ID: 985547753

View in Genome Browser
Species Human (GRCh38)
Location 5:518641-518663
Sequence CAGGAGCCAGGGGCTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1481
Summary {0: 1, 1: 1, 2: 12, 3: 145, 4: 1322}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985547753_985547765 -1 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547765 5:518663-518685 GGAGAAGCCGGCAGTGGGGGTGG 0: 1
1: 1
2: 5
3: 66
4: 765
985547753_985547760 -7 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547760 5:518657-518679 GCTCCTGGAGAAGCCGGCAGTGG 0: 1
1: 0
2: 0
3: 38
4: 285
985547753_985547764 -4 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547764 5:518660-518682 CCTGGAGAAGCCGGCAGTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 341
985547753_985547768 9 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547768 5:518673-518695 GCAGTGGGGGTGGCCACGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 290
985547753_985547761 -6 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547761 5:518658-518680 CTCCTGGAGAAGCCGGCAGTGGG 0: 1
1: 0
2: 3
3: 14
4: 167
985547753_985547762 -5 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547762 5:518659-518681 TCCTGGAGAAGCCGGCAGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 253
985547753_985547767 8 Left 985547753 5:518641-518663 CCCAGTGCAGCCCCTGGCTCCTG 0: 1
1: 1
2: 12
3: 145
4: 1322
Right 985547767 5:518672-518694 GGCAGTGGGGGTGGCCACGCTGG 0: 1
1: 0
2: 1
3: 31
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985547753 Original CRISPR CAGGAGCCAGGGGCTGCACT GGG (reversed) Intronic
900071829 1:777648-777670 CGGGAGGCAGAGGTTGCACTGGG - Intergenic
900240620 1:1615739-1615761 CAGCAGCCCCGGGCTGGACTCGG + Intronic
900474613 1:2870270-2870292 CTGGCCCCGGGGGCTGCACTGGG - Intergenic
900505842 1:3029434-3029456 CAGGTGACAGGGGCTCCGCTGGG - Intergenic
900529977 1:3148361-3148383 CAGGAGCCAGGAGCTGCAGGAGG + Intronic
900646844 1:3712920-3712942 CAGGGGGCAGGGGCTGCTCGTGG - Intronic
900937938 1:5778796-5778818 CAGGAGCCAAGGGATGAACGTGG + Intergenic
901040843 1:6362355-6362377 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
901209061 1:7514358-7514380 CAGGAGCCAGGTGCTCCAGAAGG + Intronic
901321465 1:8342823-8342845 CAGGAGGCTGAGGCTGCAGTGGG + Intronic
901404785 1:9038785-9038807 CAGGAGCCCGGAGCTGCACCAGG - Intronic
901484700 1:9550744-9550766 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
901493089 1:9606546-9606568 CAGGAGCCGGGGGCTGCTTAAGG - Intronic
901730343 1:11274370-11274392 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
901806790 1:11743638-11743660 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
902152139 1:14452011-14452033 CAGGAGACGGAGGCTGCAGTGGG - Intergenic
902220058 1:14958940-14958962 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
902255001 1:15182834-15182856 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
902509110 1:16955964-16955986 CAGAGGTCAGGGGCTGCCCTGGG - Intronic
902691375 1:18111815-18111837 GAGGAGCCTGGGGCAGAACTAGG - Intronic
902705425 1:18200981-18201003 CATGAGACAGGGGCCACACTAGG + Intronic
903041329 1:20532906-20532928 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
903048211 1:20580422-20580444 CAGGAGGCAGAGGCTGCAGTAGG + Intergenic
903211906 1:21823402-21823424 CAAGAACCTGGTGCTGCACTCGG - Exonic
903304588 1:22403868-22403890 CTGGAGTTAGGAGCTGCACTGGG + Intergenic
903416436 1:23186537-23186559 CAGGTGCCAGGCCTTGCACTTGG - Intergenic
903733550 1:25515804-25515826 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
904062193 1:27720483-27720505 CAGGAGTTAGAGGCTGCAGTGGG - Intergenic
904088487 1:27927948-27927970 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
904176636 1:28634340-28634362 CGGGAGGCAGGGGTTGCAGTAGG + Intronic
904423921 1:30411160-30411182 CAAGACTGAGGGGCTGCACTAGG + Intergenic
904559285 1:31385943-31385965 CAGGAGTCAGTGACTGCACCTGG + Intergenic
904593315 1:31627384-31627406 CTGAAGCCCAGGGCTGCACTTGG + Intronic
904603884 1:31688683-31688705 AAGGAGCCTGGGGCAGCACAGGG + Intronic
904732176 1:32602252-32602274 CAGGAGGCAGAGGCTGCGGTGGG + Exonic
904803647 1:33115627-33115649 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
904947014 1:34206784-34206806 CAGGAGAGAGAGGCTGCCCTGGG + Intronic
905049992 1:35042129-35042151 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
905187339 1:36205940-36205962 CGGGAGGCAGAGGTTGCACTGGG + Intergenic
905425412 1:37879682-37879704 CGGGAGGCAGGGGTTGCAGTGGG + Intronic
905481106 1:38262594-38262616 CAAGAGCCAGGCCCTGCACTGGG - Intergenic
905540733 1:38758297-38758319 CAGGAGGCAGAGGTTGCAGTTGG + Intergenic
905860607 1:41348525-41348547 CAGGTGACAGGGGATGCCCTGGG + Intergenic
905934924 1:41815841-41815863 CAGGAGGCAGGGGTTGCAGTGGG - Intronic
905935034 1:41816603-41816625 CAGGAGGCAGGAGTTGCAGTGGG + Intronic
905948078 1:41920347-41920369 CAGGGGGCAGGGGCTGGACCAGG - Intronic
906222595 1:44093466-44093488 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
906324800 1:44838791-44838813 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
906412053 1:45586357-45586379 CAGGAGGTAGGGGCTGCTGTGGG - Intronic
906519000 1:46456360-46456382 CAGAACCCAGGGGCTGGACCAGG - Intergenic
907004857 1:50901789-50901811 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
907023706 1:51094727-51094749 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
907081614 1:51628755-51628777 CAGCAGGCAGAGGCTGCAGTGGG - Intronic
907103973 1:51863326-51863348 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
907218170 1:52884155-52884177 CAGGAGTCAGGCACTGCACCCGG + Intronic
907222496 1:52917146-52917168 CAAGAGGCAGAGGCTGCAGTGGG + Intronic
908585767 1:65566274-65566296 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
910155074 1:84207939-84207961 CAGGAGGCAGAGGCTGCAGCGGG - Intronic
910371667 1:86523492-86523514 CCGGAGCCAGCGGCTGCAACAGG - Intergenic
910543722 1:88390975-88390997 CGGGAGGCAGGGGTTGCAGTGGG - Intergenic
910779769 1:90917569-90917591 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
910974260 1:92889719-92889741 CAGGAGACAGAGGCTGCAGTGGG - Intronic
911249395 1:95557971-95557993 CAGGAGGCAGAGGTTGCGCTGGG - Intergenic
911343931 1:96673975-96673997 CAGTAGCCAGGGCCTGGAGTTGG + Intergenic
911348506 1:96724322-96724344 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
912385693 1:109270237-109270259 CCTGGGCCAGGTGCTGCACTAGG - Intronic
912756548 1:112329399-112329421 CAGGAGCCATGGGAAGGACTTGG - Intergenic
912778368 1:112521550-112521572 CAGGAGTCAGTGGCTACAGTGGG + Exonic
912848568 1:113101142-113101164 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
912945102 1:114078187-114078209 CAGGAGGTAGAGGCTGCAGTGGG + Intergenic
913204005 1:116518770-116518792 CAGGAGCCAGGGTCAGAGCTGGG - Intronic
913589644 1:120311151-120311173 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
913618541 1:120587215-120587237 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
914195470 1:145446058-145446080 AAGGAGCCCAGGGCTGCCCTTGG - Intergenic
914493002 1:148164631-148164653 CATGAGCCAGGGACTGTACCTGG + Intergenic
914571672 1:148923009-148923031 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
914601162 1:149207253-149207275 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
914854145 1:151337927-151337949 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
914893042 1:151644870-151644892 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
914904853 1:151735521-151735543 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
915106067 1:153535852-153535874 CTGGATCCAGCGGCTGAACTGGG + Exonic
915186006 1:154105739-154105761 CAGGAGCCAAGGCCTGAAATTGG - Intronic
915231921 1:154452079-154452101 GAGGCGGCAGGGGCTGGACTGGG - Intronic
915713375 1:157922237-157922259 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
915974441 1:160375666-160375688 AAGAAGACAGGGCCTGCACTGGG - Intergenic
916031736 1:160882941-160882963 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
916234954 1:162577683-162577705 CGGGAGGCAGGGGTTGCAGTGGG - Intronic
916236202 1:162591557-162591579 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
916436815 1:164785109-164785131 CAGCATCCAGGGTCTCCACTTGG + Intronic
917092537 1:171368047-171368069 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
917433194 1:174992364-174992386 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
917457048 1:175193873-175193895 CAGGTGCCAGGTGCTGAACCAGG + Intergenic
917692457 1:177483268-177483290 CAGGAGCTTGAGGCTGCAGTGGG + Intergenic
917967368 1:180187082-180187104 CAGGAAGCTGGGGCTGCCCTCGG + Intronic
918155675 1:181843827-181843849 CAGGAGCCAGAGGTTGCAGTGGG + Intergenic
918253345 1:182724629-182724651 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
918358068 1:183724681-183724703 CAGGAGCCAGGGCCTAGAGTTGG - Intronic
918498214 1:185163465-185163487 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
918532331 1:185537474-185537496 CAGGAGCCAGGGAATGAAGTTGG + Intergenic
918585066 1:186177230-186177252 CAGGAGGCAGGGGTTGCAGTGGG + Intronic
919043875 1:192426124-192426146 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
919185900 1:194148770-194148792 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
919706064 1:200677188-200677210 CGGGAGGCAGAGGCTGCAGTGGG - Intergenic
919883822 1:201918318-201918340 CAGGAGGCAGGGGGTTCAGTGGG - Intronic
920089496 1:203442056-203442078 CACGAGCTAGGGGCTGGATTAGG + Intergenic
920523109 1:206644106-206644128 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
920678697 1:208056719-208056741 AGGGGTCCAGGGGCTGCACTGGG + Intronic
920888203 1:209954777-209954799 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
920891151 1:209986695-209986717 CGGGAGGCAGAGGTTGCACTGGG - Intronic
920948370 1:210550741-210550763 CAGGAGGCAGAGGGTGCAGTGGG - Intronic
921651217 1:217680849-217680871 CAGGAGACAGAGGTTGCAGTGGG + Intronic
921790188 1:219280973-219280995 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
922047789 1:221963526-221963548 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
922057327 1:222054052-222054074 CTGGAGACAGGAGCTGCACTAGG + Intergenic
922533914 1:226365691-226365713 CAGGAGGCAGAGGCTGCAGCAGG + Intronic
922653428 1:227360342-227360364 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
922700645 1:227758056-227758078 CAGGAGCTAAGGGCTTCCCTTGG - Intronic
922758304 1:228108960-228108982 CAGGAGCCTGGGGCTGGTCCAGG + Exonic
923029966 1:230241518-230241540 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
923053393 1:230404534-230404556 CAGGAGGCTGAGGCTGCAGTGGG + Intronic
923495016 1:234516876-234516898 CAGGAGGTAGAGGCTGCAGTGGG - Intergenic
923548927 1:234945936-234945958 CGGGAGGCAGAGGCTGCAGTGGG + Intergenic
924229509 1:241951704-241951726 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
924361192 1:243243148-243243170 CAGGAGTTTGGGGCTGCAGTAGG + Intronic
924364880 1:243282055-243282077 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
924385103 1:243492679-243492701 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
924687188 1:246306271-246306293 CAGGAGGCAGAGGTTGCAATGGG + Intronic
924702545 1:246468565-246468587 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
924791686 1:247256466-247256488 CAGGAGGCAGGGGGTGCAGATGG - Intergenic
924946678 1:248851214-248851236 CAGGTGCCAGGGTCTGTCCTTGG - Intronic
1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG + Exonic
1062923254 10:1295957-1295979 CAGGAGCCTGTGGTTGGACTGGG + Intronic
1063122393 10:3114221-3114243 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1063366096 10:5491803-5491825 TACGTGGCAGGGGCTGCACTGGG + Intergenic
1063435617 10:6027250-6027272 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1063699494 10:8370859-8370881 CAGGAGGCGGGGGTTGCAGTGGG - Intergenic
1063903263 10:10757383-10757405 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1064290608 10:14030898-14030920 CATGAGCCAGGGACTGCGGTGGG - Intronic
1064654441 10:17543260-17543282 CAGGAGGCAGAGACTGCAGTGGG - Intergenic
1064805433 10:19125017-19125039 CAGGAGGCGGGGGTTGCAGTGGG - Intronic
