ID: 985543903

View in Genome Browser
Species Human (GRCh38)
Location 5:499825-499847
Sequence GACCCTGGACTGGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 1, 3: 56, 4: 517}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985543903_985543908 -8 Left 985543903 5:499825-499847 CCAGCCACTCCCAGTCCAGGGTC 0: 1
1: 1
2: 1
3: 56
4: 517
Right 985543908 5:499840-499862 CCAGGGTCCAGCCCCTCTGTAGG 0: 1
1: 0
2: 0
3: 17
4: 300
985543903_985543910 -6 Left 985543903 5:499825-499847 CCAGCCACTCCCAGTCCAGGGTC 0: 1
1: 1
2: 1
3: 56
4: 517
Right 985543910 5:499842-499864 AGGGTCCAGCCCCTCTGTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 121
985543903_985543909 -7 Left 985543903 5:499825-499847 CCAGCCACTCCCAGTCCAGGGTC 0: 1
1: 1
2: 1
3: 56
4: 517
Right 985543909 5:499841-499863 CAGGGTCCAGCCCCTCTGTAGGG 0: 1
1: 0
2: 1
3: 23
4: 190
985543903_985543915 15 Left 985543903 5:499825-499847 CCAGCCACTCCCAGTCCAGGGTC 0: 1
1: 1
2: 1
3: 56
4: 517
Right 985543915 5:499863-499885 GGCCACTGCTCAAGCCAGCATGG 0: 1
1: 0
2: 1
3: 29
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985543903 Original CRISPR GACCCTGGACTGGGAGTGGC TGG (reversed) Intronic
900441525 1:2657936-2657958 GATGCTGGCCTGGGAGTGGTGGG - Intronic
900444313 1:2672346-2672368 GATGCTGGCCTGGGAGTGGTGGG - Intronic
900445215 1:2677002-2677024 GATGCTGGCCTGGGAGTGGTGGG - Intronic
900445927 1:2680736-2680758 GATGCTGGCCTGGGAGTGGTGGG - Intronic
900446201 1:2682181-2682203 GATGCTGGCCTGGGAGTGGTGGG - Intronic
900653366 1:3742253-3742275 CAGCCTGGACTGGGCTTGGCTGG - Intergenic
900721604 1:4179658-4179680 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
901671861 1:10860769-10860791 GACCCTGGAGGTGGAGAGGCGGG + Intergenic
901674170 1:10873245-10873267 GCCCCTGGACGGGGTCTGGCTGG + Intergenic
902318691 1:15644195-15644217 GAGCCTGGACTGGCAGTTTCAGG + Intronic
902651217 1:17838862-17838884 GAGGCGGGACTGGGAGAGGCAGG - Intergenic
903005948 1:20298930-20298952 GGCACTGGAATGGAAGTGGCCGG + Intronic
903661908 1:24983614-24983636 GGCACTGGACGGGGAGTGGTGGG + Intergenic
903743108 1:25569801-25569823 GACACTGGGCTGGGAGAGGAAGG + Intergenic
904678424 1:32212609-32212631 GCCCCTGGGCAGGGAGGGGCTGG - Exonic
905286129 1:36881582-36881604 GAGTCGGGGCTGGGAGTGGCGGG - Intronic
905658285 1:39700552-39700574 GACCCTGCTCAGGGATTGGCAGG + Intronic
906205432 1:43984061-43984083 GACTCTGGACTAGGACTAGCAGG - Intronic
907668526 1:56453827-56453849 GATCCTGGGCTGGGACTGGCTGG - Intergenic
907718556 1:56950568-56950590 CACCCTTGTCTGGGAGTTGCAGG - Intronic
911001441 1:93170346-93170368 GGCCCCGCACTGGGAGCGGCCGG + Intronic
911307376 1:96247418-96247440 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
911807975 1:102235092-102235114 GGCCCTGCATTCGGAGTGGCTGG - Intergenic
912546469 1:110454991-110455013 GACTCTGGACTGGGAGCTGGAGG - Intronic
912682392 1:111737829-111737851 GACCCTGGAGTAGGACTGACAGG + Intronic
913500590 1:119469312-119469334 GGCCCTGGAATGGGGGAGGCAGG - Intergenic
915109340 1:153553171-153553193 GACACTGGACGGGGTGTGGGAGG - Intergenic
916574873 1:166058370-166058392 GACGCTGGAGAGGGAATGGCTGG + Intronic
917406322 1:174711476-174711498 GACCCCGCACTCGGAGCGGCTGG + Intronic
918542720 1:185649209-185649231 GGCCCCGCACTCGGAGTGGCTGG - Intergenic
919658063 1:200216393-200216415 GACCCTGTACTAGGACTGGGTGG - Intergenic
919817128 1:201448598-201448620 GACCCTGGCATGGGGGTGGGGGG + Intergenic
920070765 1:203301444-203301466 GACCCTTGGGTGGGAGTGGAGGG + Intergenic
920150211 1:203900315-203900337 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
920181957 1:204137509-204137531 GACACTGTCCTGGGAGTGACAGG + Intronic
920431759 1:205923286-205923308 GGCTCTGGACAGAGAGTGGCCGG - Intronic
920718561 1:208365129-208365151 TACCTCGGTCTGGGAGTGGCAGG + Intergenic
921096273 1:211889627-211889649 GGCCCCGCACTGGGAGCGGCAGG + Intergenic
922243659 1:223774152-223774174 GACCCTGGAGTGGGGGTGGGTGG - Intronic
922412909 1:225392971-225392993 GACAGTGGCGTGGGAGTGGCAGG - Intronic
922485409 1:225969848-225969870 GGCCCTGCACTGGGAGCAGCCGG + Intergenic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
923100364 1:230809462-230809484 AGCCCTGGACTGGGACTGACAGG + Intergenic
923199009 1:231693985-231694007 GGCCCTGGACTCCGAGTGGTGGG - Exonic
923623242 1:235594664-235594686 GGCCCCGCACTGGGAGCGGCCGG - Intronic
1063380889 10:5585152-5585174 GGCCCTGGACTCGGAATGCCTGG + Intergenic
1064030576 10:11880343-11880365 GTCCCTGGACTGGGCCGGGCTGG - Intergenic
1065565414 10:27002604-27002626 GACCCTGAACTGGGATAAGCAGG + Intronic
1065752184 10:28897058-28897080 GACCCTGCACTCGGAGCGGCCGG - Intergenic
1065963791 10:30754659-30754681 CACCCTGGGTTGGGAGTGTCTGG + Intergenic
1065965860 10:30769701-30769723 GGCCCTGCACTCGGAGCGGCTGG - Intergenic
1065981584 10:30903080-30903102 GGCCCCGCACTGGGAGCGGCTGG - Intronic
1067469724 10:46527742-46527764 AGCCCTGGACTGGCTGTGGCCGG + Intergenic
1067802661 10:49369924-49369946 GACGTGGGACTGGGTGTGGCTGG - Intronic
1069900791 10:71705558-71705580 ACCCCTGGACTGGCAGTAGCAGG + Intronic
1069906604 10:71735915-71735937 GCCCCTTGGCTGGGAGTGGCAGG - Intronic
1070147512 10:73785762-73785784 GAGCCGGGGCTGGGGGTGGCCGG - Exonic
1070161844 10:73871622-73871644 TACCCTGGAGTGGGGGTGGGGGG - Intronic
1070968298 10:80543326-80543348 GACCCCGCACTCGGAGCGGCCGG + Intronic
