023917 1:239813132-239813154 AGGCACCCGCCACCACGTCAGGG - Intronic
924831877 1:247604719-247604741 AGCATCTGGCCAAAACGTTAGGG + Intergenic
1063205362 10:3826090-3826112 GAGCTGTGGCCACCACGTCATGG - Intergenic
1063956971 10:11276227-11276249 AGCCTCGGGCCACAACGGCGGGG - Intronic
1069593371 10:69655405-69655427 AGGCCCTGGCCAGCACGGCAGGG - Intergenic
1072611787 10:97022012-97022034 AGGCTCTGGCCCCAACAGCATGG - Intronic
1079674249 11:23204015-23204037 AGGCTGAGGCCACAAGTTCAAGG + Intergenic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1083056812 11:59829737-59829759 AGTCTCTGGTCACCACTTCATGG + Intronic
1083945730 11:65921563-65921585 AGGCTCTGCGCAGGACGTCATGG + Intergenic
1090029796 11:123196391-123196413 AGGCCCTGGGCACAAGGTCAGGG - Intergenic
1090560956 11:127931890-127931912 AGACTCTGTGCACAACGCCAAGG + Intergenic
1092880485 12:12884326-12884348 AGACTCTTGCCTCACCGTCAGGG + Intergenic
1093461532 12:19411492-19411514 AGGCCCTGGCCAAAATGTCCTGG - Intronic
1096087803 12:48877826-48877848 AGGCTCAGGCCACAATGCCTGGG + Intergenic
1098787355 12:74776504-74776526 AGGCCCGGGCCACAACGCCCTGG - Intergenic
1103581232 12:121917084-121917106 AGGCAGTGCCCACAGCGTCAAGG - Exonic
1103735109 12:123056139-123056161 AGGCTCTGGCCCTGAGGTCAAGG + Intronic
1104016527 12:124965602-124965624 GGGCTCTGGGCACATCCTCAGGG + Intronic
1104797164 12:131527928-131527950 AGGGCCTGGCCACACCCTCAGGG - Intergenic
1105674976 13:22661427-22661449 ATGCTCTGGAGACAACATCAAGG + Intergenic
1112142163 13:96656598-96656620 AGGCTTTGGGCTCAAGGTCAGGG + Intronic
1115099977 14:29686926-29686948 AGGCTCTGACAAAAAAGTCATGG - Intronic
1118959602 14:70516893-70516915 AGGCTCTGTCCACGTCATCAGGG - Intergenic
1127352209 15:58164434-58164456 ATGCTCTGGGCACAACTTCCAGG - Intronic
1128312823 15:66642069-66642091 AGCCTTTGGCCTCAATGTCATGG - Intronic
1128401173 15:67282500-67282522 AGGCTCTGGAGGCAAAGTCAGGG - Intronic
1129641478 15:77383165-77383187 AGGCTCCCGCCACCACGTCCAGG + Intronic
1131691800 15:94835328-94835350 AGCCTGTGGCCACAACGACACGG - Intergenic
1132959444 16:2613788-2613810 AGGACGTGGCCACACCGTCAGGG + Intergenic
1132972505 16:2695763-2695785 AGGACGTGGCCACACCGTCAGGG + Intronic
1133477465 16:6137446-6137468 AGGCACTGGCCACCACGCCTGGG + Intronic
1136147616 16:28324620-28324642 CTGCTCTGGCCCCATCGTCAGGG - Intergenic
1138522280 16:57577821-57577843 AGGATGTGGCCACAGCGACACGG + Intronic
1141120068 16:81346737-81346759 AGGCTCTGGGGAAAACTTCAGGG + Intronic
1142539299 17:645783-645805 AGGCAGTGGCCACACGGTCACGG - Intronic
1142539323 17:645953-645975 AGGCAGTGGCCACACGGTCACGG - Intronic
1142539388 17:646378-646400 AGGCAGTGGCCACACGGTCACGG - Intronic
1143423540 17:6815003-6815025 AGCCTCTGGGCCCAATGTCAAGG + Intronic
1151747312 17:76018450-76018472 AGGCCCTGGCCACAGCATCAGGG + Exonic
1152408002 17:80108396-80108418 AGGCCCTACCCACAACGTCCAGG - Intergenic
1153893582 18:9539839-9539861 AGGCTCTGGCCCCACAGGCAGGG - Intergenic
1154327792 18:13404356-13404378 AGGCTGCGGCCACACCGTCGCGG - Intronic
1158936710 18:62371240-62371262 AGGTCCTGGCCACACTGTCAGGG + Intronic
1164162521 19:22637097-22637119 AGGCTCTTGCCACCACGCCCGGG + Intronic
1166762929 19:45235811-45235833 AGCCTCTGGCCAGAACGTGGAGG + Intronic
1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG + Intergenic
925477150 2:4230117-4230139 AGGCTCTGGCCACATTCACAGGG + Intergenic
927104696 2:19813040-19813062 GGCCTCTGGCCACAAGGTCAAGG + Intergenic
932448821 2:71796705-71796727 AGGGTCTGTCCACCCCGTCATGG + Intergenic
935213348 2:100956826-100956848 AGGCTCTGTACACAATGTGATGG + Intronic
935217699 2:100987883-100987905 AGGCACTGGCCACAGAGCCATGG - Intronic
944479308 2:200139037-200139059 AGGCTCTGGCCAAAACATCAAGG + Intergenic
1169833537 20:9852524-9852546 AGGCTCTGGCCACATTGCCCAGG - Intergenic
1171528652 20:25836241-25836263 AGGCACTGGCCACCATGTCTGGG - Intronic
1171548174 20:26019645-26019667 AGGCACTGGCCACCATGTCTGGG + Intergenic
1172668130 20:36614818-36614840 AGTCACTGGGCACAGCGTCAGGG - Intronic
1174426558 20:50435754-50435776 AGGCTCTGGTCACAGGGCCAGGG + Intergenic
1175282518 20:57813584-57813606 AAGCTCTGGCCACCAAGTGATGG + Intergenic
1177205421 21:18005140-18005162 AGGATCTGGCCACAGCGTTCAGG - Intronic
1178704029 21:34858195-34858217 TGGTCCTGGCCACAACCTCATGG - Intronic