1065020676 10:21499892-21499914 CAGGAGCCGGGCTCCGCACTGGG - Intergenic
1065835103 10:29650022-29650044 CATGATCCAGGGGCTGCATCTGG - Intronic
1065849454 10:29774999-29775021 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1065913811 10:30334585-30334607 CAGGAGGCAGAGGCTGCAGCGGG + Intronic
1065995543 10:31056101-31056123 CAGGAGCCCATGGCTGCACGGGG - Intergenic
1066066887 10:31768058-31768080 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1066131224 10:32395916-32395938 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
1066321272 10:34306205-34306227 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1067286165 10:44908982-44909004 CATGAGACAGGAGCAGCACTGGG - Intergenic
1067473580 10:46552360-46552382 CAGGAGGCAGCAGCTGCATTTGG + Intronic
1067682055 10:48447620-48447642 CCCGAGCCAGGGGCAGCAGTGGG - Intronic
1067788525 10:49270724-49270746 CAGGGGCCAGGCACTGCACAAGG - Intergenic
1068104062 10:52591863-52591885 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1068688579 10:59893530-59893552 CAGGAGGCAGAGCCTGCAGTGGG + Intronic
1068803258 10:61165421-61165443 CATGTGTCAGGGGCTACACTGGG - Intergenic
1069007676 10:63336382-63336404 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1069134810 10:64751200-64751222 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
1069442380 10:68440228-68440250 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1069904488 10:71724364-71724386 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
1070015872 10:72530257-72530279 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1070037470 10:72741171-72741193 CAGGAGGCAGAGGCTGAAGTAGG - Intronic
1070338464 10:75475383-75475405 CAGGAGTCAGGGGCTGTTTTGGG + Intronic
1070556176 10:77529378-77529400 CAGCAGGCAGGGGCTGAGCTGGG - Intronic
1070607973 10:77912764-77912786 CTGGAGCCAGAGGCTGCAGATGG - Intronic
1070954243 10:80454153-80454175 CAGGCGCCCGGGGCCGCACCGGG + Exonic
1071051178 10:81450675-81450697 CAGGAGCCAGGGCTTGGACAGGG + Intergenic
1071133637 10:82426705-82426727 CAGGAGGCAAAGGCTGCAGTGGG - Intronic
1071134975 10:82443193-82443215 TAGGATCCAGGGGATGCACTTGG + Intronic
1071150804 10:82632026-82632048 CGGGAGACAGAGGTTGCACTGGG + Intronic
1071239765 10:83692640-83692662 CAGCAGACAGGGGCAGGACTGGG - Intergenic
1071563876 10:86661769-86661791 CAGGAGCCTGGGGTGGCTCTGGG + Intronic
1071604668 10:86977143-86977165 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1071772814 10:88748541-88748563 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1072137996 10:92565168-92565190 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1072186365 10:93043008-93043030 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1072461323 10:95621391-95621413 CAGGAGGCAGAGGTTGCATTGGG - Intronic
1072875345 10:99167082-99167104 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1072912622 10:99517265-99517287 CAGGAGGCAGAGGCTACAGTGGG + Intergenic
1072972219 10:100027194-100027216 CAGGAGGCAGAGGTTGCGCTGGG + Intergenic
1073011868 10:100366488-100366510 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1073177195 10:101563811-101563833 CCGGATCCAGGGGCTGCCCCAGG + Intergenic
1073228557 10:101946007-101946029 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1073516903 10:104084381-104084403 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1074371435 10:112903778-112903800 CAGGAGGCAAGGGTTGCAGTGGG - Intergenic
1074773594 10:116749569-116749591 CATGTGCCAGGTGCTGCGCTAGG - Intergenic
1074847110 10:117407997-117408019 TAGGTGCCAGCTGCTGCACTTGG - Intergenic
1074848096 10:117416782-117416804 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1075086596 10:119418127-119418149 GAGGAACCTGGGGCCGCACTGGG - Intronic
1075264152 10:120986617-120986639 CAGGAGGCAGAGGTTGCATTGGG + Intergenic
1075394505 10:122117266-122117288 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1075442495 10:122491256-122491278 CAGTAGCCATGGGCTGCCTTAGG - Intronic
1075637316 10:124038178-124038200 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1075656919 10:124168211-124168233 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1075776137 10:124990116-124990138 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1076639058 10:131901452-131901474 CAGGGGCCAGGGGCCGAGCTGGG + Intronic
1076742523 10:132493842-132493864 CAGGCGCCAGGTGCTGTGCTGGG - Intergenic
1077108276 11:851188-851210 CAGGAGCCAGGGACAGGACAGGG - Intronic
1077333360 11:1993009-1993031 CAGCACTCAGGGGCTGCCCTAGG + Intergenic
1077356433 11:2121012-2121034 GAGGAGCCAGGGTCTGCATTTGG + Intergenic
1077522060 11:3042280-3042302 CAGGGTCCAGGGGCAGCACCAGG + Intronic
1077602633 11:3584038-3584060 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1078165628 11:8881607-8881629 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1078229010 11:9421552-9421574 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1078240777 11:9529420-9529442 CAGCAGCCAGGACCAGCACTGGG - Intergenic
1078790252 11:14534998-14535020 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1078813339 11:14794388-14794410 CAGGAGGCAGAGACTGCAGTGGG - Intronic
1078911423 11:15736286-15736308 CATGAGCCAGGGTCTGTACAAGG - Intergenic
1079193113 11:18298419-18298441 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1079250004 11:18780406-18780428 CAGGAGCTAGGGGCCGCTCTAGG - Intronic
1080539155 11:33250127-33250149 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1081137119 11:39451777-39451799 CAGGAGGCAGAGGATGCAGTGGG + Intergenic
1081212526 11:40354466-40354488 TCGGAGCCAGGGCCTGTACTCGG + Intronic
1081225904 11:40522094-40522116 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1081515560 11:43825055-43825077 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1081533354 11:43979771-43979793 CAGGAGGCGGGGGTTGCAGTGGG + Intergenic
1081692149 11:45085995-45086017 CAGGAGCCAGCGCCTCCCCTTGG + Intergenic
1081744728 11:45464839-45464861 CAGCAGCCAGGGTCTCCACTGGG + Intergenic
1081819604 11:45979088-45979110 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1081903524 11:46650677-46650699 CGGGAGGCAGAGGCTGCAATGGG - Intronic
1081916324 11:46733275-46733297 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1081918318 11:46748903-46748925 CAGGAGGCGGAGGTTGCACTGGG - Intronic
1081974235 11:47221516-47221538 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1082081131 11:48013388-48013410 CAGGAGCCAGTGCCGGTACTAGG + Intronic
1082781768 11:57293645-57293667 CAGGATCCAGGAGCTGCAACTGG - Intergenic
1082850259 11:57758003-57758025 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1083116710 11:60467349-60467371 CCGGAGGCAGAGGTTGCACTGGG - Intronic
1083300465 11:61737388-61737410 CTGGTGCTAGGGGCTGGACTGGG + Intronic
1083544482 11:63538348-63538370 CAGGAGGCAGGGGCTGGTCAGGG + Intronic
1083568886 11:63744916-63744938 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1083653038 11:64214874-64214896 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1083778187 11:64904469-64904491 CAGGAGGCAGAGGTTGCAGTCGG + Intronic
1083843592 11:65318167-65318189 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1083843614 11:65318326-65318348 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1083881939 11:65553223-65553245 CAGAAGCCAGGGCCTGTACGTGG - Exonic
1083903425 11:65654860-65654882 CTGGAGCCTGGGGCAGGACTTGG + Exonic
1084083662 11:66844859-66844881 CAGGAGCGGGGGGCTGCAGAGGG - Exonic
1084098762 11:66931303-66931325 CAGGAGGCAGGGGTTGCAGTGGG + Intronic
1084175933 11:67422255-67422277 CAGGAGGCAGAGGTTGCAATGGG - Intronic
1084274735 11:68045511-68045533 CTGGAGCCAGGGGCAGCCTTTGG + Intronic
1084333700 11:68445171-68445193 CTGGAGGCAGAGGCTGCAGTGGG - Intronic
1084490842 11:69477398-69477420 CAGTAGCCTGGGGCTTCGCTGGG + Intergenic
1084662451 11:70554131-70554153 CTGGGGACAGGGGCTGGACTCGG - Intronic
1084700633 11:70784428-70784450 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1084814220 11:71636624-71636646 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1084876748 11:72138999-72139021 CACCAGCCAGGAGCTGCACAAGG + Exonic
1084879779 11:72162725-72162747 CAGGAGGTAGAGGCTGCAGTGGG + Intergenic
1084881769 11:72176805-72176827 CACCAGCCAGGAGCTGCACAAGG + Intergenic
1084887523 11:72220908-72220930 CACCAGCCAGGAGCTGCACAAGG + Exonic
1085013777 11:73159344-73159366 CAGGAGCCCCCGGCAGCACTGGG - Intergenic
1085147386 11:74213348-74213370 CAGGAGCCAGGGCTTGGAATTGG - Intronic
1085178397 11:74510965-74510987 CAGGAGCTAGGGCCTGGAATGGG - Intronic
1085237344 11:75025322-75025344 CAGCAGGAAGGGCCTGCACTTGG + Intergenic
1085358320 11:75860857-75860879 CAGGAGACAGAGGCTGCAGTGGG - Intronic
1085520261 11:77134001-77134023 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1085538201 11:77239886-77239908 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1085595352 11:77803995-77804017 CAGGAGCTCAGGGCTGCAGTGGG + Intronic
1085677993 11:78543102-78543124 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1086305901 11:85481861-85481883 CAGGAGTCTGGGGCTGCAGGGGG - Intronic
1086464108 11:87036335-87036357 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1086473057 11:87138162-87138184 CAGGAGGCGGGGGTTGCAGTGGG - Intronic
1087007401 11:93483316-93483338 CTGGGCCCAGGGGCTGCACCGGG + Intronic
1087359208 11:97136660-97136682 CAGAAGCTAGGGCCTGGACTTGG + Intergenic
1088057354 11:105601269-105601291 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1088129866 11:106474618-106474640 CAGGAGCCAGGGTCTTCAGTGGG + Intergenic
1088181778 11:107121243-107121265 CAGGAGCTAGGGTCTGGAATGGG - Intergenic
1088478010 11:110263792-110263814 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1088555800 11:111059421-111059443 CAAGAGAGAGGAGCTGCACTGGG - Intergenic
1088699729 11:112401013-112401035 CTGGAGCCAAGTTCTGCACTTGG + Intergenic
1088911330 11:114194755-114194777 TAGAAGCCAGGTGGTGCACTGGG - Intronic
1089095293 11:115915225-115915247 CAGCAGCAAGGGGCTGGATTTGG + Intergenic
1089225180 11:116913814-116913836 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1089685999 11:120147220-120147242 CTGGAGCCATGTGCTGCTCTAGG + Intronic
1089873613 11:121698568-121698590 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1090602982 11:128391770-128391792 AAGGGGCCAGAGGCTGCACAGGG - Intergenic
1090665164 11:128910112-128910134 CAGAAGCCAGGAACTGCACTAGG - Intronic
1091149422 11:133313663-133313685 CAGGAGCCAGGGAATGCAGGTGG + Intronic
1091345940 11:134854125-134854147 CAGGAGCCAGGCGCTGTGCCAGG - Intergenic
1202816338 11_KI270721v1_random:48190-48212 CAGCACTCAGGGGCTGCCCTAGG + Intergenic
1091476338 12:777234-777256 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1091486623 12:895530-895552 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1091494174 12:957983-958005 CAAGAGCCAGTGGCTTGACTGGG + Intronic
1091603727 12:1933602-1933624 AAGGAGCCAGGGCCTGCCCCTGG - Intergenic
1092352772 12:7769394-7769416 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1092429858 12:8399597-8399619 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1092606098 12:10120980-10121002 CAGGAGGCAGAGGTTGCAGTAGG + Intronic
1092670881 12:10859200-10859222 CAAGAGCCAGGGCCTGGAATTGG - Intronic
1093619959 12:21277245-21277267 CAGGAGCTAGGGCCTGGAATGGG - Intronic
1093903373 12:24661519-24661541 CAGGAGCGAGGGTCTGGAATGGG + Intergenic
1094115636 12:26909285-26909307 CAAGAGGCAGAGGCTGCACTGGG + Intronic
1094590116 12:31812030-31812052 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1095163285 12:38941543-38941565 CAGGAGCTAGGGCCTGGAATAGG - Intergenic
1095261709 12:40105813-40105835 CAGGGGCCCGGGGCTGCCCGGGG + Exonic
1095729924 12:45495163-45495185 CAGGAGAGAGAGGCTGCAGTAGG + Intergenic
1095946672 12:47757865-47757887 CTGCATCCAGGGGCTGCGCTGGG - Exonic
1096140936 12:49242061-49242083 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1096168421 12:49445976-49445998 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1096358965 12:50967038-50967060 CAGGAGGCAGAGGTTGCAGTAGG + Intronic
1096423573 12:51481563-51481585 CAGGGGGCAGGGGCAGGACTAGG + Intronic
1096481129 12:51941751-51941773 CAGGAAACAGGGGTGGCACTCGG + Intergenic