1071611025 10:87031253-87031275 GGCCCTGCACTTGCAGTGGCCGG - Intergenic
1073493988 10:103874765-103874787 GACCAAGCACTTGGAGTGGCAGG + Intergenic
1073532500 10:104245252-104245274 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1073996883 10:109325568-109325590 GAACATGGACTGGGAGTGGTAGG - Intergenic
1074049342 10:109867984-109868006 GACCCTGGACTGGTAAGGCCAGG - Intronic
1075307616 10:121382241-121382263 GACCCTGGACTCGGAGCTGCGGG + Intergenic
1075505023 10:123013785-123013807 GGCCCTGCACTCGGAGCGGCCGG - Intronic
1076607797 10:131700724-131700746 CACCCTGGACTGGGAAGGGCAGG - Intergenic
1076638317 10:131897793-131897815 GACCTTGGACTGGTTCTGGCCGG + Intergenic
1076690795 10:132223044-132223066 TGCCCTGGCCTGGGGGTGGCGGG - Intronic
1077317729 11:1926854-1926876 GACCCTGGCTTGGGAAGGGCTGG + Intronic
1077815600 11:5683026-5683048 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1078319687 11:10322987-10323009 GTCTCTGGCCTGGGGGTGGCGGG + Intronic
1079136069 11:17776651-17776673 GGCCCTGGGCTGGGGGAGGCAGG + Intronic
1079148590 11:17876775-17876797 ATCACTGGACTGGGAGAGGCTGG - Intronic
1079163116 11:18012803-18012825 GATCCTGGGCTGGGAGCGGAGGG - Intronic
1080106040 11:28512613-28512635 GGCCCTGCACTCAGAGTGGCCGG - Intergenic
1080685827 11:34513957-34513979 TCCCCTGGGCTGGGAGTGGGGGG - Intergenic
1081047709 11:38296549-38296571 CGCCCTGCACTGGGAGTGGCTGG - Intergenic
1081136166 11:39442344-39442366 GGCCCTGCACTTGGAGCGGCTGG - Intergenic
1083188920 11:61035633-61035655 GACCCTGGGGAGGGGGTGGCTGG - Intergenic
1083622553 11:64056334-64056356 GAGCCTGGGCGGGGAGTGGCGGG - Intronic
1083871380 11:65490440-65490462 GGGCCTGGATTGGGAGTGGGGGG - Intergenic
1083902395 11:65649972-65649994 GACCCTGGAGGACGAGTGGCAGG + Exonic
1083945554 11:65920819-65920841 AACCCATCACTGGGAGTGGCAGG - Intronic
1084006574 11:66326481-66326503 GACCCTCAGCTGGGAGGGGCCGG - Intergenic
1084024762 11:66441015-66441037 GACCCCGCACTCGGAGCGGCCGG - Intronic
1084122582 11:67078055-67078077 GACCCGGCACTGGGAGAGGCGGG + Intergenic
1084874484 11:72120810-72120832 GGCACTGGGGTGGGAGTGGCGGG - Intronic
1085375866 11:76060643-76060665 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1085454011 11:76655735-76655757 GACTGTGACCTGGGAGTGGCAGG + Intergenic
1085527514 11:77172892-77172914 GGCCCTGGCCTGGGGTTGGCGGG + Intronic
1087288360 11:96291871-96291893 GCCCCTGCAATGTGAGTGGCTGG + Intronic
1088175646 11:107050346-107050368 GACCATGGAAAGGGAGGGGCTGG - Intergenic
1089209206 11:116789236-116789258 AGACCTGGACTGGGAGTGGGTGG + Intergenic
1089846971 11:121466273-121466295 GACACTGGCCTGGGAGTGGGTGG - Intronic
1091435042 12:465753-465775 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435059 12:465814-465836 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435077 12:465875-465897 CCCCCAGGACAGGGAGTGGCAGG - Intronic
1091435112 12:465999-466021 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435129 12:466060-466082 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435146 12:466121-466143 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091621818 12:2094735-2094757 GACCAGGAAGTGGGAGTGGCTGG + Intronic
1092732455 12:11547371-11547393 GACCCAGCACTCGGAGCGGCAGG + Intergenic
1095304137 12:40620735-40620757 GACCCCGCACTCGGAGCGGCAGG + Intergenic
1095803811 12:46296529-46296551 GGCCCTGGAGTGGCAGTGGAGGG - Intergenic
1096007661 12:48185293-48185315 GCCCCTGGGCTGGGAGGAGCTGG + Exonic
1097178991 12:57160204-57160226 GGCCCTGAACTGGGAGTGACAGG - Intronic
1097863755 12:64543002-64543024 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863762 12:64543023-64543045 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863769 12:64543044-64543066 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863776 12:64543065-64543087 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863783 12:64543086-64543108 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863790 12:64543107-64543129 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863797 12:64543128-64543150 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863804 12:64543149-64543171 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863811 12:64543170-64543192 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863818 12:64543191-64543213 GGCCCCGCACTTGGAGTGGCGGG + Intergenic
1097863824 12:64543212-64543234 GGCCCCGCACTTGGAGTGGCCGG + Intergenic
1097925807 12:65124972-65124994 GAGCCTGGAATGGGAGAGGGAGG + Intergenic
1098114062 12:67155874-67155896 GACCATGGACTGGTTCTGGCTGG - Intergenic
1098127475 12:67314958-67314980 GATACTGGAATGGAAGTGGCAGG + Exonic
1099190218 12:79554286-79554308 GGCCCCGCACTGGGAGCGGCGGG - Intergenic
1099203312 12:79700403-79700425 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
1100600627 12:96108983-96109005 GACCCCGCACTCGGAGCGGCCGG + Intergenic
1101592189 12:106134501-106134523 GAGTCTGGGATGGGAGTGGCAGG - Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1101836963 12:108302642-108302664 GACCTGAGGCTGGGAGTGGCTGG - Intronic
1101970842 12:109310660-109310682 TCCCCTGGACTGGGTGTGCCTGG + Intergenic
1103342964 12:120230827-120230849 GTCCCTGGGCTGGGGGTGGGTGG - Intronic
