ID: 985543397

View in Genome Browser
Species Human (GRCh38)
Location 5:497451-497473
Sequence GGGCACCGGGACTGCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985543387_985543397 30 Left 985543387 5:497398-497420 CCACCCTCGAGCATTTGCGAATG 0: 1
1: 0
2: 0
3: 5
4: 31
Right 985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 183
985543388_985543397 27 Left 985543388 5:497401-497423 CCCTCGAGCATTTGCGAATGTCA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 183
985543389_985543397 26 Left 985543389 5:497402-497424 CCTCGAGCATTTGCGAATGTCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 183
985543393_985543397 -4 Left 985543393 5:497432-497454 CCTGTGTCTGAGCCTGTCTGGGC 0: 1
1: 0
2: 0
3: 34
4: 321
Right 985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985543397 Original CRISPR GGGCACCGGGACTGCTGTGA AGG Intronic
900408437 1:2502474-2502496 CGGCCCCGGGCCTGCTGGGATGG + Intronic
900461267 1:2803100-2803122 GCCCATCGGCACTGCTGTGATGG - Intergenic
900823962 1:4911551-4911573 GGCCACAGGGGCTGCTGTGTTGG + Intergenic
901913248 1:12478100-12478122 GGGCCCAGGGCCTGCTGGGATGG + Intronic
903174668 1:21573804-21573826 GGACCCCGGGTCTGCTGAGAGGG + Intronic
904400794 1:30255031-30255053 GGTCACAGGGGCTGCTGTGCGGG + Intergenic
904917274 1:33979240-33979262 GGGAACCTGGGCAGCTGTGACGG - Intronic
905170862 1:36108831-36108853 GGAGACCAGGACTGCTGGGAAGG - Intronic
905308122 1:37033036-37033058 GGGCGCAGGGCCTGCGGTGATGG + Intronic
911745661 1:101439272-101439294 GGCCACCTGGGCTGCTGGGAGGG - Intergenic
914397711 1:147286569-147286591 GGGCACTGGGACTGGGGTGGTGG + Intronic
914988563 1:152479486-152479508 GGGCACCAGGACTCCAGTTAAGG - Intergenic
915463126 1:156081515-156081537 GGGCGCCGGGACCACTGAGAGGG - Intronic
915933842 1:160078427-160078449 GGGCACCTGGACTGAGGCGAGGG + Intergenic
919743176 1:200992609-200992631 GGGCACCTGCACTGCTGGGCTGG - Intronic
920352112 1:205344092-205344114 GGGCGCCGAGACTGCGGGGAGGG - Intronic
921708046 1:218346216-218346238 GGGCGCCGGGAGCGCGGTGAGGG - Exonic
923423312 1:233842961-233842983 AGGCATTTGGACTGCTGTGATGG - Intergenic
923552942 1:234978670-234978692 GGGCACCGGGAGTGTTTTGAGGG - Intergenic
1062930202 10:1347787-1347809 GGACACCAGGATTGCTGAGAAGG + Intronic
1063857653 10:10272714-10272736 GGGCACAGGGACCCATGTGAAGG + Intergenic
1065782837 10:29186625-29186647 GGGCACCTGAAGTGCTGTGGGGG + Intergenic
1066007975 10:31165616-31165638 AGGCACTGGGATTGCTGTGCAGG + Intergenic
1070772299 10:79089533-79089555 GGGTACTGGGACTGCTGTGTTGG + Intronic
1072067849 10:91887548-91887570 GGGCACCGGTGGAGCTGTGAGGG - Intergenic
1072304722 10:94096111-94096133 AGGCAGTGGGACAGCTGTGAGGG - Intronic
1073101064 10:101006929-101006951 GAGCAGCGGGACAGCTTTGAGGG + Exonic
1073472416 10:103731130-103731152 GGGCAGCAGGACTCCTCTGAAGG + Intronic
1075085782 10:119413591-119413613 CGGCACCAGGTGTGCTGTGAGGG - Intronic
1075644825 10:124090709-124090731 GGTCACCGTGGCTGCTGTGAGGG - Intronic