1096951210 12:55474740-55474762 CAGGTGCCAGCCCCTGCACTTGG + Intergenic
1097425983 12:59445540-59445562 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1098288178 12:68930152-68930174 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1098333908 12:69382326-69382348 CAGGAGCCAGGGCCTGGAGTTGG + Intronic
1098530230 12:71533269-71533291 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1098936221 12:76482537-76482559 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1099610132 12:84857522-84857544 CAGGAGCTAGGGTCTGGAATGGG + Intergenic
1099921958 12:88969514-88969536 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1099951429 12:89308757-89308779 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1100322527 12:93509112-93509134 CAGGAGGCAGAGGTTGCAGTGGG + Exonic
1101607499 12:106258736-106258758 CAAGAGCCAAGGCCTGGACTTGG - Intronic
1101607554 12:106259048-106259070 CAGGAGCCAGAGCCTGGAGTTGG - Intronic
1101876153 12:108598053-108598075 CTGGTGCCCGGGGCTGCTCTGGG + Exonic
1101912477 12:108870545-108870567 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1101962026 12:109257942-109257964 CAGGAGCTGTGGGCTGCACGTGG - Intronic
1101962147 12:109258478-109258500 CCAGGGCCAGGGACTGCACTGGG - Intronic
1101982757 12:109421897-109421919 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
1102121287 12:110443504-110443526 CAGGAGGCGGAGGTTGCACTGGG - Intronic
1102266682 12:111491910-111491932 CAGGAGCCAGGGCCTGGGATCGG - Intronic
1102270708 12:111532404-111532426 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1102273045 12:111556300-111556322 CAGGAGTCTGAGGCTGCAGTAGG + Intronic
1102274229 12:111567738-111567760 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1102370619 12:112380369-112380391 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1102875165 12:116443532-116443554 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1102925352 12:116821906-116821928 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1102967647 12:117140581-117140603 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
1102999172 12:117372150-117372172 CAGGAGGCAGAGGCTGGATTTGG - Intronic
1103048026 12:117754562-117754584 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1103124344 12:118408405-118408427 CAGGAGGCAGGGACTGCAGTGGG - Intronic
1103568744 12:121830391-121830413 CCGGAGCCAGGGGCTCCAGGGGG - Exonic
1103574807 12:121869596-121869618 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1103885907 12:124200064-124200086 CAGGAGGCAGAGGCTACAGTGGG - Intronic
1103931991 12:124455671-124455693 TAGGGACCAGGAGCTGCACTAGG + Intronic
1104148283 12:126056238-126056260 CAGGACCCAGGAGCTGGCCTGGG - Intergenic
1104637751 12:130448601-130448623 AAGGAGCCAGGGGTAGGACTGGG + Intronic
1104993527 12:132640331-132640353 GAAGAGGCAGGGGCTGCCCTGGG + Intronic
1105008852 12:132740891-132740913 CAGGAGCCTGGGCGTGCACCAGG + Intronic
1105331549 13:19421327-19421349 CAGGAGCCAAGAGCCCCACTAGG - Intergenic
1105919597 13:24949643-24949665 CAGGAGCCAAGAGCCCCACTAGG - Intergenic
1106061761 13:26299974-26299996 AATGAGCCATGGGCTGAACTTGG + Intronic
1106091265 13:26597204-26597226 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1106143233 13:27028520-27028542 CACGAGCCATGGGCTTCACCTGG - Intergenic
1106359365 13:29015976-29015998 CAGGAGGCGGAGGTTGCACTGGG - Intronic
1106566061 13:30885757-30885779 CAGGAGGCAGAAGCTGCAGTGGG - Intergenic
1106582130 13:31027625-31027647 CCAGAGCCCAGGGCTGCACTAGG - Intergenic
1106614110 13:31310611-31310633 CAGGAGCCACGGGCTGGAGTGGG + Intronic
1106643817 13:31611867-31611889 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1106670270 13:31897832-31897854 CAGGAGCCAGGCAATGCAGTTGG - Intergenic
1107527719 13:41249698-41249720 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1107808168 13:44174359-44174381 CAGGAGCCAGAGCCTGGAGTCGG + Intergenic
1108238183 13:48430853-48430875 CAGGAGTTTGGGGCTGCAGTAGG + Intronic
1108294219 13:48996987-48997009 CAGGAGGCAGAGGCTGCAGCGGG + Intronic
1108296808 13:49029045-49029067 CAGGAGGCAAAGGCTGCAGTGGG - Intronic
1108347281 13:49558618-49558640 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1108665890 13:52630348-52630370 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1108965279 13:56290598-56290620 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1109436365 13:62308949-62308971 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
1110247161 13:73339919-73339941 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
1110602848 13:77395699-77395721 CAGGAGGTCGGGGCTGCAGTGGG + Intergenic
1112061457 13:95743629-95743651 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1112272571 13:97982942-97982964 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1112516214 13:100055284-100055306 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1112520702 13:100092454-100092476 CAGGAGGCAGAGGCTGCAGTAGG - Intronic
1112525049 13:100137881-100137903 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
1112970250 13:105252923-105252945 CAGGAGGTAGAGGCTGCAATGGG + Intergenic
1113251259 13:108455602-108455624 CAGGAGGCAGAGGCTGTAGTGGG - Intergenic
1113885078 13:113654632-113654654 CAGGGGCCAGGGGCTGCCCTCGG + Intronic
1113960659 13:114124021-114124043 CAGGAGACAGGAGCCGCACTGGG - Intronic
1113992295 14:16037281-16037303 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
1114293202 14:21305785-21305807 CGAGAGGCAGGGGTTGCACTGGG + Intronic
1114495022 14:23126475-23126497 CAGGAGGCAGGGGCAGGGCTGGG + Exonic
1114504656 14:23200397-23200419 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1114944136 14:27657013-27657035 CAGGAGGCAGGGGTTGCACTAGG + Intergenic
1115346494 14:32348486-32348508 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1115537219 14:34384644-34384666 GAGGAGCCAGGGGCAGCACGGGG - Intronic
1116043109 14:39710019-39710041 CAGGAGCCAAGGGATGCAGATGG - Intergenic
1116413270 14:44650136-44650158 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1116497728 14:45582871-45582893 CAGGAGCCAGGGCCTGGGATTGG + Intergenic
1116848355 14:49885034-49885056 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1116883182 14:50192480-50192502 CGGGAGGCAGAGGTTGCACTGGG + Intronic
1117066599 14:52017890-52017912 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
1117504469 14:56388610-56388632 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1117780317 14:59225099-59225121 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1118568965 14:67173237-67173259 CAGGAACCCGGTGCTGCAGTAGG + Intronic
1118705910 14:68480144-68480166 CGGGAGGCAGGGGTTGCAGTGGG - Intronic
1119017390 14:71073222-71073244 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1119333770 14:73815233-73815255 CAGGAGGCAGAGGGTGCAGTGGG + Intergenic
1119741826 14:77018610-77018632 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1120349794 14:83341320-83341342 CATGGGCCAGGGGCTGTTCTGGG - Intergenic
1120791341 14:88586092-88586114 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1120865085 14:89289106-89289128 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1121117303 14:91352797-91352819 ATGGAGCCAGGGGCAGGACTGGG + Intronic
1121297445 14:92840835-92840857 CAGGAGTTTGGGGCTGCAGTGGG - Intergenic
1121653560 14:95577567-95577589 CAGGTGTCAGGGGCAGCACAAGG + Intergenic
1121904488 14:97727259-97727281 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1121939794 14:98059285-98059307 GGGGAGCCAGGGGCTGCCCAGGG - Intergenic
1121957779 14:98229620-98229642 AAGAAACCAGAGGCTGCACTGGG - Intergenic
1122033035 14:98927439-98927461 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
1122057861 14:99117100-99117122 CAGGTGCCAGGGGTTGCCCTTGG + Intergenic
1122172728 14:99890213-99890235 CGGGAGTCAAGGGGTGCACTGGG - Intronic
1122220116 14:100232887-100232909 CAGGAGCCCGCCACTGCACTTGG - Intergenic
1122489344 14:102103105-102103127 CAGGAGACAGAGGTTGCAGTGGG + Intronic
1122522249 14:102353061-102353083 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1122620847 14:103057036-103057058 CAGGGCCGAGTGGCTGCACTCGG + Exonic
1122675558 14:103410209-103410231 CAAGATCCAGGGGCTGCATCTGG + Intronic
1122718711 14:103710107-103710129 CAGGGGGCAGGGGCTGCACGTGG + Intronic
1122814220 14:104304330-104304352 CAGGCCCCCAGGGCTGCACTGGG - Intergenic
1122871083 14:104639360-104639382 CTGGGGCCACGGGCTGCACGGGG + Intergenic
1122899879 14:104778022-104778044 CAGGGGCCAGGGGCTGTGCTGGG - Intronic
1123217376 14:106823866-106823888 CAGTAGCCACTGGATGCACTGGG - Intergenic
1124009580 15:25826719-25826741 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1124012237 15:25848360-25848382 CAGGAGACTGGGGTTGCACTGGG - Intronic
1124417499 15:29485333-29485355 CAGGGGCCAGGTCCTGCACTGGG - Intronic
1124692548 15:31837470-31837492 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1124961522 15:34400292-34400314 CAGGAGGCAGGGGTTGCAGTGGG - Intronic
1124978148 15:34546515-34546537 CAGGAGGCAGGGGTTGCAGTGGG - Intronic
1125503899 15:40255760-40255782 CAGAAGGCAGGGGCTGCAGGGGG + Intronic
1125840272 15:42793987-42794009 CAGGAGTTAGAGGCTGCAGTGGG - Intronic
1125995437 15:44155356-44155378 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1126682480 15:51216323-51216345 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1127076557 15:55332049-55332071 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1127919636 15:63483374-63483396 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1127986731 15:64078560-64078582 CAGGAGTCAGAGGCTGCACTGGG + Intronic
1127988178 15:64091409-64091431 CAGGAGGCTGAGGCTGCAGTGGG + Intronic
1128166465 15:65469760-65469782 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1128361515 15:66964978-66965000 CAGAGGACAGGGTCTGCACTGGG + Intergenic
1128364554 15:66988521-66988543 CAGGAGCCAGGGCCTAGAGTCGG - Intergenic
1128470590 15:67948855-67948877 CAGGAGGCAGGGGTTGCAGCGGG - Intergenic
1128757694 15:70194629-70194651 CAGGCCCCAGGGGCTCCAGTAGG - Intergenic
1129003417 15:72352735-72352757 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1129158015 15:73730958-73730980 CAGGAGCCAGGAGCCCCACTTGG - Intergenic
1129394713 15:75237551-75237573 CAGGAGGAGGGGGCTGCACGAGG + Intergenic
1129497904 15:76004523-76004545 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1129561707 15:76577549-76577571 CAGGAGCTAGGGCCTGGAATGGG - Intronic
1129642465 15:77394142-77394164 CAGGAGCCAGGGCCTGGAGTTGG - Intronic
1129979802 15:79857940-79857962 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1130118388 15:81025452-81025474 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1130164249 15:81436567-81436589 CAGGAGGCAGGGGCTGCAGGAGG + Intergenic
1130408677 15:83625904-83625926 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1130438575 15:83927188-83927210 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1130536236 15:84786922-84786944 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1130607512 15:85331292-85331314 CAGCCGCTAGAGGCTGCACTTGG + Intergenic
1130797236 15:87222617-87222639 CATGACCCTGAGGCTGCACTAGG + Intergenic
1131018368 15:89076555-89076577 CAGGAGGTAGAGGCTGCAATGGG - Intergenic
1131410668 15:92205173-92205195 CAGGAGCCAGGGCCTGCAACAGG + Intergenic
1131599006 15:93828075-93828097 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1131642181 15:94304366-94304388 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1132120794 15:99173510-99173532 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
1132413320 15:101602275-101602297 CAGGAGGCGGAGGCTGCAGTGGG + Intergenic
1132464178 16:70138-70160 CAGGTGCCCTGAGCTGCACTTGG - Intronic
1132479917 16:162110-162132 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1132489401 16:217631-217653 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1132529353 16:437881-437903 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1132730250 16:1357407-1357429 CAGGAGCCAGATGCCACACTGGG - Intronic
1132737715 16:1395239-1395261 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1132775379 16:1590837-1590859 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
