ID: 985546029

View in Genome Browser
Species Human (GRCh38)
Location 5:509633-509655
Sequence CGCAAGCTTGGTTTTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985546029_985546037 9 Left 985546029 5:509633-509655 CCATTCCCAAAACCAAGCTTGCG No data
Right 985546037 5:509665-509687 TCAGTGAACTGCCAGGGACCTGG 0: 1
1: 0
2: 0
3: 20
4: 190
985546029_985546036 3 Left 985546029 5:509633-509655 CCATTCCCAAAACCAAGCTTGCG No data
Right 985546036 5:509659-509681 CCAGACTCAGTGAACTGCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 140
985546029_985546034 2 Left 985546029 5:509633-509655 CCATTCCCAAAACCAAGCTTGCG No data
Right 985546034 5:509658-509680 TCCAGACTCAGTGAACTGCCAGG 0: 1
1: 1
2: 1
3: 10
4: 172
985546029_985546038 18 Left 985546029 5:509633-509655 CCATTCCCAAAACCAAGCTTGCG No data
Right 985546038 5:509674-509696 TGCCAGGGACCTGGCACAGCAGG 0: 1
1: 0
2: 3
3: 42
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985546029 Original CRISPR CGCAAGCTTGGTTTTGGGAA TGG (reversed) Intronic