1103459679 12:121093789-121093811 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1103668525 12:122592103-122592125 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1104241707 12:126996306-126996328 GACCATGGACTGGTTCTGGCTGG - Intergenic
1104978456 12:132562360-132562382 GGCCCTGGACTGGGGCTGGGAGG + Intronic
1108509899 13:51147208-51147230 GACCTTGGACTAGGTGTGGTGGG + Intergenic
1108735400 13:53278598-53278620 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
1108991158 13:56659391-56659413 GGCTCTGCACTTGGAGTGGCCGG - Intergenic
1108995996 13:56735687-56735709 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1109159891 13:58958464-58958486 GGCCCTGCACTGGGAGCAGCCGG - Intergenic
1109563177 13:64077776-64077798 GACCCCGCACTTGGAGCGGCCGG - Intergenic
1110874387 13:80490844-80490866 GGCCCTGCACTGGGAGCAGCCGG - Intergenic
1111006626 13:82258037-82258059 GCCCCCGTACTGGGAGGGGCCGG + Intergenic
1111822601 13:93231200-93231222 GACCCTGGAGTCAGAGTGCCTGG - Intronic
1112226482 13:97545355-97545377 GGCCCTGCACTCGGAGTGGCTGG + Intergenic
1112282705 13:98076574-98076596 GGCCCTGCACTGTGAGCGGCCGG - Intergenic
1112418184 13:99222376-99222398 GGCCCTGTAGTGGGAGTGGCAGG + Intronic
1113653344 13:112053647-112053669 GACCCTTGCCTGGGAGAGGGAGG + Intergenic
1113800758 13:113085266-113085288 GCCCTTGGCCTGGGAGGGGCAGG - Intronic
1114549814 14:23526238-23526260 GCCCCTGCACGGGGAGAGGCCGG - Exonic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1115329069 14:32174521-32174543 GACCCAGAACTGTAAGTGGCTGG - Intergenic
1115616098 14:35096216-35096238 GACCCAGTACTGGGGGTGGTGGG + Intronic
1116149197 14:41116767-41116789 GACAATGGACTGGGGGTGGTCGG + Intergenic
1116653760 14:47626636-47626658 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1116872811 14:50084006-50084028 GAGTCTGGAGTGGGAGGGGCAGG + Exonic
1117252996 14:53953963-53953985 GACCCTGGGGAGGAAGTGGCGGG - Intronic
1117368909 14:55058003-55058025 GACCCTGAACTGGAAGAGGGAGG - Intronic
1118326870 14:64787123-64787145 GACCCTGGTGTCGGAGCGGCGGG - Exonic
1118606264 14:67506135-67506157 GTCACTGGACTGGGAGGGGCAGG - Intronic
1119695063 14:76706946-76706968 GGCCCTGCACTGGGAGCGGCCGG - Intergenic
1120219911 14:81720257-81720279 GAAGCTGGACTGGGAGTGCAGGG - Intergenic
1121101720 14:91254075-91254097 CACCCGGGAGTGGGCGTGGCTGG - Intergenic
1121233059 14:92372441-92372463 GTCCCTGGGCTGGGTGTGGTGGG + Intronic
1121783789 14:96639648-96639670 GGCCCTGGCCTTGGTGTGGCAGG + Intergenic
1122972769 14:105159094-105159116 GAGGCTGGGCTGGGTGTGGCTGG - Intronic
1123051864 14:105547909-105547931 GGCCCCGCACTCGGAGTGGCAGG + Intergenic
1123082238 14:105700955-105700977 GACCCTGGGCTGGTTGGGGCTGG + Intergenic
1123506133 15:20942243-20942265 CACGCTGGACACGGAGTGGCGGG + Intergenic
1123563361 15:21515950-21515972 CACGCTGGACACGGAGTGGCGGG + Intergenic
1123599612 15:21953233-21953255 CACGCTGGACACGGAGTGGCGGG + Intergenic
1124418055 15:29490846-29490868 GCGCCTGGAGTGGGACTGGCAGG - Intronic
1126165548 15:45651286-45651308 GGCCCCGCACTTGGAGTGGCAGG - Intronic
1126872151 15:53001480-53001502 AACCCTGGACTGGGAGGAGATGG + Intergenic
1127389056 15:58490712-58490734 AACCCGGGGCTGGGAGTGGGTGG + Intronic
1128672570 15:69585599-69585621 GAGCCTGGACTGGGAGTCCTGGG + Intergenic
1129154691 15:73710485-73710507 GATCCTGGGCTGGGAGAGGCAGG + Intronic
1129181625 15:73881625-73881647 GACCCTGGGGTGGGGGTGGGAGG - Exonic
1129452858 15:75660357-75660379 GAGCCAGGCCTGGGAGAGGCAGG + Exonic
1129476389 15:75786801-75786823 GAGCCTGCACCGGGAGCGGCCGG + Intergenic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1129820644 15:78599518-78599540 ATCTCTGGGCTGGGAGTGGCAGG - Intronic
1130273982 15:82466937-82466959 ACCCCTGGACTGGGAGTCCCCGG - Intergenic
1130466330 15:84194311-84194333 ACCCCTGGACTGGGAGTCCCCGG - Intergenic
1130497934 15:84479225-84479247 ACCCCTGGACTGGGAGTCCCCGG + Intergenic
1130588624 15:85198904-85198926 ACCCCTGGACTGGGAGTCCCCGG - Intergenic
1131212677 15:90511038-90511060 GACCCTGCGCTTGGAGCGGCCGG + Intergenic
1132097693 15:99000128-99000150 GGCCCCGCACTGGGAGTGGCCGG + Intronic
1202971717 15_KI270727v1_random:243084-243106 CACGCTGGACACGGAGTGGCGGG + Intergenic
1132577135 16:669287-669309 GTCCCTGCACTGGCAGTGGGCGG + Intronic
1132584922 16:701946-701968 GAGCCTGGCCTGGGAGCTGCTGG + Intronic
1132699031 16:1214439-1214461 GAGCCTGGGCTGGGAGGGGCAGG + Intronic
1133326084 16:4943239-4943261 GAGCCTGGCCCAGGAGTGGCGGG + Intronic
1133362662 16:5186604-5186626 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1133665745 16:7966166-7966188 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
1134440419 16:14296489-14296511 GACCCTTGACAGGGGGCGGCTGG - Intergenic
1135629019 16:24021492-24021514 GACTCTGGTTTGGGGGTGGCAGG + Intronic
1135942706 16:26836337-26836359 GGCCCCGCACTCGGAGTGGCCGG - Intergenic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138267379 16:55669505-55669527 GATCCAAGACTGGGAGGGGCAGG + Intronic
1138343094 16:56303505-56303527 GACCCTGACATGGGAGAGGCTGG + Intronic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1140097143 16:71884383-71884405 GACCCGGGAATGGGCGAGGCGGG - Intronic
1142598929 17:1043738-1043760 GACCCTGTGGTGGGAGGGGCAGG - Intronic
1142618464 17:1150598-1150620 GATCTAGGACTGGGAGTGGACGG - Intronic
1143128001 17:4656790-4656812 GACCCCGCACTCGGAGCGGCTGG - Intergenic
