ID: 985545680

View in Genome Browser
Species Human (GRCh38)
Location 5:507915-507937
Sequence GATTCGGGCGTCTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 7, 1: 2, 2: 1, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985545680 Original CRISPR GATTCGGGCGTCTGTGGGGT GGG (reversed) Intronic
900135999 1:1117145-1117167 GGTTGGGGGGTCTGAGGGGTTGG - Intergenic
900136007 1:1117162-1117184 GGTTGGGGGGTCTGGGGGGTTGG - Intergenic
903832255 1:26182398-26182420 GGATCGTGAGTCTGTGGGGTGGG + Exonic
904042922 1:27594495-27594517 GTTTGGGGCCTCTTTGGGGTGGG - Intronic
908381355 1:63599654-63599676 GTTTCGGGCGCCTGTGGTCTCGG + Intronic
909871709 1:80748316-80748338 AATTGGGGCTTCTGTGGTGTTGG + Intergenic
920223941 1:204424544-204424566 GTTTGGGGAGTGTGTGGGGTGGG - Exonic
1070744132 10:78922629-78922651 GATTGGGAAGGCTGTGGGGTGGG - Intergenic
1073146601 10:101285576-101285598 GATGCGGCCGTCTCTGGAGTGGG - Intergenic
1076219474 10:128721674-128721696 AATTGGGGCTTCTGTGGGTTTGG - Intergenic
1079033045 11:16999878-16999900 AATTAGAGCTTCTGTGGGGTGGG - Intronic
1079350038 11:19684681-19684703 CACTCTGGTGTCTGTGGGGTTGG - Intronic
1088096626 11:106108135-106108157 GATTAGGGTGTCAGTAGGGTCGG + Intergenic
1090013197 11:123062709-123062731 GATTCGGACGTGGGTGGGGGAGG - Intronic
1090238368 11:125165417-125165439 GCTTCGGGCGTCCTTGGGGCCGG + Intronic
1091646895 12:2279903-2279925 GATTTGGGTATCTGTGGGGCAGG + Intronic
1092426462 12:8379458-8379480 GGTTGGGGGGACTGTGGGGTGGG + Intergenic
1107995003 13:45851009-45851031 GACTTGGACGTCGGTGGGGTGGG - Intronic
1110745493 13:79048691-79048713 GATTAGGGAGTCTGATGGGTTGG - Intergenic
1110859972 13:80337601-80337623 GGTGAGGGCGTCTCTGGGGTCGG + Exonic
1111691245 13:91565824-91565846 AATCCAGGTGTCTGTGGGGTTGG + Intronic
1113639539 13:111947310-111947332 GATGCAGGTGTCTGTGGAGTTGG - Intergenic
1113832252 13:113305234-113305256 GACTCGGGTGTGTGTGTGGTTGG + Intronic
1114357315 14:21925516-21925538 GATTGAGGTGTCTGTGGTGTTGG - Intergenic
1122631043 14:103107912-103107934 GACTGGGGCGCCTGTGGGGCTGG + Intronic
1132185377 15:99798512-99798534 GATGCCAGCGTGTGTGGGGTGGG - Intergenic
1132431640 15:101766118-101766140 GATGCCAGCGTGTGTGGGGTGGG + Intergenic
1132690578 16:1180312-1180334 GACTCGGGCTGCTGTGGGCTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1134061966 16:11204759-11204781 GAGTCAGGGGTCTGTGGGGGAGG + Intergenic
1137036915 16:35575658-35575680 CATTAGGGCCGCTGTGGGGTGGG - Intergenic
1138492417 16:57384173-57384195 GAATCTGGCGTGTGTGGGGTGGG - Exonic
1139596347 16:67960507-67960529 GATTTGGGCCTTTCTGGGGTGGG - Intronic
1143697495 17:8630953-8630975 GATTGGGGCCTCTGTGGCCTGGG - Intergenic
1145779842 17:27555217-27555239 GATTGGGGGGTATGAGGGGTAGG + Intronic
1158644483 18:59232514-59232536 GATTTGGGAGTCTCTGGGGAGGG - Intergenic
1160750843 19:733666-733688 GATGCGGGGGTATGTGGGGAGGG + Intronic
1160808833 19:1004293-1004315 GCTTCAGGCGTATGTGGAGTGGG + Intronic
1160919579 19:1513387-1513409 AATCCGGGCGTCGGCGGGGTAGG - Intronic
1161335310 19:3709722-3709744 GATTCGGGAGTCCGTGGGGGTGG + Intronic
1161571078 19:5031174-5031196 GATCCTGGGGCCTGTGGGGTTGG + Intronic
1162651567 19:12092566-12092588 GACTCCGGGGTCTGTGGGGCTGG + Intronic
1163453284 19:17391389-17391411 GATTCCGGCGTGCGTGGGGCGGG - Intergenic
1164033775 19:21435422-21435444 CATTCGGGTTTCTGAGGGGTTGG + Intronic
1164995993 19:32720557-32720579 GAGTTGGGGGTGTGTGGGGTTGG - Intronic
926202562 2:10812468-10812490 GACTCGGGCGCCCGTGGGGAGGG - Intronic
932417849 2:71584432-71584454 GATGAGGCCATCTGTGGGGTGGG - Intronic
932418121 2:71586024-71586046 GGTTTGGGGGTCTGTGGGTTTGG + Intronic
932753912 2:74391823-74391845 GCGTCGGTCGTCGGTGGGGTCGG - Intronic
936250445 2:110864399-110864421 GCTTCGGGTTTCTGTGGGCTTGG - Intronic
938435374 2:131280313-131280335 GATTTGGGGGCCTGTGGGGAAGG + Intronic