950498124 3:13346634-13346656 AGGCTCTGCCCACATCATCTCGG + Intronic
953406604 3:42662940-42662962 AGGGTCTGGGCCCAACGTCGGGG + Intronic
954446148 3:50547867-50547889 AGCCTTGGGCCACAAGGTCATGG - Intergenic
964736088 3:159919514-159919536 ATGATTTGGCCACAACTTCATGG + Intergenic
968402864 4:313604-313626 AGGCTCAGACCACAACACCACGG - Intergenic
968652594 4:1766168-1766190 GGGCTCTGCCCACCATGTCAGGG - Intergenic
968797496 4:2717450-2717472 AGGCTCTTGTCACCACGTCCAGG - Intronic
977826011 4:101532537-101532559 AGGCTCTGGACACAACTTCTGGG + Intronic
983502328 4:168513290-168513312 AGGCTCTGGCCACTAGAGCATGG + Intronic
985542340 5:492771-492793 AGGCTCTGGCCACAACGTCAGGG - Intronic
985562895 5:600869-600891 AGGCTGTGGCCCTAACGCCATGG - Intergenic
986026620 5:3857455-3857477 AGGCTCTGGTCACACAGTCCCGG - Intergenic
987683161 5:21163692-21163714 AGGATCTGGCCACAACAACTTGG + Intergenic
990880216 5:60530419-60530441 AGGCTCTGCCCACAAGGCCCAGG + Intergenic
996468326 5:123829410-123829432 AGGCTTTGGCCACAAACTGAAGG - Intergenic
997452250 5:133993185-133993207 AAGCTCTGGCCACAAAATGAAGG - Intronic
1001274732 5:170342331-170342353 AGGCCCTGGGCACAATGACAAGG + Intergenic
1004648472 6:17585716-17585738 AGGCGCCTGCCACAACGTCTGGG - Intergenic
1007117605 6:39354628-39354650 AGGGCCTGGCCTCAAAGTCATGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1010098212 6:72072083-72072105 AGACTCTGTCCACACCTTCAAGG - Intronic
1011624472 6:89271887-89271909 GAGCTCTCTCCACAACGTCAGGG + Intronic
1019442687 7:1055462-1055484 AGGCTTGGGCCACAAAGTAAAGG + Exonic
1023718262 7:43066105-43066127 AGGCTGAGGCCAGAAGGTCAAGG + Intergenic
1024274993 7:47670288-47670310 AGTCTCTGCCCACAGCCTCAGGG - Intergenic
1035597086 8:866676-866698 AGCTTCTGGCCACCACGCCAGGG + Intergenic
1036704884 8:11039577-11039599 ACGCGCTGGCCCCAACGTCCAGG + Intronic
1037956430 8:23063942-23063964 AGGCTGAGGACACAACGTCTGGG + Intronic
1042359720 8:67868707-67868729 AAGCTCTGGCAACAATGGCAGGG - Intergenic
1042915911 8:73875907-73875929 AGGCGCTGGCCACCACGCCCAGG - Intronic
1046810600 8:118529061-118529083 TGTCTGTGGCCACAACTTCATGG - Intronic
1047257812 8:123229051-123229073 AGGCTGTGGCCACAGTGCCAGGG - Intronic
1049759530 8:144325813-144325835 TGGCTCTGGCAACATCGGCAGGG + Intronic
1051118553 9:13726427-13726449 AGGCTCTGCCCTCAAGGTAACGG + Intergenic
1051443996 9:17120923-17120945 AGGCTATGGCCAGAACAACATGG + Intergenic
1061994322 9:134176109-134176131 AGGCCCTGGCCCCAACGTCCCGG + Intergenic
1062133366 9:134912302-134912324 AGGCTCTGGCAACATCGGGAAGG - Intronic
1062229117 9:135471466-135471488 AGGTGCTGGCCACCACGCCAGGG - Intergenic
1062684854 9:137806577-137806599 AGGCGCTGGCCACCACGCCCGGG + Intronic
1185649382 X:1637540-1637562 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649411 X:1637705-1637727 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649455 X:1637953-1637975 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649499 X:1638201-1638223 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649528 X:1638366-1638388 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649617 X:1638859-1638881 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649645 X:1639024-1639046 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649675 X:1639189-1639211 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649761 X:1639682-1639704 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649789 X:1639847-1639869 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649819 X:1640012-1640034 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649848 X:1640177-1640199 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649879 X:1640342-1640364 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649937 X:1640670-1640692 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649967 X:1640835-1640857 AGGCTGTGTCCACATCCTCATGG - Intronic
1185649996 X:1641000-1641022 AGGCTGTGTCCACATCCTCATGG - Intronic
1185650027 X:1641165-1641187 AGGCTGTGTCCACATCCTCATGG - Intronic
1185650197 X:1642068-1642090 AGGCTGTGCCCACATCCTCATGG - Intronic
1185650272 X:1642484-1642506 AGGCTGTGCCCACATCCTCATGG - Intronic
1197715174 X:129701335-129701357 CGGCTCTGGCCACAGTGTTATGG - Intergenic