1132955773 16:2592599-2592621 CAGGAGGCAGAGGTTACACTGGG + Intronic
1132987294 16:2774154-2774176 CGGGAGGCAGCGGCTGCAGTGGG + Intronic
1133048825 16:3105127-3105149 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1133213187 16:4274075-4274097 CAGGAGCCAGGGGAGGGCCTGGG - Intergenic
1133467116 16:6038253-6038275 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1133579577 16:7130104-7130126 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1133834096 16:9351166-9351188 CAGGAGCCAGGGCTTGGAGTTGG + Intergenic
1133925149 16:10186229-10186251 CAGGAGGCTGGAGTTGCACTGGG + Intergenic
1134065973 16:11228484-11228506 CAGAAGCTTGGGGCTGCACCTGG - Intergenic
1134179160 16:12033678-12033700 CAGGAGGCATAGGCTGCAGTGGG - Intronic
1134245182 16:12534409-12534431 GTGTAGCCAGCGGCTGCACTCGG + Intronic
1134427460 16:14164636-14164658 CATGTGCCAGGCACTGCACTTGG + Intronic
1134477657 16:14589791-14589813 CAGGAGACAGAGGTTGCAGTGGG + Intronic
1135305891 16:21367463-21367485 CAGGAGGCATAGGCTGCAGTGGG - Intergenic
1135404705 16:22189988-22190010 CAGGAGCAAGACGCTGCACTCGG + Intronic
1135517257 16:23146452-23146474 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1135543393 16:23349411-23349433 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1136132505 16:28232617-28232639 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1136157735 16:28395682-28395704 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1136205352 16:28719602-28719624 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1136284002 16:29230720-29230742 CAGGAGCCAGCGGGTGAAGTGGG + Intergenic
1136302633 16:29346615-29346637 CAGGAGGCATAGGCTGCAGTGGG - Intergenic
1136468462 16:30461738-30461760 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1136983860 16:35082388-35082410 CAGCATCCAGGGGCTGCAAGAGG + Intergenic
1137225760 16:46506757-46506779 CGGGAGCCAGGGCCTGAAGTTGG - Intergenic
1137558424 16:49488048-49488070 CAGGTGCCAGGCACTGCACAGGG - Exonic
1137565038 16:49527466-49527488 CAGGGGGCAGGGGATGCATTGGG - Intronic
1138173863 16:54878087-54878109 CAGGAGGCAAGGGCAGCCCTGGG - Intergenic
1138195788 16:55051226-55051248 CAGGGCCCAGGGGCTGAGCTGGG - Intergenic
1138209393 16:55150689-55150711 CAGCAGGCAGGGGCTGCTTTTGG + Intergenic
1138389097 16:56657583-56657605 CAAGAGACTGGGGTTGCACTGGG + Intronic
1138390905 16:56669410-56669432 CAAGAGACTGGGGTTGCACTGGG + Intronic
1138428714 16:56953722-56953744 CAGGAGGCAGAGGTTGCAATGGG + Intergenic
1138812515 16:60167297-60167319 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1138857594 16:60713089-60713111 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1139290007 16:65849459-65849481 CAGGAGCAAGGGGTTGGGCTGGG + Intergenic
1139343704 16:66288626-66288648 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1139377108 16:66506618-66506640 CAGGAGGCAGAGGTTGCAATGGG - Intronic
1139381227 16:66532529-66532551 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1139716300 16:68816089-68816111 CAAGAGACAGAGGCTGCAGTAGG - Intronic
1139746036 16:69075525-69075547 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
1139750039 16:69104368-69104390 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1139874519 16:70134710-70134732 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1139921385 16:70462716-70462738 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1140361262 16:74346421-74346443 CGGGAGGCAGAGGCTGCAGTGGG - Intergenic
1140373452 16:74426378-74426400 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1140760489 16:78104428-78104450 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1141106609 16:81239088-81239110 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1141124213 16:81388610-81388632 CGGGAGCCTGGGGCTGCACTGGG - Exonic
1141286986 16:82681777-82681799 CAGGTCCCAGGAGCAGCACTCGG + Intronic
1141400536 16:83743131-83743153 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1141629952 16:85282099-85282121 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1141768747 16:86075764-86075786 CGCCAGCCAGGGGCAGCACTGGG - Intergenic
1142034845 16:87856531-87856553 TAGGGGCCACAGGCTGCACTGGG - Intronic
1142078126 16:88132149-88132171 CAGGTGCCTCAGGCTGCACTTGG + Intergenic
1142089036 16:88200230-88200252 CAGGAGCCAGCGGGTGAAGTGGG + Intergenic
1142286332 16:89173017-89173039 CAGCTGCCAGGGGCTGAAATTGG - Intronic
1142353086 16:89588641-89588663 CGGGAGCCAGGAGCTGTGCTGGG - Intronic
1142576719 17:913971-913993 CAGGAGCCGGAGGTTGCAGTAGG - Intronic
1142883217 17:2896867-2896889 CAGGACCCTGTGGCTGCACGTGG - Intronic
1142903357 17:3026841-3026863 CAGGAGGCAGCGGCTGTCCTGGG + Intronic
1143231389 17:5358595-5358617 CAGGAGACGGAGGCTGCAATGGG + Intronic
1143386995 17:6536872-6536894 CAAGAGCCAGGGACTGTCCTGGG + Intronic
1143409020 17:6697304-6697326 CAGGAGCCAGAGCCTGCATTTGG + Intronic
1143543923 17:7585461-7585483 CAAGAGGCAGAGGCTGCAGTGGG + Intronic
1143647636 17:8241530-8241552 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1143652157 17:8269949-8269971 CAGGAGGCAGAGGTTGCAGTGGG - Exonic
1143951149 17:10633136-10633158 CAGGAGACAGAGGTTGCAGTGGG + Intronic
1144149019 17:12425453-12425475 CAGGGGCCAGGCGTTGCACTTGG + Intergenic
1144321644 17:14128918-14128940 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1144653915 17:17023615-17023637 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1144709325 17:17390180-17390202 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1144872187 17:18378183-18378205 CAGGAGGCAGGGGATGGCCTGGG + Intronic
1145077761 17:19869447-19869469 CAGGAGGCGGAGGCTGCAGTGGG - Intergenic
1145098297 17:20051247-20051269 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1145207911 17:20994486-20994508 CAGGAGCCTGGGTCTGGACAGGG + Intergenic
1145304564 17:21666237-21666259 CAGGAGCCCTGGGCTGCAGGTGG + Intergenic
1145367899 17:22279449-22279471 CAGGAGACAGGCGCGGGACTCGG + Intergenic
1145889908 17:28407056-28407078 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1145899762 17:28482930-28482952 CAGGAGCAAGGCGAGGCACTGGG - Intronic
1146009456 17:29181560-29181582 CAAGTGCCTGGGGCTGCACTTGG - Intergenic
1146041475 17:29458766-29458788 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1146479361 17:33192307-33192329 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1146555402 17:33818824-33818846 CACCAGCCAAGGGCTGCTCTAGG - Intronic
1146625559 17:34432497-34432519 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1146774532 17:35601401-35601423 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1146906613 17:36622141-36622163 CAGGGGCCAGAGGCTGGGCTGGG + Intergenic
1146939362 17:36833507-36833529 CGGGAGCCAGGTGCTGTTCTAGG + Intergenic
1147202274 17:38810845-38810867 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1147370029 17:39986167-39986189 CAGGAGTCTGAGCCTGCACTGGG - Intronic
1147433007 17:40385525-40385547 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1147503612 17:40991364-40991386 CAGGAGGCAGAGGCTGCACTGGG - Intergenic
1147546576 17:41406564-41406586 CAGGCTGCAGGGGCTGGACTAGG + Intergenic
1147751335 17:42735909-42735931 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1147911010 17:43856283-43856305 CGGGAGCCGGGAGCTGCACATGG - Intronic
1147931274 17:43983156-43983178 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1148398157 17:47327237-47327259 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1148459456 17:47830577-47830599 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1148517480 17:48233780-48233802 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1148974151 17:51512114-51512136 CATGTCCCAGGGGCTGCCCTGGG - Intergenic
1149653035 17:58289606-58289628 CAGGAGGCAGAGGTTGCATTGGG + Intergenic
1149655655 17:58308500-58308522 CAGCAGGCAGGGGCTGCCCAGGG + Intronic
1149825622 17:59825158-59825180 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1150192564 17:63258775-63258797 CAGGAGCCAAGGCCTGGAATTGG + Intronic
1150221523 17:63498053-63498075 CAGGAGCCAAGGTAAGCACTAGG - Intronic
1150268700 17:63848706-63848728 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1150317466 17:64181400-64181422 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1150365672 17:64581869-64581891 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1150484592 17:65534854-65534876 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1151615870 17:75211074-75211096 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1151713880 17:75821736-75821758 CGGAAGCCCGGGGCTGCCCTGGG + Intronic
1151749095 17:76026873-76026895 CAGGAGGCAGGGGATGACCTGGG - Intronic
1151869253 17:76825474-76825496 CAGGAGAGAGAGGCTGCCCTAGG - Intergenic
1151941373 17:77294344-77294366 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1151999313 17:77635388-77635410 CAGGTGGGAGGGGCTGCTCTGGG + Intergenic
1152103052 17:78314115-78314137 CTGGAGCCCGGGGCGGCCCTTGG + Intergenic
1152398478 17:80049599-80049621 AAGGAGCTGGGGGCTGCACAGGG + Intronic
1152766904 17:82146451-82146473 CAGGAGGTCGGGGCTGCAGTGGG - Intronic
1152777341 17:82210918-82210940 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1153097141 18:1419797-1419819 CGGGAGGCAGAGGCTGCAGTGGG + Intergenic
1153641728 18:7163408-7163430 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1153953649 18:10077327-10077349 GAGGGGGCAGGGGCTGCAGTGGG - Intergenic
1154491194 18:14923519-14923541 CAGGAGACAGGGCCTGGAGTCGG - Intergenic
1155183487 18:23368171-23368193 CGGGAGTCAGAGGCTGCCCTGGG - Intronic
1155443481 18:25885556-25885578 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1155556696 18:27027987-27028009 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1155808674 18:30205331-30205353 CAGGAGGCAGAGGTTGCAATGGG + Intergenic
1155948452 18:31882688-31882710 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
1156033859 18:32744401-32744423 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1156342172 18:36219603-36219625 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1157065281 18:44342165-44342187 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1157172384 18:45419698-45419720 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1157275071 18:46304557-46304579 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1157309176 18:46538973-46538995 CAGGAGGCGAGGGCTGCACCAGG + Intronic
1157373754 18:47143363-47143385 CAGGAGTATGGGGCTGCAGTGGG + Intronic
1157588343 18:48819504-48819526 CAGCAGCCAGGGCCGGCGCTCGG - Intronic
1157683834 18:49627257-49627279 CAGGAGCCAGGGGCCACGCTGGG - Intergenic
1157898728 18:51493103-51493125 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1158245978 18:55432227-55432249 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1158358160 18:56642848-56642870 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
1158396891 18:57086233-57086255 CAGGAGGCAAAGGTTGCACTGGG + Intergenic
1158481208 18:57823514-57823536 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1158938475 18:62385548-62385570 CAGGAGTTAGAGGCTGCACCGGG - Exonic
1159225089 18:65523294-65523316 CAGGAACTAGGGCCTGCAATGGG - Intergenic
1160371325 18:78374034-78374056 GAGGCAGCAGGGGCTGCACTTGG + Intergenic
1160836918 19:1129191-1129213 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1160839254 19:1138234-1138256 GAGGCACCAGGGGCTGCCCTGGG + Intronic
1160848812 19:1179736-1179758 CAGCAGGCAGAGGCTGCAGTGGG - Intronic
1160891024 19:1378878-1378900 CAGCAGCCAGGGGCCTCACTGGG + Intergenic
1161031519 19:2059901-2059923 CAGGAGCCCGGGGCAGCCATGGG + Intergenic
1161037358 19:2092682-2092704 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1161057936 19:2200014-2200036 CAGGAGCGAGGGGCCGCTCCCGG - Intronic
1161206517 19:3044097-3044119 CAGGAGACAGAGGTTGCAGTGGG + Intronic
1161252204 19:3286168-3286190 CAGGGGTCAGCGGCTGCACCGGG - Intronic
1161302835 19:3551326-3551348 CAGGAGCGAGGGTCTGCAGTCGG + Intronic
1161489691 19:4555193-4555215 CTGGAGACAGGGGCTCCCCTAGG - Intronic
1161526398 19:4758735-4758757 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
1161541625 19:4855174-4855196 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1161617599 19:5280645-5280667 CAGGAGGCAGAGGGTGCAGTGGG + Intronic