1143383503 17:6510787-6510809 GACAGTGGTCTGGGAGAGGCTGG + Intronic
1143460525 17:7100837-7100859 GACCCCGCACTCGGAGTGGCCGG - Intergenic
1143499402 17:7330149-7330171 GCCCCCTGACTGGGATTGGCTGG + Intergenic
1144765673 17:17731178-17731200 GACCCTGCACTTGGGGTGCCTGG + Intronic
1144775856 17:17784223-17784245 GAACGGGGACTGGGAGGGGCTGG + Intronic
1145094827 17:20016545-20016567 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1145124595 17:20289698-20289720 TGCACTGGACTGGGAGTTGCTGG + Intronic
1145901945 17:28495290-28495312 GCCACTGGACTGGAAGGGGCAGG + Intronic
1146404285 17:32523820-32523842 AACCCTGGAGTGAGAGTGGTCGG + Intronic
1146788275 17:35736380-35736402 GACCCTGGGCTGGGAGATGGCGG + Intronic
1146891226 17:36507721-36507743 GAACCTGGACTGGGGCTGGAAGG + Intronic
1148178592 17:45587134-45587156 GACCCTGGGCTGGGAGGGGGAGG - Intergenic
1148270561 17:46259321-46259343 GACCCTGGGCTGGGAGGGGGAGG + Intergenic
1149048469 17:52275864-52275886 GACCCTGGAATTGGATTGCCAGG + Intergenic
1149881645 17:60297975-60297997 GACCATGGACTGGTTCTGGCTGG + Intronic
1150846067 17:68659302-68659324 GAACCTGGATTGGGAATGGCAGG - Intergenic
1151842142 17:76626341-76626363 CACCCGGGACTATGAGTGGCTGG - Exonic
1152140002 17:78530623-78530645 GACCCTGGCCCCAGAGTGGCCGG - Intronic
1152309983 17:79544179-79544201 GTCCCTGGACTGACACTGGCCGG + Intergenic
1152727891 17:81956638-81956660 GACCCTGCGCTGTGAGTGGGCGG - Exonic
1154097623 18:11432572-11432594 GACCCCGCACTCGGAGAGGCCGG - Intergenic
1154128769 18:11717193-11717215 GACCCCGCACTGGGAGCGGCCGG - Intronic
1154294128 18:13134951-13134973 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1154349663 18:13572410-13572432 CAGCCTGGGCTGGGAGTGGAAGG + Intronic
1157021462 18:43787912-43787934 GTCAGTGGACTGGGAGGGGCAGG - Intergenic
1157686978 18:49650652-49650674 GAACATGGTCTGGGACTGGCTGG + Intergenic
1158327496 18:56326897-56326919 CACTCTGGACTGGGTGGGGCTGG + Intergenic
1159656226 18:71031987-71032009 GGCCCCGCACTGGGAGCGGCCGG - Intergenic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1160718369 19:586687-586709 GACCCTGGGGAGGGAATGGCAGG + Intergenic
1160796035 19:945834-945856 GAACCTGGGCTGGGAGTGATGGG + Intronic
1161035748 19:2083459-2083481 GACCATGGCCTGGAGGTGGCCGG - Intronic
1161267672 19:3372338-3372360 GACCCTGGACAGGGCTGGGCAGG - Intronic
1163430586 19:17264769-17264791 AAGCCTGGCCTGGGAGGGGCTGG + Exonic
1163653355 19:18531801-18531823 GAACCTGGACAGGGGGCGGCAGG + Exonic
1163720391 19:18895772-18895794 GACCCCGGACTGGGGGAAGCCGG - Intronic
1164145777 19:22511653-22511675 GACCCAGGACTGGCAGGAGCAGG + Intronic
1164693774 19:30228542-30228564 GACTCCGGACTGGGAGGCGCGGG - Intronic
1165152953 19:33771703-33771725 GAACCTGGCCTGGGAGAGGGTGG - Intronic
1165846565 19:38821575-38821597 GACCCCGCACTCGGAGTGGTGGG + Intronic
1166352123 19:42204183-42204205 GGCCCTGGGCTGGGTGTGTCTGG + Intronic
1166980669 19:46630257-46630279 GAGACTGGAATGGGAGTGGGAGG - Intergenic
1167269226 19:48498548-48498570 GACCCGGGTCTGGAGGTGGCCGG + Exonic
1167453068 19:49583639-49583661 GAACCTGGAACGGGAGTGTCTGG + Exonic
1167722053 19:51185806-51185828 GAATCTGGGCTTGGAGTGGCTGG + Intergenic
1168002893 19:53463398-53463420 GGGCCTGGAATGGGAGTGGGCGG + Intergenic
1168547246 19:57263571-57263593 GACCCTGGAGTGGTTATGGCAGG - Intergenic
925120725 2:1415804-1415826 GAGGCTGGGCTGGGTGTGGCTGG - Intronic
925293039 2:2761199-2761221 GACCTAGGAGTGGGGGTGGCAGG + Intergenic
925627096 2:5852420-5852442 GAGCCTGGAATGGGAGGTGCAGG + Intergenic
925877783 2:8327563-8327585 CACCCTGGCCTTGGAGGGGCAGG + Intergenic
926688914 2:15719278-15719300 GGGCCTGGCCTGGGAGTGACTGG + Intronic
926742676 2:16125681-16125703 GACTCTGGACTGGGCTGGGCTGG - Intergenic
927227286 2:20780911-20780933 TTGCCAGGACTGGGAGTGGCAGG - Intronic
928688540 2:33775426-33775448 GGACCTGCACTTGGAGTGGCCGG + Intergenic
928947096 2:36781382-36781404 ATCCCTGGCCTGTGAGTGGCTGG - Intronic
929783450 2:44972616-44972638 GGCCCTGGACTGGGCTGGGCTGG - Intergenic
931473556 2:62564832-62564854 GACCTTGGAGTGGGAGAGGTGGG + Intergenic
931757755 2:65389004-65389026 GATTCTGTACTGGGAGGGGCAGG + Intronic
932402365 2:71489724-71489746 GGCTCTGTACTGGGAGGGGCAGG + Intronic
932794336 2:74681581-74681603 GTCCCTGGACTGGTAGCTGCTGG + Exonic
933463429 2:82619472-82619494 AACTCTGGCCTGGCAGTGGCAGG - Intergenic
934562082 2:95318579-95318601 GAGCCTGGAGTGGAACTGGCTGG - Intronic
934657540 2:96123912-96123934 TTCCCTGGACAGGGACTGGCTGG + Exonic
934770563 2:96905106-96905128 GACCCTGGGGTGGGGGTGGGGGG + Intronic
935130613 2:100258380-100258402 GAGCCAGGAGTGGGAGGGGCAGG - Intergenic
935922535 2:108031643-108031665 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
936078382 2:109416220-109416242 CAACCTGGGCTGGGCGTGGCTGG - Intronic
936082879 2:109446838-109446860 GCCCCTGGGCTGTGCGTGGCTGG - Intronic
936470536 2:112794983-112795005 GGCCTCAGACTGGGAGTGGCAGG + Intergenic
937123248 2:119455284-119455306 GACACTGGACTGGAAGTGTTGGG - Intronic
937447880 2:121974243-121974265 GACCCTGAACTGGGAGTCCTAGG + Intergenic
937596828 2:123683852-123683874 GACCCTGCACTCGGAGCAGCCGG + Intergenic
939275228 2:139990981-139991003 GACCCCGCCCTGGGAGCGGCCGG - Intergenic
939886448 2:147686529-147686551 GGCCCTGCACTGGGAGCGGCCGG - Intergenic