940358539 2:152771618-152771640 GATTTTGGTATCTGTGGGGTTGG - Intergenic
941570019 2:167159037-167159059 GATTCAGGCCTCAGTGGGGAGGG + Intronic
944113797 2:196165279-196165301 GATCAGGGTGTCTGCGGGGTTGG - Intronic
947436864 2:230080371-230080393 GATCCAGAGGTCTGTGGGGTTGG + Intergenic
948360439 2:237416483-237416505 GATTGGGGCCTCTGTGGATTTGG + Intergenic
948916813 2:241038689-241038711 GAGTCGGGCTTCTGTGGCATTGG + Intronic
1175731048 20:61354176-61354198 CATTTGGGCCTCTGGGGGGTGGG - Intronic
1175939020 20:62529343-62529365 GATCCCGGTGTCAGTGGGGTTGG - Intergenic
1179874815 21:44262281-44262303 GATAGGGGTGGCTGTGGGGTAGG + Intergenic
1184170417 22:42756067-42756089 GATCAGGGTGTCAGTGGGGTTGG + Intergenic
1185086148 22:48742144-48742166 GATGAGGGGGCCTGTGGGGTTGG - Intronic
952241056 3:31532301-31532323 GTTTCGCGCGCCTGTGCGGTCGG - Intergenic
952324162 3:32306084-32306106 TTTTCGTGAGTCTGTGGGGTTGG + Intronic
961598078 3:128035243-128035265 GATCAAGGTGTCTGTGGGGTTGG - Intergenic
962381006 3:134898070-134898092 GATTCCGGAGTCTGTGGGGTGGG + Intronic
966734839 3:183180179-183180201 GGATGGGGCCTCTGTGGGGTGGG + Intronic
968835940 4:2964150-2964172 GATTCGGGGTTCTCTGGGGGGGG - Intronic
970705275 4:18794135-18794157 GATTCGTGTGTGTGTGTGGTGGG - Intergenic
972684718 4:41340849-41340871 GCTTCAGGTGTCTGTGGGTTAGG + Intergenic
979534232 4:121801390-121801412 GATTCTGGTGCCTGTGGGGCCGG + Exonic
981879179 4:149588706-149588728 GATTAAGGTGTCCGTGGGGTTGG - Intergenic
983526558 4:168766096-168766118 GATTCAGGGGTGTGTTGGGTGGG - Intronic
985545588 5:507618-507640 GATTCGGGCGTCTGTGGGGCAGG - Intronic
985545608 5:507685-507707 GATTCGGGCGTCTGCGGGGTGGG - Intronic
985545622 5:507731-507753 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545630 5:507754-507776 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545638 5:507777-507799 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545646 5:507800-507822 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545660 5:507846-507868 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545680 5:507915-507937 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545694 5:507961-507983 GATTCGGGCGTCTGTGGGGTGGG - Intronic
986422092 5:7595677-7595699 GATTTGGGTATCTGTGAGGTGGG - Intronic
993884621 5:93401103-93401125 GATTCAGGAGGCTTTGGGGTGGG + Intergenic
1001449957 5:171817080-171817102 GATATGGGCTTCTGTGGGGAGGG - Intergenic
1002812140 6:640754-640776 GATGAGGGAGTCAGTGGGGTTGG - Intronic
1003223535 6:4184032-4184054 GATTAAGGGGTCAGTGGGGTTGG - Intergenic
1005479683 6:26243634-26243656 GATGCGGGCATCTGGGGGGGAGG - Intergenic
1007389955 6:41545423-41545445 GTTTCCGGCGTGTGTGGGGCGGG + Intergenic
1009431845 6:63573288-63573310 GATCCGGGCGGGCGTGGGGTAGG + Intronic
1015919557 6:138253434-138253456 GATCAAGGCGTCAGTGGGGTTGG + Intronic
1026964195 7:74429006-74429028 GATTTAGGTGTCTGTGGGTTTGG + Intergenic
1034006958 7:147483343-147483365 GATTTGGGTATCTATGGGGTGGG + Intronic
1034955159 7:155329390-155329412 GATGTGGGCGTCTGGGGGGGGGG - Intergenic
1041192604 8:55368584-55368606 GATGGGGGCGTCTGTGGGAAGGG - Intronic
1044870953 8:96619521-96619543 GGTTTGGGGGTATGTGGGGTGGG - Intergenic
1046679765 8:117155741-117155763 CAATCGGGCGTCAGTGGGGTTGG + Intronic
1049436264 8:142587537-142587559 GAGTCGGGAGGCTGTGGAGTGGG + Intergenic
1049605891 8:143529058-143529080 CATTCGGGAGTCTGTGAGGTGGG - Intronic
1049689983 8:143954092-143954114 GACTCGGGGGGCTGTGGGGTGGG - Intronic
1186216970 X:7310945-7310967 GATTTGGGCATGTGTGGGCTTGG - Intronic
1187247818 X:17568821-17568843 CACTGGGGCCTCTGTGGGGTGGG - Intronic
1190224268 X:48533534-48533556 GACGGGGGCATCTGTGGGGTGGG - Intergenic
1193636955 X:83962897-83962919 GATTGGGGCATGTGTGGGGTTGG - Intergenic
1198099731 X:133413915-133413937 GATTTTGGCGCCGGTGGGGTGGG - Intronic