1161633737 19:5373884-5373906 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
1161643283 19:5436994-5437016 TAGGGTCCAGGGGCTGGACTTGG + Intergenic
1161664325 19:5565711-5565733 CAGGAGTCTGGGGCTGCAATGGG - Intergenic
1161804512 19:6434833-6434855 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
1162102958 19:8351588-8351610 CAGGAGGCAGAGGTTGCAATGGG + Intronic
1162148466 19:8628460-8628482 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1162229382 19:9253108-9253130 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1162288249 19:9757119-9757141 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1162369781 19:10271652-10271674 CTGGGGCCAGGTGCTGCGCTGGG - Intronic
1162538977 19:11282177-11282199 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1162584136 19:11548761-11548783 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1162618273 19:11819470-11819492 CAGGAGGCAGAGGCTGCGGTGGG - Intronic
1162657762 19:12144358-12144380 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1162658692 19:12152766-12152788 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1162674346 19:12287286-12287308 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1162693066 19:12449728-12449750 CAGGAGCTAGGGCCTGCAAAGGG + Intronic
1162818505 19:13209623-13209645 CAGGGGCCAGGGGATGCCATGGG + Intronic
1163433730 19:17282978-17283000 CAGGAGCCCGAGCCTGCACCTGG + Exonic
1163484719 19:17578934-17578956 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1163512982 19:17747268-17747290 CCGGATCCCGGGGCTGCCCTAGG + Intergenic
1163836381 19:19577119-19577141 CAGGAGGCTGAGGCTGCAGTGGG + Intronic
1164240427 19:23383612-23383634 CAGAAGGCAGAGGCTGCAGTTGG + Intronic
1164534365 19:29074357-29074379 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1164549823 19:29200445-29200467 CAGGAGACAGAGGTTGCAATGGG - Intergenic
1164739285 19:30564615-30564637 CGAGCGCCAGGGGCTGCGCTTGG - Intronic
1165354727 19:35296398-35296420 CACGTGCCAGGTGCTGCTCTGGG - Intronic
1165684799 19:37810109-37810131 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1165756328 19:38295308-38295330 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1165822114 19:38683311-38683333 GGAGAGGCAGGGGCTGCACTGGG - Intronic
1165827522 19:38713806-38713828 GAGGAGGCAGGGGGTGCACACGG - Intronic
1165865094 19:38932060-38932082 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1166063799 19:40344403-40344425 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1166412338 19:42564225-42564247 CAGGGGCCAGGGACTGTGCTAGG + Intergenic
1166435849 19:42766107-42766129 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166445729 19:42856135-42856157 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166453120 19:42918283-42918305 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166465394 19:43026869-43026891 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166471527 19:43083074-43083096 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166765944 19:45252062-45252084 CCGGAGCCAGAGGCAGGACTGGG - Intronic
1166794515 19:45418444-45418466 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1166811394 19:45516515-45516537 CAAGAGCCCAGAGCTGCACTAGG - Intronic
1166956138 19:46466067-46466089 CAGGAGGTAGAGGCTGCAGTGGG + Intergenic
1167217990 19:48177652-48177674 CCGGAGCAAGGGGCTGTCCTAGG + Intronic
1167464947 19:49645768-49645790 CAGCGGCGAGGGGCTGCGCTGGG + Intronic
1167497724 19:49829350-49829372 CTGGAGGCAGAGGCTGCAGTGGG - Intronic
1167562322 19:50233241-50233263 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1167861391 19:52286907-52286929 CAGTAGGCAGAGGCTGCAGTGGG - Intronic
1167914228 19:52726937-52726959 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1168107372 19:54173070-54173092 CAGAAGCCTGGGGCTCCTCTAGG - Exonic
1168111794 19:54196501-54196523 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
1168323125 19:55521976-55521998 CCAGAGCCAGGGCCAGCACTGGG - Intergenic
1168328956 19:55554957-55554979 CAGGAGCCAGGGGCAGGTGTAGG + Intergenic
1168505214 19:56928474-56928496 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
925341961 2:3144032-3144054 CAGGAAAGAGGGGATGCACTTGG - Intergenic
925588499 2:5487157-5487179 CAGGAGCTAGTGCCTGCAATGGG - Intergenic
925967451 2:9079108-9079130 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
926017865 2:9470146-9470168 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
926137786 2:10348703-10348725 CAGGAGTCTGAGGCTGCAATGGG + Intronic
926181132 2:10644172-10644194 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
926250253 2:11151707-11151729 CAGGAGGCACAGGTTGCACTGGG - Intergenic
926322185 2:11756460-11756482 CAGGAGGCAGAGGTTGCAATGGG - Intronic
926561215 2:14419383-14419405 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
926733408 2:16054599-16054621 CAGGAGGTAGGGGTTGCAGTGGG + Intergenic
926948625 2:18216725-18216747 CAGGAGACAGAGGTTGCAGTAGG + Intronic
927085370 2:19669921-19669943 CAGCAGCCAGTGGCGTCACTAGG - Intergenic
927222695 2:20728644-20728666 GAGGAGGCAGGGGTGGCACTGGG + Intronic
927509723 2:23636887-23636909 CTGGAGGCAGGGGCTGCTCCAGG + Intronic
927696533 2:25243229-25243251 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
927792331 2:26020072-26020094 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
927988033 2:27427398-27427420 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
928058747 2:28087720-28087742 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
928069521 2:28200840-28200862 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
928116558 2:28549186-28549208 CAGGACCCAGAGGCAGCATTTGG - Intronic
928341340 2:30445813-30445835 CAGGAGGCAGGGGTTGTAGTGGG + Intergenic
928505967 2:31953291-31953313 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
928647622 2:33371297-33371319 GAGGAGTCAGGGGCTGCAATGGG - Intronic
928925195 2:36571579-36571601 CAGGAGGTAGAGGCTGCAGTGGG + Intronic
929102470 2:38329352-38329374 CAGGAGGCAGAGGGTGCAGTGGG + Intronic
929246331 2:39707543-39707565 CAGGAGACAGAGGTTGCAGTGGG - Intronic
929534239 2:42770463-42770485 CAAGAGGCAGGGGCTGGGCTGGG + Intronic
929546378 2:42857457-42857479 CAGAAGCCAGCTGCAGCACTAGG - Intergenic
929762567 2:44818154-44818176 GAGGTGCCAGGGTGTGCACTTGG - Intergenic
930012846 2:46950655-46950677 CAGTAGCCACTGGCTGCACATGG + Intronic
930431158 2:51278309-51278331 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
930746258 2:54886237-54886259 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
930785345 2:55266839-55266861 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
931406951 2:61988457-61988479 CAGGAGCTAGGGCCTGGAATGGG + Intronic
931412430 2:62045809-62045831 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
931474088 2:62570577-62570599 CAAGAGTCAGGGGCTGGGCTGGG - Intergenic
931490445 2:62739860-62739882 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
931524307 2:63135803-63135825 CAGGAGTTAGAGGCTGCAGTAGG - Intronic
931572221 2:63680892-63680914 CAGGAGCTAGGGCCTGGAATGGG - Intronic
932021954 2:68096298-68096320 CAGGAGGCAGAGGTTGCAATGGG + Intronic
932134335 2:69215073-69215095 CAGGATGGAGGGGCTGCAATTGG - Intronic
932152748 2:69387571-69387593 CTGGGGCCTGGGGCTGCACGGGG - Intergenic
932432584 2:71684850-71684872 CATGAGGAAGGGGCTGCACTAGG + Intronic
932453075 2:71828167-71828189 CAAGGGCCAGGGGCTGCAGAGGG - Intergenic
932470907 2:71955937-71955959 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
933369996 2:81402245-81402267 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
933844838 2:86316783-86316805 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
933977513 2:87523297-87523319 CAGGTGCAAGGGGCTCCACTGGG + Intergenic
934014647 2:87866792-87866814 CAGGGGCCAGGGGCCTCACGTGG + Intergenic
934147344 2:89108547-89108569 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
934221927 2:90092045-90092067 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
934483028 2:94671741-94671763 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
934539500 2:95162187-95162209 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
934785811 2:97004857-97004879 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
935032248 2:99334278-99334300 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
935647522 2:105352516-105352538 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
935675745 2:105593938-105593960 CAGGAGCAAGGGGCTGTCCTGGG - Intergenic
935812905 2:106817421-106817443 CAGGAGCTAGGGCCTGGAATGGG - Intronic
935940878 2:108238053-108238075 CAGGAGGTAGAGGCTGCAGTGGG + Intergenic
935992012 2:108727675-108727697 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
936127330 2:109800376-109800398 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
936217367 2:110571109-110571131 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
936316311 2:111427509-111427531 CAGGTGCAAGGGGCTCCACTGGG - Intergenic
936426508 2:112425683-112425705 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
936603596 2:113924968-113924990 CAGGAGTCAGAGGTTGCAGTAGG - Intronic
936606909 2:113967823-113967845 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
936940328 2:117878110-117878132 CAGGAGCCAGGGCCTAGAGTCGG + Intergenic
937032486 2:118752407-118752429 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
937155462 2:119715780-119715802 CAGGAGACATGGGGTGCACCAGG - Intergenic
937171649 2:119877750-119877772 CAGGAAGCTGGGGCTGGACTGGG - Intronic
937215475 2:120310090-120310112 CGGGAGGCAGAGGCTGCAGTGGG + Intergenic
937326046 2:120990015-120990037 GGGGAGGCCGGGGCTGCACTAGG - Exonic
937812042 2:126210093-126210115 CAGGTGCAAGGGGCAGCACATGG - Intergenic
937909056 2:127066583-127066605 GAGGAACCAGGGGCTGGAGTGGG - Intronic
938266571 2:129932578-129932600 CTGGAGCCTGGGGCTGAGCTGGG + Intergenic
938288300 2:130136436-130136458 CAGAGGCCTGGGGCTGCAGTTGG - Intergenic
938780925 2:134584026-134584048 TAGGAGCCAGGTGCTGCTCTAGG - Intronic
938971786 2:136439469-136439491 CTGGAGCAAGGGGCTGCCTTTGG + Intergenic
939201509 2:139041575-139041597 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
939663485 2:144920215-144920237 CAGGAGGCAGGGGTTGCAATGGG - Intergenic
939923048 2:148140837-148140859 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
939979210 2:148758467-148758489 CAGGAGGCAGAGGTTGCACTGGG - Intronic
941074110 2:160987863-160987885 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
941695089 2:168542768-168542790 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
941811615 2:169760982-169761004 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
941824330 2:169876629-169876651 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
941999118 2:171628555-171628577 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
942100064 2:172571903-172571925 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
942103722 2:172612739-172612761 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
942291834 2:174480841-174480863 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
942975793 2:182015706-182015728 CAGGAGCTAGGGCCTGGAATGGG + Intronic
943646414 2:190411231-190411253 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
943710569 2:191090632-191090654 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
944078615 2:195759602-195759624 CAGGAGCCAAGGCCTGGAATTGG - Intronic
944091274 2:195914735-195914757 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
944642876 2:201745873-201745895 CAGGAGGCAGAGGTTGCAATGGG + Intronic
946401306 2:219469733-219469755 CAGGTGCCAGGCCCTGCTCTGGG - Intronic
946576557 2:221082113-221082135 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
946904698 2:224405300-224405322 CAAGAGCCAGGCGTTGCACCAGG + Intergenic
947404107 2:229756719-229756741 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
947504435 2:230696147-230696169 CAGGAGGCAGAGGCTACAGTGGG + Intergenic
947595558 2:231409579-231409601 CAGAAGCCAGGTCCTGCTCTGGG + Intergenic
947644796 2:231730711-231730733 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