941878623 2:170459906-170459928 GGCCCTGCACTGGAAGCGGCTGG - Intronic
943922669 2:193729468-193729490 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
944630674 2:201620637-201620659 GACATTGGACAGGGAGTTGCTGG + Exonic
945664242 2:212721349-212721371 GGCCCTGCACTTAGAGTGGCAGG - Intergenic
946024409 2:216663318-216663340 GACCTTGGAGTGGGAATGCCTGG + Intronic
946180487 2:217946054-217946076 GAGCTTGGACTGGAAGTAGCAGG - Intronic
946396405 2:219445730-219445752 GGCCATGGGCTGGGGGTGGCAGG + Intronic
946410127 2:219511590-219511612 GACCCTGGACTGGGAGTGCCGGG - Intergenic
947197018 2:227578508-227578530 GAACATGGAATGGGAGTGGGAGG - Intergenic
1168869879 20:1118993-1119015 GACCCTGCACTGGGAGAAGCGGG - Intronic
1169009338 20:2237360-2237382 GAGCCTGGAGTGAGAGTGGGTGG - Intergenic
1170634628 20:18093581-18093603 TCCCCTGGGCTGGGAGTGCCTGG - Intergenic
1171186656 20:23128002-23128024 GACACTGGGCAGGGAGAGGCAGG + Intergenic
1172056169 20:32155634-32155656 CACACTGGACTGGGGCTGGCAGG - Intronic
1172177360 20:32980445-32980467 GGACCTGGACTGGGGGTGGGTGG + Intergenic
1172211153 20:33199481-33199503 CAGCCTGGACTGGGGGTGGTTGG - Intergenic
1172221929 20:33280127-33280149 AACCAGGGGCTGGGAGTGGCTGG - Intronic
1172284409 20:33731140-33731162 GAGGCTGGGCTAGGAGTGGCTGG + Intergenic
1172782810 20:37447342-37447364 GGCCCTGGGCTGGAAGTGGGAGG - Intergenic
1173775364 20:45701935-45701957 GACCCTGGAGTGGGTGTGATTGG + Intronic
1173778745 20:45735976-45735998 GGCCCTGCACTTGGAGTGGCCGG + Intergenic
1173930040 20:46811006-46811028 AGCCCTGGACTGGGAGTCACTGG + Intergenic
1174353685 20:49984658-49984680 GACCCGGGAGAGGGTGTGGCCGG - Intronic
1175505999 20:59484508-59484530 GACCCTGGTCTGGGATTGGTGGG + Intergenic
1175814471 20:61876332-61876354 GCCCCTGCACTGGGACTGGACGG - Intronic
1175829123 20:61952432-61952454 GACCCTGGCCTGGGGCAGGCAGG + Intergenic
1175903123 20:62367633-62367655 GCCCCTGGGCTGGGAGGAGCTGG - Intergenic
1175953253 20:62594879-62594901 GACCCTGGACTAGGAAAGGGTGG - Intergenic
1176191778 20:63814582-63814604 GACCCTTGCCTGGGGGTGGGAGG - Intronic
1176270715 20:64234586-64234608 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176270724 20:64234610-64234632 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176270733 20:64234634-64234656 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176270748 20:64234682-64234704 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176270798 20:64234845-64234867 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176270950 20:64235320-64235342 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176271047 20:64235627-64235649 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176271114 20:64235843-64235865 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176271147 20:64235939-64235961 GACCCTGGGCTGGACGTGGTGGG + Intronic
1176271190 20:64236059-64236081 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176271208 20:64236107-64236129 GACCCTGGGCTGGCTGTGGTGGG + Intronic
1176271224 20:64236155-64236177 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176271242 20:64236203-64236225 GACCCTGGGCTGGCTGTGGTGGG + Intronic
1176271313 20:64236395-64236417 GACCCTGGGCTGGCCGTGGTGGG + Intronic
1176365775 21:6032011-6032033 GACCCTGGACTGGCACTCGAAGG - Intergenic
1177549076 21:22597880-22597902 GGCCCTGCACTCCGAGTGGCCGG + Intergenic
1178054513 21:28783835-28783857 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1179103845 21:38380742-38380764 TAACCTGGACTGGGGGTGGAGGG + Exonic
1179495638 21:41769666-41769688 GTCCCTGGTCTGGAAGTGCCAGG + Intergenic
1179502670 21:41819916-41819938 GGCGCTGGGCTGTGAGTGGCAGG + Intronic
1179757741 21:43506534-43506556 GACCCTGGACTGGCACTCGAAGG + Intergenic
1179951266 21:44710074-44710096 CACCCTGGAGTGGGGGTGGGGGG - Intronic
1179987148 21:44928200-44928222 GTCCCTGGACAGGGGGTGACAGG - Intronic
1180781215 22:18520939-18520961 GGCGCTGGCCTGGGAGTGGTGGG - Intergenic
1180995914 22:19965091-19965113 GACCCTGGACACGGATTGGAAGG + Intronic
1181053502 22:20248647-20248669 GGCCCTGGACCGTGAGTGCCTGG - Intronic
1181131921 22:20737103-20737125 GCACCTGGACTAGGAGTGACTGG + Intronic
1181164874 22:20977809-20977831 GGTGCTGGGCTGGGAGTGGCAGG + Intronic
1181238100 22:21460281-21460303 GGCGCTGGCCTGGGAGTGGTGGG - Intergenic
1181514214 22:23402147-23402169 GCCCTTGGACTGGGAGGGGGCGG + Intergenic
1181728566 22:24828176-24828198 GACCCAGTACTGGGTGGGGCTGG + Intronic
1182959564 22:34459364-34459386 GACCCAGTACTGTGAGTGGCTGG - Intergenic
1183352812 22:37343440-37343462 CAGCCTGGAGTGGGAGAGGCGGG - Intergenic
1183475739 22:38034851-38034873 GGCCCAGGGCTGGGAGTGGTGGG + Intronic
1184069330 22:42138361-42138383 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1184246970 22:43240752-43240774 GCTCCTGGATTGGGAGTGGGAGG - Intronic
1184263319 22:43332382-43332404 GACCTGGGAATGGGAGGGGCTGG - Intronic
1184783391 22:46660083-46660105 GATCCTGGAGTGGGGCTGGCGGG - Intronic
1184860078 22:47168630-47168652 GACCCTGAGCTCTGAGTGGCTGG - Intronic
949839565 3:8305327-8305349 AAACCTGGATTGGGAGAGGCTGG + Intergenic
950256981 3:11513524-11513546 GGCCCCGCACTGGGAGCGGCCGG - Intronic
950601208 3:14037277-14037299 GGCCCTGCACTCAGAGTGGCCGG + Intronic
951146600 3:19234522-19234544 GACCCCGCACTCGGATTGGCCGG - Intronic