1076404517 10:130202953-130202975 GGGCACCGTGTGTGCTGTGCAGG - Intergenic
1076404524 10:130203011-130203033 GGGCACCGTGTGTGCTGTGTGGG - Intergenic
1076404532 10:130203051-130203073 GGGCACCGTGCGGGCTGTGAGGG - Intergenic
1076404540 10:130203100-130203122 GGGCACCGTGCGGGCTGTGAGGG - Intergenic
1076404564 10:130203243-130203265 GGGCACCGTGCGGGCTGTGAGGG - Intergenic
1077146662 11:1049563-1049585 GGGCCCCTTGGCTGCTGTGACGG - Intergenic
1081808998 11:45904918-45904940 GGTCACCTGGCCTGCAGTGAGGG - Intronic
1083304493 11:61755386-61755408 GGGCACAGGGCCTGCAGAGAGGG + Intronic
1083333127 11:61908252-61908274 GGGGACCGGGACAGCTGCAAGGG + Exonic
1085312882 11:75526293-75526315 GGGCATGGGGACTGCTGTGCGGG + Intergenic
1087691763 11:101328710-101328732 GAGCCCTGGGACTGCTGTGTTGG + Intergenic
1087772890 11:102229728-102229750 GGGAAACGGTTCTGCTGTGAGGG - Exonic
1088250588 11:107858321-107858343 GGTCCCCGGGGATGCTGTGAAGG - Intronic
1089367732 11:117931372-117931394 GGGCACTGGGAAGGCTGGGAAGG + Intergenic
1090243618 11:125200781-125200803 GGGCACTGGGGATGCAGTGACGG - Intronic
1091224898 11:133951342-133951364 GGGGGCCGGGAGGGCTGTGAGGG - Intronic
1091582072 12:1796277-1796299 GGCCGCTGGGACTGCTGGGAAGG - Intronic
1091582288 12:1797177-1797199 GGGGACCGGGACAGCCGGGATGG - Intronic
1094348462 12:29497584-29497606 GGGCACCAGGACTGCGGAGGAGG - Intronic
1094831161 12:34300965-34300987 CTGCACAGGGACTGCTGGGAAGG - Intergenic
1094832828 12:34308291-34308313 CCGCACAGGGACTGCTGGGAAGG - Intergenic
1094834146 12:34314376-34314398 CTGCACAGGGGCTGCTGTGAAGG + Intergenic
1097019069 12:56007457-56007479 GGGGAGGGGGACGGCTGTGATGG + Intergenic
1100548414 12:95624454-95624476 GGGCTCAGGGACTGCTGTAAGGG + Intergenic
1103393682 12:120591854-120591876 GGGGACTGGGACTGCAGAGATGG + Intergenic
1103552863 12:121748940-121748962 GGGAACGGGGACTTCTCTGAAGG - Intronic
1104874546 12:132024810-132024832 TGCCACCGGGGCTGCTGTGGGGG - Intronic
1104975124 12:132548775-132548797 GGGCACCTGGACGGGGGTGAGGG + Intronic
1105780537 13:23702051-23702073 GGGCACCTGCTGTGCTGTGAGGG - Intergenic
1108490332 13:50975240-50975262 GGGCATCGTGACAGCTGTGATGG - Intergenic
1113871487 13:113562493-113562515 TGGCACCAGGACTGCCGGGAGGG - Intergenic
1121906429 14:97750414-97750436 GGGGACAGGGACTGCTCAGAAGG + Exonic
1125835388 15:42746070-42746092 AGGCACTGGGACTCCTGCGAGGG + Exonic
1125889665 15:43256255-43256277 GGGCATCATCACTGCTGTGATGG + Intronic
1126649827 15:50909039-50909061 GGGCTCAGGGGCTGCTGTGTCGG + Intronic
1127520626 15:59740009-59740031 GGTCACCAGGCCAGCTGTGAGGG + Intergenic
1129413579 15:75362620-75362642 GGTCAGAGGGACAGCTGTGAGGG - Exonic
1130994171 15:88895014-88895036 GGGCCCCGGGAGTCCTGGGAGGG - Intronic
1131509467 15:93041728-93041750 GGGCACGGGGCCTGTAGTGACGG + Intronic
1131968273 15:97868026-97868048 GGGAACAGGGTCAGCTGTGAAGG - Intergenic
1134566051 16:15252805-15252827 GGGCTTCGGGGCTGCTCTGAAGG + Intergenic
1134736443 16:16503893-16503915 GGGCTTCGGGGCTGCTCTGAAGG - Intergenic
