ID: 985545343

View in Genome Browser
Species Human (GRCh38)
Location 5:506287-506309
Sequence CACACGAAAGGGGCCCGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985545338_985545343 2 Left 985545338 5:506262-506284 CCCAGAGAGGACAAAGGTGGAAA 0: 1
1: 0
2: 6
3: 29
4: 399
Right 985545343 5:506287-506309 CACACGAAAGGGGCCCGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 65
985545339_985545343 1 Left 985545339 5:506263-506285 CCAGAGAGGACAAAGGTGGAAAG 0: 1
1: 1
2: 2
3: 33
4: 306
Right 985545343 5:506287-506309 CACACGAAAGGGGCCCGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 65
985545336_985545343 5 Left 985545336 5:506259-506281 CCACCCAGAGAGGACAAAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 212
Right 985545343 5:506287-506309 CACACGAAAGGGGCCCGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985545343 Original CRISPR CACACGAAAGGGGCCCGAGA CGG Intronic
900181327 1:1312254-1312276 CACACGCAAGGAGCAGGAGACGG - Exonic
903103085 1:21050519-21050541 CACCCGAAAGGGGTGCGAGACGG + Intronic
903545936 1:24123428-24123450 GAAACCAAAGGGGCCAGAGAAGG + Intronic
906380071 1:45327098-45327120 CACAAGTAAGCGGCCCCAGAAGG + Exonic
913083516 1:115412653-115412675 CAAAGGAAAGGGCCCCAAGAAGG + Intergenic
913119527 1:115726979-115727001 AACACCAAAGGTGCCTGAGATGG - Exonic
1062950161 10:1492968-1492990 CACACGAAATGCTCCCAAGAAGG + Intronic
1065006809 10:21387772-21387794 CAGAAGAAGGGGGCCCGAGAGGG - Intergenic
1075871144 10:125773544-125773566 CACAGGCAGGGGGCCCGAGTGGG + Intronic
1084898529 11:72293163-72293185 CACAACAAAGGGGCCAGAGTAGG + Exonic
1098606486 12:72396836-72396858 CACAGGAAAGGAGTCTGAGAAGG - Intronic
1100853502 12:98738086-98738108 CACACGAGAGGGGCAGAAGAAGG + Intronic
1103907892 12:124336671-124336693 CACGATAAAGGGGCGCGAGAAGG - Intronic
1105823191 13:24098044-24098066 CACATGAAAATGGCCCTAGAAGG + Intronic
1106790796 13:33153369-33153391 CACAGGAAAAGAGCCAGAGAGGG + Intronic
1121073417 14:91045848-91045870 CACAGGAAATGGGGCTGAGAAGG - Intronic
1122400582 14:101465073-101465095 CCCATGCAAGGGGCCCCAGAGGG - Intergenic
1122892494 14:104739253-104739275 CACACGTGAGGGGCCAGAGCTGG - Intronic
1125008827 15:34848214-34848236 CATCCAAAAGGGGCCAGAGAAGG + Intergenic
1132808912 16:1788382-1788404 CACCCGAGAGGGCCCTGAGAAGG - Intronic
1135921039 16:26649237-26649259 CACACCAATGGGGCTTGAGAAGG - Intergenic
1136574010 16:31112565-31112587 CCCACACACGGGGCCCGAGAGGG - Exonic
1139691821 16:68646144-68646166 TTCACAAAGGGGGCCCGAGAGGG - Intronic
1141962968 16:87421604-87421626 CCCCCGAAAAGGGGCCGAGAGGG + Intronic
1143030619 17:3965057-3965079 CTCCCCAGAGGGGCCCGAGAGGG + Intergenic
1150725767 17:67650089-67650111 CACAGGTGAGGGGCCCTAGATGG - Intronic
1152551003 17:81030188-81030210 CACACAGAAGGGGCACGAGCTGG + Intergenic
1155384398 18:25261431-25261453 CACATTAAAGGGGCCTAAGAAGG + Intronic