951359336 3:21705884-21705906 GAGCTTGGTGTGGGAGTGGCAGG - Intronic
952255897 3:31695473-31695495 GACTCTATACTGGGAGTGGAGGG - Intronic
952889146 3:38029494-38029516 GACCCTGCACGGTGAGTGCCTGG - Intronic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
953308532 3:41853753-41853775 GACCATGGACTGGTTCTGGCCGG + Intronic
953359430 3:42281802-42281824 GACCATGGACTGGTTCTGGCTGG + Intergenic
953411647 3:42693582-42693604 GACCTGGGGCTGGGACTGGCTGG - Intronic
953573637 3:44095034-44095056 GGCTCTTGACTGGGGGTGGCTGG + Intergenic
953926581 3:46985701-46985723 GACCCTGGAGAGGGCTTGGCAGG + Intronic
954369560 3:50163081-50163103 GTCCCAGGACTGAGAGTGGAGGG + Intronic
954576044 3:51676893-51676915 GACCCAGGACTGGGATGGGCAGG - Intronic
954756456 3:52843031-52843053 TAACCTGGAATGGGAGTGGGCGG - Intronic
956563619 3:70611935-70611957 GGCCCTGCACTCGGAGTGGCTGG + Intergenic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
956675829 3:71731052-71731074 GAGTGAGGACTGGGAGTGGCTGG - Intronic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
958691255 3:97469938-97469960 GACTCTGGACTTGGAGTTGTAGG + Intronic
958838218 3:99171582-99171604 AACCCTGGTCAGGGGGTGGCTGG - Intergenic
959532652 3:107451342-107451364 GTCTTTGGACTGGGAGTGGAGGG - Intergenic
959651545 3:108755817-108755839 CACACTGCACTGGCAGTGGCAGG + Exonic
960199422 3:114812935-114812957 GACCCCGCACTCGGAGCGGCCGG - Intronic
961046457 3:123711972-123711994 GAACCTGGATGGGGAGAGGCTGG + Intronic
961326326 3:126111546-126111568 GACCCTCAACACGGAGTGGCTGG - Intronic
961365322 3:126395798-126395820 GACCCTCGGGTGGGAGAGGCAGG + Intronic
961495262 3:127286970-127286992 GGCCCTGGGATGGGTGTGGCTGG + Intergenic
961723207 3:128909426-128909448 GACCCAGGCCTGGGAGGGCCTGG - Intronic
961932336 3:130547341-130547363 GCCCCCGCACTTGGAGTGGCTGG - Intergenic
962608314 3:137050859-137050881 GAACCTGGGCTGGGCTTGGCAGG - Intergenic
962998120 3:140651503-140651525 GGCCCTGCACTGGGAGCAGCCGG + Intergenic
963589995 3:147245847-147245869 GACCCCGCACTCGGAGCGGCCGG - Intergenic
966182045 3:177197081-177197103 GACCCTGGAGTGGGGGCGGCCGG - Intronic
967035460 3:185645810-185645832 GACCTTGGGGTGGGAGTGGAGGG - Intronic
967234119 3:187367850-187367872 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
968957623 4:3727209-3727231 CACCCTGCACTGGGAGCTGCTGG + Intergenic
969431147 4:7155024-7155046 GAGCCTGCTCTGGGAGCGGCTGG - Intergenic
969448199 4:7257358-7257380 GACCCAGGCCTGGGGGTGGTGGG + Intronic
969506488 4:7591339-7591361 GTCCCAGGGCTGGGAGGGGCTGG + Intronic
970033299 4:11702195-11702217 GGCCCAGGACTGGGCCTGGCAGG - Intergenic
970051312 4:11918050-11918072 GATCCTGCACTGGGACTGGCAGG - Intergenic
971563547 4:28112859-28112881 GGCGCCGCACTGGGAGTGGCTGG + Intergenic
972360961 4:38325197-38325219 GGCCCTGCACTCGGAGCGGCTGG - Intergenic
973144272 4:46805073-46805095 GGTCCTGCACTCGGAGTGGCTGG - Intronic
973146297 4:46831118-46831140 GGCCCCGCATTGGGAGTGGCCGG + Intronic
974391274 4:61272931-61272953 GATCCTAGACTCAGAGTGGCTGG + Intronic
974765900 4:66345473-66345495 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
974877500 4:67716745-67716767 GACCATGAACTTGGAGTGGGTGG - Intergenic
974892311 4:67896842-67896864 GGGCCTGCACTTGGAGTGGCCGG - Intergenic
975298802 4:72765978-72766000 GACCCTGCACTGGGAGCAGCGGG + Intergenic
977883580 4:102234418-102234440 GGCCCTGCACTCAGAGTGGCTGG + Intergenic
979033242 4:115678758-115678780 GGCCCTGCACTTGGAGAGGCCGG - Intergenic
979299673 4:119073002-119073024 GACCCAGCAGTGGGATTGGCTGG - Intergenic
979949525 4:126874719-126874741 GGCCCTGCACTCGGAGTGGCTGG - Intergenic
980457616 4:133066031-133066053 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
981779549 4:148411443-148411465 GACCCTGGAGAGGGAGGGACAGG - Intronic
982678958 4:158407399-158407421 GGCCCTGGACTTGGAGAAGCTGG + Intronic
982700704 4:158657570-158657592 GGCCCTGAACTAGGAGTGGCCGG + Intergenic
982921248 4:161277322-161277344 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
982985743 4:162203667-162203689 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
985485438 5:146021-146043 GACCATGGAAGGGGAGTGGAAGG - Intronic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
985810022 5:2075866-2075888 GACCCTGGCCTGGGAGGAGGTGG + Intergenic
986547330 5:8912576-8912598 GTCAGTGGACTGGGAGAGGCTGG - Intergenic
986776214 5:11016529-11016551 GTCCCTGGCCAGTGAGTGGCCGG + Intronic
986919012 5:12661986-12662008 GGCCCTGCACTTGGAGTGGGCGG + Intergenic
987165190 5:15190670-15190692 GAGCCTGGACTCAGAGTGGACGG + Intergenic
988692657 5:33588343-33588365 GATCCTGTACTGGGAGTGGGGGG + Intronic
991970124 5:72132916-72132938 GAACCTGGACAGGGAGTTTCAGG - Intronic
992050345 5:72935318-72935340 GGCCCTGCACTCAGAGTGGCTGG + Intergenic
992641877 5:78774781-78774803 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
993634848 5:90331433-90331455 AACCCAGTACTGGGAGTGGTGGG + Intergenic
994087063 5:95770659-95770681 GACCCTGGAATGGGTGCGGTAGG + Intronic
994149490 5:96432139-96432161 GACCCTGCAGTGGGACTGGCCGG + Intronic
995032303 5:107494325-107494347 GGCCCTGCACTGGGAGCAGCCGG + Intronic
997301534 5:132809776-132809798 GACCCTGGGGAGGTAGTGGCAGG - Intergenic
997626012 5:135330974-135330996 CCCCCAGGACTGGGAGGGGCAGG + Intronic
997730510 5:136169343-136169365 GTCAGTGGACTGGGAGAGGCAGG - Intronic