1134931071 16:18208275-18208297 GGGCTTCGGGGCTGCTCTGAAGG + Intergenic
1136411276 16:30078867-30078889 GGGCACAGGGCCTGCTGCGCTGG + Intronic
1136548947 16:30971600-30971622 GGGCACTGGGACTTCTCTGGGGG - Exonic
1137648303 16:50095466-50095488 GTGCACATGGATTGCTGTGAAGG - Intronic
1138351753 16:56349712-56349734 GGGCACCTGGACAGCTGGCATGG - Intronic
1140823051 16:78680788-78680810 GGGCACAGTACCTGCTGTGATGG + Intronic
1145259355 17:21345473-21345495 TGCCCCCGGGGCTGCTGTGAGGG - Intergenic
1145317263 17:21742476-21742498 CGCCCCCGGGGCTGCTGTGAGGG + Intergenic
1148564767 17:48626341-48626363 TGGCACCCGGACCGGTGTGAGGG + Exonic
1153879290 18:9406122-9406144 GTCCACCTGGACTGCTGAGATGG - Intergenic
1157674716 18:49560789-49560811 GGGGCGCGGGACTGCTGTGGGGG + Intronic
1159465570 18:68778758-68778780 GGGCATGGGAACTGCTTTGAAGG + Intronic
1160542776 18:79634283-79634305 GGTCACTGGGAGTGCTGTGCAGG - Intergenic
1164680188 19:30129334-30129356 GGGCACAGGGAGTCCTGGGAGGG + Intergenic
1165100575 19:33436329-33436351 GGGCATGGGGCCTGCTGGGAAGG - Intronic
1168275287 19:55274546-55274568 GGGCTGCGGGACTGCGGTGGCGG - Exonic
925351179 2:3201537-3201559 GGGCACAGGCACTGCAGGGAGGG + Intronic
926194972 2:10757887-10757909 GGGCACCGGGACTGCCCTGGAGG - Intronic
929888380 2:45898839-45898861 GATCACAGGGACTTCTGTGAAGG + Intronic
929936319 2:46297029-46297051 GGGCTCCGGGATTGCTGCGGGGG - Intronic
930100053 2:47596435-47596457 GGGCTCAGGGAGTGCTGGGAAGG + Intergenic
931667852 2:64623104-64623126 AGGCACCGGATCTGCTGTGTCGG + Intergenic
932494652 2:72140353-72140375 GGGCACAGGGGCTGCTGAGGGGG - Intronic
934118947 2:88822160-88822182 GGGCACCGGGACCCCTCTGCAGG - Intergenic
935065660 2:99645221-99645243 GGGCACGGGGAGAGCTGAGATGG + Intronic
937273461 2:120669849-120669871 GGGAACCGGGAGTGGGGTGAGGG + Intergenic
938405128 2:131028271-131028293 GGGCACAGGGAGTCCTGTGTTGG - Intronic
938954354 2:136284271-136284293 GGGCACTTGGACTCCTGTGCTGG - Intergenic
948398915 2:237668343-237668365 AGGCACAGGGACAGCTGTGACGG - Intronic
1169087585 20:2836936-2836958 GGGCACAGTGGCAGCTGTGAGGG - Intronic
1170043300 20:12060673-12060695 GGGCACTGGGAGGGCTCTGATGG + Intergenic
1170838394 20:19904388-19904410 GGGCACCGGGTATGCGGTGCTGG + Intronic
1171180069 20:23085360-23085382 TGCCACCAGGACTGCTTTGAAGG - Exonic
1171308126 20:24123419-24123441 GGGCACAGGGACAGTGGTGAGGG + Intergenic
1174115463 20:48223829-48223851 GTGCTCCGGGACTGCTGAGCTGG - Intergenic
1175804596 20:61820539-61820561 GTGCAGTGGGACTGCTGTGAGGG - Intronic
1176089506 20:63312673-63312695 GGGCACCCGGACGGGTGTGATGG + Intronic
1176203520 20:63875530-63875552 GGGCAACAGCACTGCTGTGGGGG - Intronic
1176549338 21:8214600-8214622 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176557231 21:8258823-8258845 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176568270 21:8397638-8397660 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176576173 21:8441858-8441880 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1178101661 21:29275511-29275533 AGGCACCAGGACTTCTGTTAAGG - Intronic