1160144951 18:76356172-76356194 CTCATCAAAGAGGCCCGAGAGGG + Intergenic
1164404629 19:27933592-27933614 AACACAAAAGGGCCCTGAGAAGG - Intergenic
1165332607 19:35149320-35149342 CACACGCAAAGGTCCTGAGATGG - Intronic
927642457 2:24853987-24854009 AACACCAAAGGGGCCTGAAATGG - Intronic
936720562 2:115247511-115247533 CCCATGAAAGGAGCCCTAGAGGG + Intronic
937721305 2:125100001-125100023 CACTTGGAAGGGGCCCAAGAGGG - Intergenic
939299895 2:140322016-140322038 CACACACAAGTGGCCCCAGAAGG + Exonic
941697688 2:168571024-168571046 CATAAGGAAGGGGCCCTAGAAGG - Intronic
943221568 2:185114721-185114743 CACAGGATAGGGTCCTGAGAAGG - Intergenic
945241281 2:207679265-207679287 CTCATGAAAGAGGCCCCAGAGGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
945977923 2:216285042-216285064 CCCACGAGAGGAGCCCCAGAAGG + Intronic
947282309 2:228469241-228469263 CACTTGAAAGAGGGCCGAGAGGG + Intergenic
947536457 2:230942838-230942860 GACACGGAAGGGGCAGGAGAAGG + Intronic
947808268 2:232983201-232983223 AACAGGAAAGGGGCTGGAGAAGG + Intronic
948874783 2:240820591-240820613 CACTCGAAAGGGGCCAGGGTGGG - Intergenic
948949675 2:241240817-241240839 CCCACGCAGGGGCCCCGAGAAGG + Intronic
1176113870 20:63422666-63422688 GACGAGAGAGGGGCCCGAGAAGG + Intronic
1179655369 21:42841499-42841521 CAGAGGAGAGGGGCCCCAGACGG - Intergenic
962412150 3:135150666-135150688 AACACTAAAGAGGCCTGAGAAGG - Intronic
985545343 5:506287-506309 CACACGAAAGGGGCCCGAGACGG + Intronic
988231389 5:28484023-28484045 CACACGATAGGGGCCGGGGCGGG + Intergenic
990195458 5:53310210-53310232 CACATGTAAGGGGCCCCAGGTGG + Intergenic
990618379 5:57531306-57531328 CACCCCAAAGGGGCACGGGAGGG + Intergenic
998093226 5:139382893-139382915 CACAGGAGAGGGGGCCAAGAGGG + Intronic
1002415704 5:179119844-179119866 GTCAGGAAAAGGGCCCGAGATGG - Intronic
1012866398 6:104623287-104623309 CAAACGAAAGGGGGCAGGGAGGG + Intergenic
1015856509 6:137630658-137630680 CACACCTAAGGGGTCAGAGATGG - Intergenic
1018867859 6:167759539-167759561 CCCAGGAAAGGGGGCTGAGAAGG + Intergenic
1019499773 7:1359049-1359071 CACATAAAGGGGGCCCAAGAGGG - Intergenic
1020091524 7:5344837-5344859 CCCACGAGAGGGTCCCAAGAAGG + Intronic
1027134138 7:75612147-75612169 CCCAGGCAAGGGGCCAGAGAAGG + Intronic
1032419219 7:131764534-131764556 CTCAGGAAATGGGCCCCAGAGGG - Intergenic
1040072219 8:43197831-43197853 CATACGAAAGGGACCTGGGAGGG - Exonic
1040485493 8:47867248-47867270 AACAAGAGAAGGGCCCGAGATGG + Intronic
1041348657 8:56927365-56927387 GACAGGAGATGGGCCCGAGAGGG - Intergenic
1042591425 8:70402593-70402615 CACCCCCCAGGGGCCCGAGAGGG + Intronic
1047746179 8:127846664-127846686 CACAGGAAAGGGGCCCCAAATGG + Intergenic
1051338786 9:16092365-16092387 CACACTAAAGGTGCCTGAGGGGG - Intergenic
1059320376 9:113464001-113464023 CAGGAGAAAGGGGCCAGAGAAGG - Intronic
1061366160 9:130173178-130173200 CACACGAACGGGGCCAGGGAGGG - Intronic
1192313397 X:70034291-70034313 CACATGAGAGCGGCCAGAGAAGG + Intronic