947661454 2:231872144-231872166 CGGGAGGCAGGGGTTGCAGTAGG - Intergenic
947864882 2:233389742-233389764 CAGGAGGCAGGGGCTGTGCCGGG + Intronic
947936793 2:234012219-234012241 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
948732235 2:239973998-239974020 CAGGAGGCGGGGGTTGCAGTGGG - Intronic
948922315 2:241071541-241071563 CAGGAGGAAGGGGCTGGTCTGGG - Intronic
949058499 2:241942999-241943021 CAGGAGTCAGGGGCTGCACTGGG + Intergenic
1168763823 20:368357-368379 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1168814912 20:729618-729640 CAGGAGGCAGAGGCTGCAGCGGG + Intergenic
1169171787 20:3471179-3471201 CAGGAGCGGCGGGCCGCACTGGG + Exonic
1169555326 20:6743529-6743551 CAGGAGCCAGAGGTTTCACATGG - Intergenic
1169914604 20:10673268-10673290 CAGGAGGCAGGGGCTCCCGTGGG + Intronic
1170039405 20:12024347-12024369 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1170224749 20:13980287-13980309 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1170605660 20:17873712-17873734 CAGGATCCAGGGAGAGCACTGGG - Intergenic
1170636681 20:18111728-18111750 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1170718255 20:18851113-18851135 CAGGAGTCTGAGGCTGCAGTGGG - Intergenic
1170864147 20:20138048-20138070 CAGGAGCCAGGGCCTGGAATAGG + Intronic
1171079163 20:22160504-22160526 CAGGATCCTGGGGCTGCACATGG + Intergenic
1171401577 20:24875948-24875970 CAGCAGCCAGGGGCTGGGGTGGG - Intergenic
1171522080 20:25783676-25783698 CAGGAGCCCTGGGCTGCAGGTGG + Intronic
1171529831 20:25845621-25845643 CAGGAGCCCTGGGCTGCAGGTGG + Intronic
1171554747 20:26072207-26072229 CAGGAGCCCTGGGCTGCAGGTGG - Intergenic
1171777607 20:29383932-29383954 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1171878239 20:30598060-30598082 CAGGAGCCAGGGAGTGCAGGTGG - Intergenic
1172288576 20:33758639-33758661 CAGTAGTCAGAGGCTGCCCTTGG + Intronic
1172303257 20:33864273-33864295 CAGCAACCAGGGGTTGCTCTGGG + Intergenic
1172506709 20:35468016-35468038 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
1172561748 20:35895095-35895117 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1172846771 20:37934312-37934334 CAGGAGACAGGAGGTGAACTGGG + Intronic
1173253196 20:41375353-41375375 CTTGCCCCAGGGGCTGCACTGGG + Intergenic
1173799644 20:45886976-45886998 CACAAGCCAGGGGCTGCCCTGGG - Exonic
1174165723 20:48582232-48582254 GAGGGGGCAGAGGCTGCACTGGG - Intergenic
1174210427 20:48873955-48873977 CAGGAGGTAGAGGCTGCAGTGGG - Intergenic
1174336163 20:49862333-49862355 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1174606517 20:51765881-51765903 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1174787319 20:53444867-53444889 AAGGAGCCAGGGGTTGGGCTGGG - Intronic
1174934126 20:54849223-54849245 CAGGTGCCAGGGGTTGAAATGGG - Intergenic
1175025630 20:55899355-55899377 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1175070497 20:56329397-56329419 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1175369049 20:58474628-58474650 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1175452356 20:59080394-59080416 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1175579994 20:60091034-60091056 AGGGAGCCAGGAGCTGAACTTGG - Intergenic
1175799217 20:61791740-61791762 GAGGAGCCAGATGCTGAACTGGG + Intronic
1175930801 20:62492927-62492949 CAGGAGCCAGATGCTCCACTGGG - Intergenic
1176050657 20:63117780-63117802 CAGGAGCGAGGGGGTGAACGCGG + Intergenic
1176176500 20:63728843-63728865 TAGGAGCCAGGGGCAGCCCCAGG + Intronic
1176180840 20:63748601-63748623 CAGGGGCCAGGGGTTGCTATTGG - Intronic
1176290188 21:5039680-5039702 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1176741451 21:10607263-10607285 CAGGAGCCAAGAGCCCCACTAGG + Intergenic
1176962388 21:15174071-15174093 CGGGAGGCAGAGGCTGCAGTGGG - Intergenic
1177112860 21:17049491-17049513 CAGGAGCCATGGGCTGTAGCTGG - Intergenic
1177632918 21:23750315-23750337 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1177827810 21:26103525-26103547 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1178120814 21:29468249-29468271 CAGGAGGGAGAGGCTGCAGTGGG - Intronic
1178260546 21:31096506-31096528 CAGGAGCTTGGGGCTGTGCTGGG - Intergenic
1178367415 21:31999115-31999137 CAGGGGCTAGGGGCTGCAGTGGG - Exonic
1179157502 21:38863025-38863047 CAGGAACCAGGGCCTACCCTTGG - Intergenic
1179355040 21:40651176-40651198 CAGGAGACAGGGCCTGGAGTTGG - Intronic
1179474168 21:41632822-41632844 CAGGTGGCAGGGGCTGTACCTGG - Intergenic
1179539024 21:42072160-42072182 CAGGAGCCAGAGGCTGCACCAGG + Intronic
1179780097 21:43694087-43694109 TAAGAGCCGGGGGCTGCGCTGGG - Exonic
1179812529 21:43881727-43881749 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1179820527 21:43934458-43934480 CAGGAGGCTGGGCCTCCACTAGG + Intronic
1179867067 21:44223961-44223983 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1180070751 21:45434894-45434916 CAGGAACCAGGGCCTGGTCTAGG - Intronic
1180079007 21:45477854-45477876 CAGGACCCAGGGGACTCACTGGG - Exonic
1180314976 22:11270236-11270258 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1180608990 22:17083927-17083949 CAGGAGCGTGTGGATGCACTAGG + Intergenic
1180624640 22:17186081-17186103 CAGCAGCCAGGGCCTGCATGGGG + Intronic
1180644486 22:17327263-17327285 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1180729149 22:17968394-17968416 CAGGAGCCGGGAGCTGCTCTGGG + Intronic
1180836176 22:18930609-18930631 CATGAGCCAGGGACTGCTCCAGG - Intronic
1181462623 22:23094536-23094558 AAGGAGCTGGGGGCTGCACGTGG - Intronic
1181602542 22:23960963-23960985 CGGGGGCCTGGGGGTGCACTGGG + Intronic
1181605972 22:23980344-23980366 CGGGGGCCTGGGGGTGCACTGGG - Intronic
1181715664 22:24725818-24725840 CAGGAACCAGGGGGAGCACAGGG - Intronic
1181757538 22:25035116-25035138 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1181787601 22:25238264-25238286 CACTAACCAGGGGCTGCCCTAGG - Intergenic
1181819342 22:25463302-25463324 CACTAACCAGGGGCTGCCCTAGG - Intergenic
1181967301 22:26666309-26666331 GGGGAGCCAGAGGCTGGACTAGG - Intergenic
1182089526 22:27584526-27584548 CATGAGCCAGGCGCTGTTCTAGG - Intergenic
1182286431 22:29251156-29251178 CAGGAGGCTGAGGCTGCACTGGG - Intronic
1182301923 22:29341832-29341854 CATGAGCCAGGTGCGGCACAGGG + Intronic
1182322327 22:29486090-29486112 CAGGAGGGAGAGGCTGCAGTGGG - Intronic
1182438539 22:30347221-30347243 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
1182610004 22:31539787-31539809 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1182641634 22:31772853-31772875 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1182708348 22:32304198-32304220 CAGGAGACAGAGGTTGCAGTAGG - Intergenic
1182711745 22:32327591-32327613 CACGTGCCAGGCTCTGCACTGGG - Intergenic
1182793593 22:32973860-32973882 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1183212624 22:36460184-36460206 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1183363485 22:37395029-37395051 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1183454380 22:37913818-37913840 CAGGAGGGAGGGGCTGAAATGGG - Intronic
1183637806 22:39075553-39075575 CGGGAGGCAGAGGTTGCACTGGG - Intronic
1183977742 22:41523085-41523107 CAGGTCCCAGTGGCTGCCCTGGG + Intronic
1184097147 22:42322499-42322521 GAGGAGGCAGGGCCTGAACTGGG + Intronic
1184126220 22:42489189-42489211 CAGGAGTCCGAGGCTGCAGTGGG + Intergenic
1184155411 22:42663557-42663579 CAGGAGCTAGGGGCTGCTCTGGG + Intergenic
1184289335 22:43490063-43490085 GAGCAGCCAGGGGCAGAACTGGG + Intronic
1184417993 22:44363322-44363344 CAGGCACCAGGGGCTGCAGATGG - Intergenic
1184422439 22:44389842-44389864 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1184448809 22:44570760-44570782 GAGGAGTCAGGGACTGAACTAGG - Intergenic
1184496933 22:44847507-44847529 CAGCAGCCAGTAGCTGCACATGG - Intronic
1184518227 22:44976095-44976117 CAGGAGGCTGAGGCTGCAGTGGG + Intronic
1184582586 22:45427706-45427728 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1184840536 22:47050076-47050098 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1184997810 22:48223262-48223284 GAGTCGGCAGGGGCTGCACTGGG - Intergenic
1185035725 22:48475776-48475798 CCTGAGCCAGGGGCTGCCCTGGG - Intergenic
1203286268 22_KI270734v1_random:155908-155930 CATGAGCCAGGGACTGCTCCAGG - Intergenic
949226066 3:1697815-1697837 CAGGAGGCAGAGGCTGCTGTGGG - Intergenic
949269509 3:2197939-2197961 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
949771744 3:7586732-7586754 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
950401905 3:12775428-12775450 CTGGAGCAAGGGGCTGCATCTGG + Intergenic
950474088 3:13204872-13204894 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
950499912 3:13357214-13357236 TATGAGCCAGGGTCTGCTCTAGG + Intronic
950573918 3:13819474-13819496 GGGGAGCTGGGGGCTGCACTTGG - Intronic
950574353 3:13822863-13822885 CAGGAGCCATTTTCTGCACTAGG - Intronic
950637189 3:14323548-14323570 CAGGACCCAAGTGCTGCCCTTGG - Intergenic
950654984 3:14431000-14431022 CAAGTGCCAGGGGATGCCCTGGG - Intronic
951702543 3:25510550-25510572 CAGGAGGCAGAGGCTGCATTGGG + Intronic
952566801 3:34668920-34668942 CAGGAGCTAGGGGCTGGGATGGG - Intergenic
952740404 3:36728893-36728915 CAGGGTCCAGGGGCTGCACTTGG - Intronic
952811935 3:37411815-37411837 CAGGAGCTAGGGCCTGGAATGGG + Intronic
953166420 3:40469166-40469188 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
953498432 3:43408956-43408978 CAGGAGAAAGAGGCTGCAGTGGG + Intronic
953707986 3:45245571-45245593 TATGAGCCTGGGGCTGCCCTGGG + Intergenic
953762027 3:45696069-45696091 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
953850817 3:46464435-46464457 CAGGAGCTAGGATCTGGACTAGG + Intronic
954126600 3:48534880-48534902 CAGGAGACAGAGGTTGCAGTGGG - Intronic
954184034 3:48903166-48903188 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
954338923 3:49937977-49937999 CAGGAGCCAGGGCCTTCTGTGGG + Intergenic
954345455 3:49993866-49993888 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
954375483 3:50192189-50192211 CAGAAGCCAGGAGCCTCACTGGG + Intronic
955248654 3:57254696-57254718 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
955441055 3:58955892-58955914 CAGGAGCCAGGGCCTGGAAAGGG - Intronic
955542414 3:59991675-59991697 CAGGAGCCAGGGTCTGCTCTCGG - Intronic
955646928 3:61149804-61149826 CAGGAGTTAGAGGCTGCAATGGG + Intronic
955729621 3:61971124-61971146 CAGGAGGCAGAGGATGCAGTTGG - Intronic
955979203 3:64507859-64507881 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
956102006 3:65778354-65778376 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
956115422 3:65913188-65913210 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
957064260 3:75508413-75508435 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
957073482 3:75583099-75583121 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
957281252 3:78154179-78154201 CAGGAGCCAGGGGCCCAGCTTGG + Intergenic
957882431 3:86237276-86237298 CATGTGCCAGGGGCTGTGCTAGG - Intergenic
958102029 3:89024321-89024343 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
958147139 3:89640189-89640211 CAGGAGCCAAGGCCTGGAATTGG - Intergenic
959127528 3:102308123-102308145 CAGGAGCCAAGGTCTGGAATCGG - Intronic
959336045 3:105066505-105066527 TAGGAGCCAGGGCCTGGAGTGGG - Intergenic
959501798 3:107114906-107114928 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
960520976 3:118654995-118655017 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
960802318 3:121551949-121551971 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
960903552 3:122575833-122575855 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
960951298 3:123000271-123000293 CAGGAGAGAGGAGCTGGACTGGG + Intronic
960960991 3:123070014-123070036 CAGGAGGCAGAGGGTGCAGTGGG + Intronic
961179001 3:124861391-124861413 CAGGAGCTCCGGGCTGCAGTGGG + Intronic
961280606 3:125763620-125763642 CAGGAGGCAGAGGTTGCACAGGG - Intergenic
961352838 3:126315041-126315063 CAGGAGCCAGGAGGGGGACTTGG - Intergenic
961446718 3:126984499-126984521 CAGAGGCCAGGTGCTGCACCAGG + Intergenic
961573804 3:127819167-127819189 CAGGTGTCAGCCGCTGCACTGGG - Intronic
961766947 3:129218855-129218877 CCTGAGCCAGGGGCAGCAGTGGG + Intergenic
961873795 3:130005909-130005931 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