1181914369 22:26267807-26267829 GGTCACCAGGACTGCAGGGAAGG + Intronic
1182967117 22:34532725-34532747 GGGCAGGGGGACTACAGTGAGGG - Intergenic
1183301454 22:37061007-37061029 GGGCCCCGGGGCTGCTGGGGGGG + Intronic
1183425172 22:37735266-37735288 GGGCTCTGGGACTGCAGTGCGGG - Exonic
1183726432 22:39592521-39592543 GGTCACCCCGACTGCAGTGAGGG + Intronic
1184649879 22:45914885-45914907 GGGCACCTTGCCTGCTGAGAGGG - Intergenic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
1203254223 22_KI270733v1_random:130916-130938 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1203262279 22_KI270733v1_random:175995-176017 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
954578044 3:51687572-51687594 TGGATCTGGGACTGCTGTGAAGG + Intronic
954880884 3:53835420-53835442 GGGCACAGTGACAGGTGTGAAGG - Intronic
956693603 3:71900311-71900333 GAGCACCCAGGCTGCTGTGAAGG - Intergenic
961779091 3:129311120-129311142 GAGCACAGGGACTGTTGGGAAGG - Intergenic
962388024 3:134948702-134948724 GGGCACAAGGCATGCTGTGAAGG + Intronic
966875555 3:184319817-184319839 GGGCTCCGGGACATCTGGGAAGG + Intronic
968582387 4:1401168-1401190 GGGCACTGGGGCTGCTGAGTGGG - Intergenic
969183751 4:5460694-5460716 GGGAACCAGGACTGCAGGGATGG + Intronic
969867708 4:10086369-10086391 GGGCAGCAGCACTGCTGAGAGGG - Intronic
970431102 4:15989952-15989974 GGGCATGGGGGCTGGTGTGAGGG + Intronic
971758548 4:30734695-30734717 GGGCACTGGAAATACTGTGATGG - Intronic
983650588 4:170032653-170032675 GGGCACCGTGGCTCCTTTGAGGG + Intronic
983923449 4:173371296-173371318 GGGCACCGGGGCTGAGGTGCCGG + Exonic
985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG + Intronic
985640338 5:1060694-1060716 GGGCACAAGGGCAGCTGTGAGGG + Intronic
985641801 5:1066918-1066940 GTGGCCCGGGGCTGCTGTGATGG - Intronic
987050748 5:14144726-14144748 GGGCACCGGGTTTGCTGCGCAGG + Intronic
989730777 5:44645568-44645590 GAGCAAAGGGACTGCTCTGAAGG + Intergenic
990237443 5:53783337-53783359 GTTCCCCGGGACTGCTGTGAAGG + Intergenic
993664233 5:90675366-90675388 GTGCACAGGGACTTCTGGGAAGG + Exonic
997297589 5:132777454-132777476 GGGGACCGGGACGGCAGTGTCGG + Intronic
997912359 5:137888869-137888891 GGGCCCCAGGACTCCTGTGTCGG + Intronic
1000239338 5:159394911-159394933 GCACCCCGGGACTGCTCTGATGG - Intergenic
1002947970 6:1780741-1780763 AGGCACTAGGACTCCTGTGATGG - Intronic
1003307094 6:4939378-4939400 GGGTTCCAGGACTCCTGTGATGG - Intronic
1003476520 6:6488627-6488649 GGGGACCCTGACTGATGTGAGGG + Intergenic
1004478448 6:15996455-15996477 GGACACAGGGCCTGCTGTCATGG - Intergenic
1006091763 6:31632539-31632561 GGCCACTGTGACTGTTGTGAGGG - Exonic
1019354223 7:570527-570549 GGGCTCGGGGACTGCTGGGCAGG - Intronic
1019541751 7:1554776-1554798 AGGGACCGGGACTCCTGTGCAGG - Intronic
1024707009 7:51972008-51972030 GGGCATAGGGACTGCTGCAATGG + Intergenic
1025230158 7:57198556-57198578 GGGGACCAGGCCTTCTGTGATGG - Intergenic