997779895 5:136646121-136646143 GGCCCTGGACTTGGAATAGCAGG + Intergenic
998266446 5:140671066-140671088 GACCCTGGGCTGGGAGCGGGAGG + Exonic
998277900 5:140776127-140776149 GACACTGAACTGGGGGTAGCGGG - Intergenic
998506493 5:142676557-142676579 AACCCTGGAATGGGACTGTCTGG - Intronic
999742682 5:154568540-154568562 GAGGCTGGACTGGGGGTGGGAGG + Intergenic
1001171177 5:169420154-169420176 CACCTTGGGCTGGGAGTGGAGGG + Intergenic
1001415559 5:171542844-171542866 GCCCCTGGCCTGGGAAGGGCTGG + Intergenic
1001704044 5:173729050-173729072 CACCCCGGAGTAGGAGTGGCAGG - Intergenic
1002315564 5:178341091-178341113 GGCACTGGACAGGGAGTGGGGGG - Intronic
1002532783 5:179858667-179858689 GACAGCGGACGGGGAGTGGCGGG - Intronic
1002774217 6:315014-315036 GCCTCTGGTCAGGGAGTGGCTGG + Intronic
1003142509 6:3483140-3483162 GTCCCTGGAATGTGAGAGGCAGG - Intergenic
1003213734 6:4090222-4090244 GGCCCTGCACTGGGAGCTGCAGG + Intronic
1003290976 6:4777217-4777239 GCCCCTGGTCGGGGGGTGGCGGG + Intronic
1004234247 6:13860214-13860236 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
1004511630 6:16288334-16288356 GGCCCTGCACTCGGAGCGGCCGG + Intronic
1005111611 6:22288205-22288227 GTCCCTGGGCTGGGAGGTGCCGG + Intronic
1005281297 6:24277343-24277365 GACGCTGGGGTGGGAATGGCTGG - Intronic
1005308239 6:24534117-24534139 GACCCTTGACTGTGACTGGCAGG + Exonic
1005819078 6:29582333-29582355 ACCCCAGGAATGGGAGTGGCTGG - Intronic
1005981812 6:30842428-30842450 GACCATGGACTGGTTCTGGCTGG + Intergenic
1006117753 6:31784351-31784373 GATCCTGGGCTGGGAGTGGCAGG - Intronic
1006265641 6:32920115-32920137 GACAAGAGACTGGGAGTGGCTGG + Intergenic
1006337037 6:33426231-33426253 GACCAGGGGCTGGGAGGGGCAGG - Intronic
1006434148 6:34017462-34017484 GACCCCGCACTGGGAGCCGCCGG - Intergenic
1006951561 6:37826016-37826038 CACCCAGGCCTGGGACTGGCAGG + Intronic
1007115633 6:39341205-39341227 GCCAGGGGACTGGGAGTGGCTGG - Intronic
1007304695 6:40894742-40894764 GTCCCTGGGCTGGGAGTTCCTGG + Intergenic
1007703029 6:43775296-43775318 GTCTCTGGTCTGGGAGAGGCAGG + Intronic
1007975644 6:46098675-46098697 CAGCCTGGACAGGGAGTGGAAGG + Intergenic
1008862034 6:56160409-56160431 GACCCTGGAGTGGAACTGGTTGG - Intronic
1010277962 6:73990910-73990932 GGCCCAGCACTGGGAGCGGCTGG - Intergenic
1011246506 6:85326059-85326081 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1011620107 6:89234726-89234748 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1012872439 6:104688039-104688061 GACTCTGGGGTGGGAGGGGCAGG - Intergenic
1013080215 6:106805845-106805867 GACCCTGCACTCGGAGCGGCCGG + Intergenic
1013694820 6:112689603-112689625 GACCCCGCACTAGGAGCGGCCGG - Intergenic
1014738980 6:125125933-125125955 GGCCCTGCACTCGGAGTGGCCGG + Intronic
1014896299 6:126904097-126904119 GACCCTGGAAAGGGAGTTTCAGG - Intergenic
1015803718 6:137087767-137087789 GACCCTGGGCTTGGAGTTGGGGG + Intergenic
1016896986 6:149063116-149063138 GTCCCTGGGGAGGGAGTGGCAGG - Intronic
1017590479 6:155973920-155973942 AAGCTTGGACTGGGAGTGGAAGG + Intergenic
1017879459 6:158549766-158549788 GAGGTTGGACTGGCAGTGGCTGG + Intronic
1017907916 6:158769531-158769553 GGCCATGGAGTGGGGGTGGCGGG - Intronic
1018046214 6:159968955-159968977 GACCCGGGCCTGGGAGGAGCCGG + Intergenic
1018383902 6:163285364-163285386 TAGCCTGGACTGGGGCTGGCGGG - Intronic
1018901501 6:168054062-168054084 GGCCCTGGGCAGGGTGTGGCCGG - Intergenic
1019019554 6:168906616-168906638 GACCATGGACTGGTTCTGGCTGG - Intergenic
1019319447 7:409013-409035 GACCCTGGAAGGGGTGTGGGAGG - Intergenic
1020784456 7:12556438-12556460 GGCCCTGCACTTGGAGCGGCGGG - Intergenic
1021513830 7:21461525-21461547 GGCCCTGCACTTGGAGCGGCTGG - Intronic
1022237474 7:28475873-28475895 CACCCTGGGCTTGGAGGGGCTGG - Intronic
1023038458 7:36153063-36153085 GGGCCTGGAGTGGGAGAGGCGGG - Intergenic
1023377975 7:39577492-39577514 GGCCCTGCACTTGGAGTGGCCGG + Intronic
1024443838 7:49453775-49453797 GGCCCCGCACTCGGAGTGGCCGG + Intergenic
1024986055 7:55194120-55194142 GTGCCTGGAGTGGGAGGGGCGGG - Intronic
1025853877 7:65262281-65262303 GACCCTGGTCTGGGTGTCTCAGG - Intergenic
1026574175 7:71558111-71558133 GTCTCTGGACTGGGAGAGACTGG - Intronic
1026894026 7:73999792-73999814 CACCCTGGACTGGGTAGGGCGGG - Intergenic
1027200735 7:76062495-76062517 GAGCCTGGTCTGGGAGAGGGAGG - Intronic
1027267849 7:76503951-76503973 AACCTTGGGTTGGGAGTGGCAGG + Intronic
1027319660 7:77003813-77003835 AACCTTGGGTTGGGAGTGGCAGG + Intergenic
1027778943 7:82499693-82499715 GGCCCTGCACTGGGAGTGACCGG + Intergenic
1028142484 7:87288804-87288826 GGCCCTGCACTGGGAGCGGCAGG + Intergenic
1028482794 7:91326067-91326089 GACCCATGAGTGGGAGTGGAAGG + Intergenic
1028912971 7:96228787-96228809 GGCCCTGCACTCGGAGTGGATGG + Intronic
1029037901 7:97541290-97541312 GGCCCTGCACTCAGAGTGGCTGG + Intergenic
1029407073 7:100381808-100381830 GGCCCCGCACTCGGAGTGGCCGG + Intronic
1030121125 7:106112002-106112024 GCCCCGGGACTGGGAGTGGACGG - Intronic
1030215739 7:107042598-107042620 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1030367033 7:108657497-108657519 GACCCCGCACTCGGAGCGGCCGG - Intergenic
1032804017 7:135338369-135338391 GACCATGGACTGGTTCTGGCCGG + Intergenic
1032971959 7:137174852-137174874 GACAGTGGACTGGGGGTGGGGGG + Intergenic
1034651844 7:152697538-152697560 GATCCTGCACTGGGGCTGGCAGG - Intergenic