962073457 3:132055751-132055773 CAAGATCCAGAGGCTGCATTTGG - Intronic
962540844 3:136380313-136380335 CGGGAGACAGAGGCTGCAGTGGG - Intronic
962607487 3:137044778-137044800 CAGGGGCCGGGGGATGCTCTGGG + Intergenic
962759167 3:138492973-138492995 CATGAGCTAGGGGCTGGAATGGG + Intergenic
962766620 3:138569792-138569814 CAGGAGGCAGAGGTTGCACTGGG + Intronic
962779006 3:138693470-138693492 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
963120225 3:141769986-141770008 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
963145287 3:141987863-141987885 CAGGAGGCAGTGGTTGCAGTGGG + Intronic
963429144 3:145174817-145174839 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
963443683 3:145374393-145374415 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
963586714 3:147200953-147200975 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
963701479 3:148631284-148631306 TAGGAGCTAGGGTCTGCAATTGG - Intergenic
963867595 3:150379266-150379288 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
963884160 3:150561862-150561884 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
963909278 3:150801048-150801070 TAGGAGCTGGGGGCTGGACTAGG + Intergenic
964244278 3:154633032-154633054 CAGGAGCTAGGGGCTAGAATGGG + Intergenic
964258864 3:154811220-154811242 CAGGAGCCAGGACCTGGAGTTGG + Intergenic
964258970 3:154811870-154811892 CAGGAGCTAGGGCCTGTAATGGG + Intergenic
964363313 3:155921530-155921552 CATGAGCCACTGACTGCACTTGG - Intronic
964516996 3:157521715-157521737 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
964668396 3:159198775-159198797 CAGGAACTGGGGGCTTCACTGGG + Intronic
964781654 3:160345618-160345640 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
964821854 3:160779594-160779616 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
964929307 3:161997126-161997148 CAGGAGCTGGAGGCTGCAGTGGG - Intergenic
964961111 3:162427847-162427869 CAGGAGCCAGGGACTAGAGTTGG - Intergenic
965079025 3:164015231-164015253 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
965580281 3:170260533-170260555 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
966021602 3:175218877-175218899 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
966850940 3:184164710-184164732 GGCAAGCCAGGGGCTGCACTGGG - Intronic
966880069 3:184345133-184345155 GAGGAGGCAGGGGCTGGGCTGGG + Exonic
966887229 3:184383420-184383442 TAAGAGCCAGGGGCTGCAGAAGG + Intronic
967098628 3:186197497-186197519 CAGGCCCCGGGGGCTGCACAGGG - Intronic
967809592 3:193745716-193745738 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
968048211 3:195635570-195635592 CAGGAGGCAGGGGCGGCCCCAGG - Intergenic
968082394 3:195855419-195855441 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
968099193 3:195954050-195954072 CAGGAGGCAGGGGCGGCCCCAGG + Intergenic
968306400 3:197654351-197654373 CAGGAGGCAGGGGCGGCCCCAGG + Intergenic
968343946 3:197984525-197984547 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
968390580 4:189132-189154 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
968520303 4:1032046-1032068 CCGGAGCCAGGGGCTGCCGCAGG + Intergenic
968727601 4:2255565-2255587 CCTCAGCCCGGGGCTGCACTGGG + Intronic
968886957 4:3340221-3340243 CAGGAGCCGGGCGCTGTGCTGGG + Intronic
969017069 4:4110405-4110427 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
969045439 4:4333240-4333262 TAGGAGGCAGAGGTTGCACTGGG + Intergenic
969212228 4:5696567-5696589 CAGGAGCCAGGGACTGCCCGCGG + Intronic
969322181 4:6418941-6418963 GAGGACCCAGGGGAAGCACTGGG - Intronic
969529014 4:7719589-7719611 TCGGAGCCAGGGGCAGCCCTGGG + Intronic
969601432 4:8178840-8178862 CAGGAGGTAGAGGCTGCAGTGGG - Intergenic
969685285 4:8669849-8669871 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
969696669 4:8738803-8738825 CTGGGCCCTGGGGCTGCACTGGG + Intergenic
969859829 4:10026968-10026990 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
969874120 4:10123499-10123521 AAGGAACCAGGGGCAGCATTGGG - Intergenic
969986137 4:11213042-11213064 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
970561014 4:17282386-17282408 CAGGAGCCAGAGGGTCCACCGGG - Intergenic
970585612 4:17511831-17511853 CACGAGTCAGGGGGTGCACAGGG + Intronic
971315348 4:25563385-25563407 CATGAGGCAGGGGCTGTATTTGG + Intergenic
971401140 4:26276199-26276221 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
971487455 4:27174725-27174747 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
972253882 4:37333105-37333127 CATGAGCCAGGGCCTGGAGTTGG - Intronic
972618678 4:40724572-40724594 CAGGAGGCGGAGGCTGCAGTGGG + Intergenic
973169401 4:47120770-47120792 CAGGAGCTAGGGTCTGCAGTGGG + Intronic
973551198 4:52038012-52038034 CAGGAGCCAGGGGCGGCCTCGGG - Intronic
973872989 4:55185450-55185472 GAGGAGCCAGGGCTTGCCCTTGG - Intergenic
974236123 4:59183499-59183521 CAGGAGGCAGAGACTGCAGTGGG + Intergenic
974292346 4:59948657-59948679 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
974497707 4:62654512-62654534 CAGAAGCCAGGGGTTGCAAATGG - Intergenic
974551441 4:63379982-63380004 CAGGATCCATGGGCTACAGTTGG + Intergenic
974701947 4:65462548-65462570 CAGGAGTCTGGGGCTTCAGTGGG + Intronic
974857977 4:67483282-67483304 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
975150078 4:71011428-71011450 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
975335418 4:73170275-73170297 CAGGAGCTAGGGTCTGGAATGGG - Intronic
976021862 4:80639167-80639189 CATAACCCAGGTGCTGCACTAGG + Intronic
976072147 4:81253834-81253856 CAGGGGCTAAGGGCTGCCCTGGG - Intergenic
976161266 4:82201797-82201819 CAGGAGCTAGGGCCTGGAATTGG - Intergenic
976211185 4:82671805-82671827 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
976610738 4:87027865-87027887 CAGGAGGCAGAGGTTGCAATGGG - Intronic
976722119 4:88178910-88178932 TGGGAGCCAGGGACTGCAGTTGG - Intronic
976762766 4:88568409-88568431 CATGAGCCAGGGCCTGGAGTTGG + Intronic
976859931 4:89652054-89652076 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
976932853 4:90590198-90590220 CAGGAGAAAGAGGTTGCACTGGG + Intronic
978258310 4:106719018-106719040 CAGGAGCCAAGGCCTGGACAAGG - Intergenic
978805448 4:112795575-112795597 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
979213326 4:118132858-118132880 CAGGAGCTAGGGCCTGGAATGGG + Intronic
979395109 4:120178285-120178307 CAGGAGCCAGGGTCTGCAGTTGG - Intergenic
979396691 4:120197731-120197753 CAGGAGCTAGGGACTGGAATGGG - Intergenic
979940708 4:126758810-126758832 CTGGAGCCTGGGGCTGCAGTGGG + Intergenic
981079546 4:140624976-140624998 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
981790975 4:148536104-148536126 CAGGAGGCCGAGGCTGCAGTGGG - Intergenic
982028593 4:151276967-151276989 CAGGACCCAGGGGAGGAACTGGG - Intronic
982040935 4:151395676-151395698 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
982109540 4:152041252-152041274 CAGGAGCCAGGGTCTCCCCAGGG + Intergenic
982242039 4:153309695-153309717 CAGGAGGCAGTGGTTGCAGTGGG - Intronic
982932649 4:161428572-161428594 CAGGAGCGAGGGCCTGGAATGGG - Intronic
983464848 4:168074402-168074424 CAGGAGGCAGGGACGGCAGTGGG + Intergenic
983493134 4:168412294-168412316 CAAGAGCCAGGGCCTGCACTTGG - Intronic
984015592 4:174422159-174422181 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
984129144 4:175851409-175851431 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
984449892 4:179886102-179886124 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
984537884 4:181000093-181000115 CAGGAGGCAGAGGCTGCTGTGGG - Intergenic
984593254 4:181639664-181639686 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
984595667 4:181664394-181664416 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
985106274 4:186503173-186503195 CAGGAGCAATGGGATGCACGTGG + Intronic
985384784 4:189434155-189434177 CAGGAGGAAGGGCCTGCAATGGG + Intergenic
985504703 5:272063-272085 CAGGAGGCAGGGGCGGCCCCAGG - Intronic
985547753 5:518641-518663 CAGGAGCCAGGGGCTGCACTGGG - Intronic
985550021 5:528262-528284 CAGGGGCCGGGGGCTGCGCCGGG + Intergenic
985562955 5:601173-601195 CAGGGGTCAGGGGCTGGAGTGGG + Intergenic
985666489 5:1183945-1183967 CGGGAGCCTGGGGCTGCGCCCGG - Intergenic
985677349 5:1238863-1238885 CAGGAGCCAGCGCCTGCTCCAGG + Intronic
985743410 5:1633532-1633554 CAGGAGGCAGGGGCGGCCCCAGG + Intergenic
986046604 5:4044245-4044267 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
986333543 5:6735832-6735854 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
986447248 5:7832167-7832189 CTGAAGCCAGGGGCTTCACAGGG + Intronic
986548354 5:8924474-8924496 CAAGAGCCAAGGCCTGCAGTTGG - Intergenic
986548401 5:8924770-8924792 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
986631212 5:9775734-9775756 CAGAAGCCAGGGCCTGGAATGGG + Intergenic
986756272 5:10839566-10839588 CAGGAGCCAGGTCCTGGAATAGG - Intergenic
986885172 5:12225682-12225704 CAGGAGTCAGGGCCTGGAGTTGG + Intergenic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
987537466 5:19207133-19207155 TAGGAGCCAGGGCCTGGAGTTGG - Intergenic
987756682 5:22105622-22105644 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
988241959 5:28623101-28623123 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
988410367 5:30878271-30878293 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
988437211 5:31190818-31190840 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
988527740 5:32001337-32001359 CAGAAGCCACAGGCTGCCCTCGG - Intronic
988608351 5:32702159-32702181 CAGGAGCCAGGGCCTAAAGTTGG + Intronic
988629888 5:32917594-32917616 CAGGAGTCAGGCACTGCTCTTGG + Intergenic
988883313 5:35529016-35529038 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
989261210 5:39421994-39422016 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
989381970 5:40817905-40817927 CAGGAGGCGGGGGCTGCAGTGGG + Intergenic
989445086 5:41518658-41518680 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
989534711 5:42550341-42550363 CAGAAGCCAGAGGCTGAACATGG - Intronic
990403026 5:55458812-55458834 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
990468464 5:56091207-56091229 CAGGAGGTAGGGGCTGCAGTGGG - Intergenic
990605124 5:57401683-57401705 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
990807505 5:59682002-59682024 CAGGATCAAGGGGCTGCATCTGG - Intronic
990992708 5:61701171-61701193 CAGGAGTCAGGGCCTACACAAGG - Intronic
991078483 5:62568498-62568520 CAGGAGACAGAGGTTGCAGTGGG + Intronic
991715687 5:69448948-69448970 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
991953107 5:71965936-71965958 CAGGAGCCAGGGGATGGAAGGGG - Intergenic
992077299 5:73203225-73203247 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
992255534 5:74917246-74917268 CAAGATCCAGGGGCTGCGTTTGG - Intergenic
992394131 5:76356317-76356339 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
992722525 5:79574804-79574826 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
993004521 5:82416136-82416158 CAGGAGGCAGAGGCTACAGTGGG - Intergenic
993287342 5:86016296-86016318 CAAGAGCCTGGGCCTGGACTTGG + Intergenic
994170013 5:96649240-96649262 CAGAAACCAAGGGCTGCAATGGG - Intronic
994719073 5:103359829-103359851 CAGGAGCTAGGGAGTGAACTGGG + Intergenic
995071353 5:107925555-107925577 CATTGGCCAGGGGCTGCTCTTGG - Intronic
995444623 5:112228918-112228940 AAGGTGCCAGGGCCTGCACTTGG + Intronic
995554620 5:113314659-113314681 CAGGAGGCAGAGGTTGCAGTAGG - Intronic
995998295 5:118326906-118326928 GAGGAGACTGGTGCTGCACTTGG - Intergenic
996022434 5:118605976-118605998 GAGGAACAAGAGGCTGCACTTGG - Intergenic
996459492 5:123725219-123725241 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
996532487 5:124541180-124541202 GAGGAGCAAGGGGCTGCTCAGGG - Intergenic
996560665 5:124825631-124825653 CAAGATCTAGGGGCTGCACCTGG + Intergenic
996737352 5:126770302-126770324 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
996901428 5:128546202-128546224 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
997124610 5:131213117-131213139 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
997131700 5:131283565-131283587 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
997475640 5:134140857-134140879 GGGGCGCCAGGGGCTGCAGTGGG - Intronic