1027125799 7:75555926-75555948 GGACCCCGGGGCTGCTGAGAAGG - Intronic
1027187850 7:75982418-75982440 GGGCACGGGGTCTGGTGAGAAGG - Intronic
1030676469 7:112390892-112390914 GGGCACCGGGTATGGTGTGCTGG - Intergenic
1033366782 7:140678167-140678189 GGGGACAGGGACTGATCTGAGGG + Intronic
1034069893 7:148174397-148174419 GGTCACAGGAACTGCTGTGCAGG - Intronic
1034886443 7:154802383-154802405 GGGCTGCGGGACTCCTGGGATGG + Intronic
1036165610 8:6429858-6429880 GGGCATGGGGACAGGTGTGAGGG - Intronic
1036181003 8:6585409-6585431 GGGCTCCCAGACAGCTGTGAGGG - Intronic
1036646265 8:10612762-10612784 GGGCCACGGGACTGCCGGGAGGG - Exonic
1037988552 8:23304723-23304745 TGCCACCGTGACTGCTATGATGG - Intronic
1040111916 8:43570438-43570460 GGGCGCGGGGGCTGCTGGGAAGG + Intergenic
1045370853 8:101521257-101521279 GGGAACAGGGACTCCTCTGATGG - Intronic
1049449727 8:142654249-142654271 GGGCAGCAGGTGTGCTGTGAGGG - Intergenic
1050568968 9:6917772-6917794 GGGCACCGGGACTGATAGGTAGG - Intronic
1050773659 9:9234399-9234421 GTGGACAGGGACTGCTGTGAAGG + Intronic
1053196215 9:36121084-36121106 AGGCACGGGGACTGGTGTGAGGG - Intronic
1053372475 9:37574616-37574638 GGGCTCTGGAACTGGTGTGAGGG + Intronic
1057174329 9:92985073-92985095 TGGAAACGGGACTGCTTTGAAGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061149080 9:128818779-128818801 CGGCGCCGGGACTGCTGGGCCGG + Exonic
1061216343 9:129224134-129224156 GGGCCCAGGGACCGCTGTGGGGG - Intergenic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1061956223 9:133962516-133962538 GGGCACCTGGGCTGCTGCGGGGG + Intronic
1062606744 9:137351924-137351946 GTGCCCCAGGGCTGCTGTGAGGG - Intronic
1062675842 9:137743231-137743253 GGGCAGTGGGCCTGTTGTGATGG + Intronic
1062707836 9:137955018-137955040 GGTCACCATGACGGCTGTGAAGG + Intronic
1203779173 EBV:91432-91454 GGGCACCGGGGCTGGCGTTAGGG + Intergenic
1203470624 Un_GL000220v1:114060-114082 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1203478445 Un_GL000220v1:158032-158054 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1187577581 X:20574777-20574799 GGGGACAGGGAGTGCTGGGATGG + Intergenic
1187899544 X:24014709-24014731 GGGCACCCAGCCTGCTGAGAGGG + Intronic
1187960604 X:24563460-24563482 GGGCACCGCGGCTGCCTTGAGGG + Intronic
1189364177 X:40375473-40375495 GTGCACAGTGAATGCTGTGAGGG + Intergenic
1189496746 X:41515568-41515590 AGGCAGCGTGACTGATGTGAAGG - Intronic
1191254243 X:58272956-58272978 GGGCGCAGGGGCTGCTGGGAAGG + Intergenic
1191254397 X:58273546-58273568 AGGCACCAGGGCTGCTGGGAAGG + Intergenic
1191255345 X:58277227-58277249 AGGCACAGGGACTGCAGAGAAGG + Intergenic
1191256233 X:58280791-58280813 GGGCACAGGGGCTGCCGGGAAGG + Intergenic
1192177208 X:68893492-68893514 GGACACCTGGGCTGCTCTGAGGG + Intergenic
1192889906 X:75379069-75379091 TGGCACCTGGACTGCTAAGAAGG - Intronic
1198505657 X:137298656-137298678 TTTCACAGGGACTGCTGTGAAGG - Intergenic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic
1201904597 Y:19076665-19076687 GAGCCCGGGGGCTGCTGTGAGGG - Intergenic