1034967126 7:155398429-155398451 GACTCCGCACTTGGAGTGGCTGG - Intergenic
1035027509 7:155835684-155835706 GAGCCTGGACTGGAAGTGACTGG - Intergenic
1035084707 7:156248114-156248136 ACCCATGGACTGGGAGTGGTGGG + Intergenic
1035845635 8:2861440-2861462 GACACTGGACTGGAATCGGCTGG + Intergenic
1036705617 8:11044138-11044160 GACCGTGGACTGGTTCTGGCTGG + Intronic
1037818575 8:22124814-22124836 GAACCCAGGCTGGGAGTGGCAGG + Intronic
1038345110 8:26725414-26725436 GACCCAGGACTCGGAGAGCCAGG - Intergenic
1038477625 8:27879299-27879321 GACACAGGACTGGGAAGGGCTGG + Intronic
1039263129 8:35794799-35794821 GACCCTGGAGTGGGGATGTCAGG - Intronic
1039521633 8:38176738-38176760 GGCCCGGGCCTGGGATTGGCTGG + Exonic
1039834901 8:41248519-41248541 GTCCGTGGACTGGCTGTGGCTGG - Intergenic
1040014434 8:42689573-42689595 GACCCCGCACTGGGAGCGGCCGG + Intergenic
1040275891 8:46013484-46013506 GACCCTGCACTGGGCCTGGGAGG - Intergenic
1040952872 8:52953893-52953915 GGCCCTGCACTCGGAGCGGCCGG + Intergenic
1040964602 8:53071418-53071440 GGCCCTGCACTTGGAGCGGCTGG - Intergenic
1041552022 8:59113705-59113727 GTCCCAGGAGTTGGAGTGGCTGG + Intronic
1041588352 8:59547177-59547199 GGCCCTGCACTTGGAGCGGCTGG + Intergenic
1042480296 8:69295130-69295152 GACCCAGGTCTGAGAGTTGCAGG + Intergenic
1043412665 8:80014814-80014836 TCCCCTGGAGTGGGGGTGGCAGG - Intronic
1043730182 8:83668278-83668300 GACGCTGCCCTGGGAGTGACTGG - Intergenic
1044088470 8:87971227-87971249 GGCCCCGCACTCGGAGTGGCTGG + Intergenic
1044404876 8:91816443-91816465 GACCCCGCACTCGGAGTGGCCGG + Intergenic
1044853565 8:96452412-96452434 GACCCAGCACTCGGAGCGGCCGG + Intergenic
1045678430 8:104633165-104633187 GGCCCAGCACTGGGAGCGGCCGG - Intronic
1047195512 8:122717706-122717728 GACACTGGACTCAGAGTGCCTGG + Intergenic
1048329999 8:133464809-133464831 GACCATCGACTTGGAGTGGGTGG - Exonic
1048973976 8:139661101-139661123 GACTTTGGCCTGGGAGTGGCTGG - Intronic
1049101592 8:140583259-140583281 GACCCTGGAGTGTCAGTAGCGGG - Intronic
1049256020 8:141614359-141614381 GCCCCTGGGCTGGGGGTGGAGGG - Intergenic
1049482133 8:142830867-142830889 GACACTGGAGTGGGAGTGGTGGG - Intergenic
1049557521 8:143290544-143290566 GACCCTGGACTGGGGCGGGAGGG - Intronic
1049645774 8:143734981-143735003 GTCCTTGGGGTGGGAGTGGCAGG - Intergenic
1049777862 8:144414756-144414778 GGGCCTGGACTGGGAGGTGCAGG + Exonic
1051792719 9:20826198-20826220 GTCAGTGGACTGGGAGAGGCAGG + Intronic
1052576556 9:30299347-30299369 GACCCTGCACTCAGAGCGGCCGG + Intergenic
1054851878 9:69854791-69854813 GACCATGGTTTGGCAGTGGCTGG + Intronic
1055248614 9:74276211-74276233 GGCCCTGCACTCGGAGGGGCCGG - Intergenic
1055461471 9:76523972-76523994 GACCCCGCACTTGGAGGGGCCGG - Intergenic
1055651353 9:78410077-78410099 GGCCCCGCACTGGGAGTGGCCGG + Intergenic
1055654914 9:78442150-78442172 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1055795963 9:79975245-79975267 GTTCCTGGGCAGGGAGTGGCGGG + Intergenic
1055814185 9:80185577-80185599 GGCCCTGCACTTGGAGAGGCCGG - Intergenic
1056733993 9:89189387-89189409 GAGCCTGGAGTCAGAGTGGCTGG - Intergenic
1056867061 9:90237351-90237373 GACCATGGACTGGCCCTGGCTGG + Intergenic
1057868812 9:98702425-98702447 GAGCCTGGAGTCGGAGGGGCTGG - Intronic
1058743291 9:107965755-107965777 GGCCCTGGATTGGGACTGGCTGG - Intergenic
1060354435 9:122891658-122891680 GAGCGTGGACTGAGAGTGTCAGG - Intronic
1061413018 9:130431219-130431241 GAACCTGGGCTGGGAGGGGCAGG + Intronic
1061866323 9:133493439-133493461 GACTCTGGAATGGAAGTGCCAGG - Intergenic
1062165594 9:135105809-135105831 GACCCTGGATGGGAAGTGGGTGG - Intronic
1062463777 9:136672450-136672472 GACCCTGGCATGGGATGGGCTGG + Exonic
1062469810 9:136697300-136697322 GACTCTGGACTGGGAGCGTCAGG + Intergenic
1188769362 X:34132355-34132377 GAACCTGGGCTGCGCGTGGCTGG - Intergenic
1188834694 X:34942733-34942755 GAACCTGGGCTGCGTGTGGCTGG + Intergenic
1189007074 X:37008312-37008334 GAACCTGGGCTGCGCGTGGCTGG + Intergenic
1190739645 X:53280659-53280681 GACCCTGCACTAGGGGTGGTGGG - Intronic
1191104431 X:56763874-56763896 GGCCCTGGAGTTGAAGTGGCAGG + Intergenic
1191162053 X:57340312-57340334 GTCAGTGGACTGGGAGAGGCAGG - Intronic
1191226740 X:58052095-58052117 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
1192194401 X:69018778-69018800 GCCCCTGTAGTGGGGGTGGCGGG - Intergenic
1193720047 X:84975238-84975260 GCCCGTGGAGTGGGACTGGCGGG + Intergenic
1195618366 X:106930349-106930371 TACCCTGGAGTGGGAGTGAGGGG + Exonic
1195691304 X:107628260-107628282 GACGTTGGACTGGGGGTGGAGGG - Intergenic
1197372656 X:125643821-125643843 GATCCTGGACTGGGACTGCTTGG + Intergenic
1197618178 X:128717747-128717769 GACCATGGACTGGTTCTGGCTGG - Intergenic
1198060895 X:133044456-133044478 GGCCCTGCACTCAGAGTGGCTGG + Intronic
1198307703 X:135399262-135399284 GACCATGGACTGGCTCTGGCTGG - Intergenic
1199251496 X:145667734-145667756 GAACCTGTACTGGGACTGTCTGG - Intergenic
1199831799 X:151555432-151555454 GGCCCTGCACTCGGAGCGGCCGG - Intergenic
1199990274 X:152983835-152983857 CACCCTGCCATGGGAGTGGCTGG + Intergenic
1200033364 X:153313309-153313331 CACCCTGCCATGGGAGTGGCTGG + Intergenic
1200054940 X:153455400-153455422 GACCAGGGGCTGGGAGGGGCTGG - Intronic
1200424433 Y:3005867-3005889 GACCTATGATTGGGAGTGGCCGG - Intergenic
1201487051 Y:14505730-14505752 GGCCCAGCACTGGCAGTGGCCGG + Intergenic