997650418 5:135513531-135513553 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
997656429 5:135558145-135558167 CAGGGGCCAGGCCCTGTACTAGG - Intergenic
997736410 5:136215747-136215769 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
997909348 5:137854274-137854296 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
997962599 5:138334005-138334027 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
998207511 5:140168878-140168900 CATGTGCCAGGGACTGCTCTAGG - Intergenic
998241176 5:140446432-140446454 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
998263764 5:140651363-140651385 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
998291183 5:140916228-140916250 CAGGAGCCAAAGCCTGGACTTGG + Intronic
998521426 5:142804563-142804585 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
999163959 5:149531763-149531785 CAGGAGGCAGACGCTGCAGTGGG + Intronic
999166978 5:149557937-149557959 CAGGAGACAGAGGTTGCAGTGGG - Intronic
999232325 5:150069110-150069132 CAGGAGCCTGCGGCCGCGCTGGG - Intronic
999265639 5:150265107-150265129 CAGCCCCCAGGGGCTGCCCTGGG - Intronic
999453993 5:151699533-151699555 CATGAGCCAGGACCTGCACCAGG - Intergenic
999559237 5:152782292-152782314 CCAGAGCCATGGGCTGCTCTAGG + Intergenic
999784031 5:154874988-154875010 CAGGAGGCAGAGGGTGCAGTGGG - Intronic
999919564 5:156303753-156303775 CAGGAGCTAGGGCCTGGAATGGG + Intronic
1000006484 5:157189605-157189627 CAGGAGGCAGAGGTTGCAGTAGG + Intronic
1000094409 5:157958511-157958533 GATGAGCCAGGTACTGCACTGGG + Intergenic
1000109394 5:158093587-158093609 CAGGGGGCAGAGGCTGCAGTGGG - Intergenic
1000317002 5:160102034-160102056 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1001039336 5:168321609-168321631 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1001873083 5:175174510-175174532 CGGGAGGCAGAGGCTGCAGTGGG + Intergenic
1002026994 5:176402511-176402533 CAGGAGGCAGGGGAAGCCCTAGG - Intronic
1002035894 5:176469169-176469191 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1002301652 5:178260718-178260740 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1002390231 5:178905823-178905845 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1002595675 5:180320691-180320713 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1002844628 6:935744-935766 GGGAAGCCAGGGGCTGCCCTGGG - Intergenic
1003445485 6:6179891-6179913 CAGGAGTCAGGGGCTTGGCTGGG - Intronic
1003513252 6:6799138-6799160 CAGGGTCAAGGGGCTGCATTTGG + Intergenic
1003694561 6:8390519-8390541 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1003888101 6:10539261-10539283 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1003906232 6:10702164-10702186 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1003909767 6:10732719-10732741 CAGGAGCCAGGTCCTCCTCTAGG - Intergenic
1003934954 6:10966037-10966059 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1003948371 6:11095417-11095439 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1004130590 6:12915431-12915453 CAGGAGGCAGAGGTTGCACTGGG + Intronic
1004212091 6:13658534-13658556 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1004712183 6:18182610-18182632 CAGGAGTTTGAGGCTGCACTGGG - Intronic
1004896228 6:20150634-20150656 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1005032021 6:21518200-21518222 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1005157111 6:22819526-22819548 CGGGAGCTAGGGTCTGGACTGGG + Intergenic
1005217046 6:23542462-23542484 CAGGAGTCAGAGGCTGCAGTGGG + Intergenic
1006006055 6:31002455-31002477 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1006087269 6:31605003-31605025 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1006130604 6:31866818-31866840 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1006201404 6:32295260-32295282 CGGGAGGCAGGGGTTGCAGTGGG + Intronic
1006497639 6:34435240-34435262 AGGGAGCCAGGGACTACACTTGG - Intergenic
1006510365 6:34518060-34518082 CAGGACACTGGGCCTGCACTGGG + Intronic
1006873127 6:37271237-37271259 TGGGAGCCAGGGGTTGCAGTGGG + Intronic
1007099157 6:39232684-39232706 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1007138513 6:39546750-39546772 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1007543496 6:42672104-42672126 CAGGATGCAGAGGCTGCAGTGGG - Intronic
1007806172 6:44449936-44449958 CAGGAGGCAGAGGTTGCAGTGGG - Exonic
1008231371 6:48988191-48988213 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1008633840 6:53389795-53389817 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1008660513 6:53662708-53662730 CAAGAGCCAGGATCTGCAGTAGG - Intronic
1008695593 6:54032625-54032647 CAAGAGGCAGGGGTTGCAGTGGG - Intronic
1008707599 6:54181804-54181826 CATGAGCCAGGGCCTGTAATGGG + Intronic
1008731822 6:54491944-54491966 CAGGAGCTAGGGCCTGAAATAGG + Intergenic
1008991212 6:57604209-57604231 CAGGAGGCAGAGGTTGCAGTTGG + Intronic
1010434493 6:75813829-75813851 CAGGAGCTAGGGCCTGGAATGGG + Intronic
1010752636 6:79631760-79631782 CAGGAGCTGGGGGCTTCCCTCGG - Intronic
1010775360 6:79878965-79878987 CAGGAGCCTAGGCCTGAACTCGG - Intergenic
1010875287 6:81096740-81096762 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1011019022 6:82789769-82789791 CAGGAGCCAGGGCCTGGATTTGG - Intergenic
1011033165 6:82944310-82944332 CAGGAGCTAGGGCCTGGAATGGG - Intronic
1011291204 6:85779204-85779226 CAGGACCCAGGGCCTGGAATGGG + Intergenic
1011499843 6:87975946-87975968 CAGGAGCCAGAGGTTGCAGTGGG - Intergenic
1011584839 6:88913129-88913151 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1011676747 6:89742025-89742047 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1011789131 6:90879201-90879223 CAGAGGCTAGAGGCTGCACTGGG - Intergenic
1012316840 6:97791390-97791412 CAGGAGCCATGGGCTGGAGTGGG - Intergenic
1012974261 6:105763132-105763154 CAGGAGTCAGTGGCTGCTCAAGG - Intergenic
1013091861 6:106907364-106907386 CGGGAGGCAGAGGCTGCAGTGGG + Intergenic
1013313284 6:108917719-108917741 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1013422218 6:109977701-109977723 CAGGAGACAGAGGTTGCAGTGGG + Intergenic
1013782207 6:113741313-113741335 CAGGAGGAAGAGGCTGCAGTGGG + Intergenic
1014210110 6:118699766-118699788 CAGGAGGCGGAGGTTGCACTGGG - Intronic
1015253397 6:131151114-131151136 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1015427000 6:133082839-133082861 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1015498089 6:133901813-133901835 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1015665967 6:135629107-135629129 CAGAACACAGGGGCTGCCCTTGG + Intergenic
1015740676 6:136450108-136450130 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1016054575 6:139565892-139565914 TAGGAGCCGGGGCCTGCAGTTGG + Intergenic
1016729186 6:147409302-147409324 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1017120092 6:151016147-151016169 AAGGAGCTAGGGTCTGTACTTGG - Intronic
1017176741 6:151512231-151512253 CAGGAGACAGAGGCTGCAGTGGG - Intronic
1017311996 6:152985480-152985502 CAGGAGGCAGGGACTGCAGCGGG - Intergenic
1017396195 6:154002520-154002542 CAGGAGCCACGGGCTGGAGTCGG - Intergenic
1017687540 6:156928306-156928328 CAGGAGGAAGGGGATGGACTGGG + Intronic
1017845917 6:158258204-158258226 CAGGAGCCAGGGATTGGGCTAGG + Intronic
1018262925 6:161988412-161988434 CAGGAGGCAGGGGTTGCATGAGG + Intronic
1019096665 6:169586773-169586795 CAGGAGGCAGTGGTTGCAGTGGG + Intronic
1019188806 6:170238188-170238210 CAGGAGCCCGGTGCTGGGCTGGG + Intergenic
1019207193 6:170371827-170371849 CTGGCGCCAGGCGCTGCTCTTGG - Intronic
1019258851 7:68773-68795 CAGCACCCAGGGGCAGCACCAGG - Intergenic
1019515021 7:1435718-1435740 CAGGAGCCAGGAGACGCACGTGG + Intronic
1019522988 7:1468916-1468938 CTGGAGCCATGGGCTGCCCCAGG - Intergenic
1019523974 7:1472537-1472559 CAGGAGCCGGGAGCTGCCTTTGG + Intronic
1019543304 7:1560971-1560993 CAGGAGGCAGGGGTGGCACGTGG - Intergenic
1019941373 7:4294398-4294420 CAAGACCAAGGGGCTGCATTTGG - Intergenic
1019990444 7:4686672-4686694 TAGGAGCCAGTGCCTGCACTAGG - Intronic
1020006864 7:4787962-4787984 CAGGGTGCAGGGGCTGCCCTTGG - Intronic
1020169511 7:5834126-5834148 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1020202246 7:6088989-6089011 CCTGAGCCAGAGCCTGCACTGGG + Intergenic
1020234102 7:6342100-6342122 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
1021840316 7:24717076-24717098 CTGGACACATGGGCTGCACTGGG - Intronic
1021874721 7:25037657-25037679 CAGGAGTGAGGGGCATCACTGGG + Intergenic
1021875001 7:25040436-25040458 CAGGAGTGAGGGGCATCACTGGG + Intergenic
1021923106 7:25506539-25506561 CAGGAGCCAGGGCCTGGAATTGG - Intergenic
1022475240 7:30705747-30705769 CAGGCGCCATGGGCTGTCCTGGG + Intronic
1022491702 7:30825475-30825497 CAGGAGCCAAGGGAACCACTTGG + Intronic
1022605219 7:31806636-31806658 CATGAGCCAGGGCATGCACAGGG - Intronic
1022742255 7:33134122-33134144 CTGGAGGCAGGGGTTGCAGTGGG - Intronic
1022983040 7:35622773-35622795 CAGGAGGCAGAGGCTGCAGTAGG - Intergenic
1023036320 7:36134423-36134445 CAGGGGCAGGGGGCTGCACAGGG + Intergenic
1023182659 7:37501088-37501110 CGGGAGTTAGAGGCTGCACTCGG - Intergenic
1023233198 7:38055387-38055409 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1023494217 7:40777579-40777601 CATGAACCAGGAGCTACACTAGG + Intronic
1023646228 7:42318764-42318786 CAGGAGCTAGGGTCTGGAATAGG - Intergenic
1023686328 7:42739253-42739275 CATGAGCCAGGGGATGCAGGTGG - Intergenic
1023686850 7:42744774-42744796 CAGCATCCAGGGGCAGCAGTGGG + Intergenic
1023737423 7:43247562-43247584 CAGGAGTTAGAGGCTGCAGTGGG + Intronic
1023802058 7:43843723-43843745 CAGGAGCCAGTGGCTGGACGTGG + Intergenic
1023995445 7:45156710-45156732 CTGGAGCCAGGGCCTGTGCTAGG + Intergenic
1023997573 7:45171227-45171249 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1024002598 7:45200708-45200730 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1024095482 7:45979343-45979365 CATGAGCCAGGGGCTGAAAGGGG + Intergenic
1024235690 7:47395897-47395919 GAGGAGCCATGTGCTGCCCTGGG + Intronic
1024255033 7:47534198-47534220 CAGGAGTCAGAGGCTGCAGTAGG + Intronic
1024321805 7:48078295-48078317 CGGGAGGCAGAGGCTGCAGTTGG + Intergenic
1024548120 7:50539191-50539213 CAAAAGCCAGGGGCTGTCCTTGG - Intronic
1024774634 7:52769431-52769453 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1025302149 7:57826559-57826581 CAGGAGCCCTGGGCTGCAGGTGG - Intergenic
1025608066 7:63053753-63053775 CAGGAGGCGGAGGCTGCAGTGGG + Intergenic
1025994560 7:66519722-66519744 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1026059443 7:67013194-67013216 CAGGAGGCAGAGGCTGCAGTGGG - Intronic
1026193510 7:68151164-68151186 CTGGAGGCAGAGGCTGCAGTGGG + Intergenic
1026413361 7:70151545-70151567 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1026479694 7:70766769-70766791 CAGGAGGCTGGGACTGCATTGGG + Intronic
1026718650 7:72811836-72811858 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1026804279 7:73419950-73419972 TAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1026830555 7:73607520-73607542 CAGGAGGCAGGGGCTGGTCTTGG + Intronic
1026915656 7:74118706-74118728 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1026971641 7:74472230-74472252 CCGGGGCCAGGTGCTGCAGTGGG + Intronic
1027030138 7:74882040-74882062 TAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1027115842 7:75479540-75479562 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1027151452 7:75736994-75737016 CAGGAGGCTGAGGCTGCAGTGGG - Intronic
1027194578 7:76020862-76020884 CAGGAACCAAGGGCTTTACTTGG - Intronic
1027540573 7:79458945-79458967 CAAGAGCCAGGGACAGCACTGGG + Intergenic
1028181446 7:87729929-87729951 CAGGAGCTAGGGCCTGGAATGGG - Intronic
1028266618 7:88733799-88733821 CAGGAGCAAGGGCCTGGAATGGG + Intergenic
1028527199 7:91799734-91799756 CATGTGCCAGGACCTGCACTGGG + Intronic
1028842624 7:95444272-95444294 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1028856628 7:95600400-95600422 TAGGTGCCAGGAGCTGGACTGGG + Intergenic
1029075567 7:97931262-97931284 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1029253784 7:99255193-99255215 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1029431555 7:100534332-100534354 GAGGAGGCATGGGCAGCACTTGG + Intergenic
1029455527 7:100669146-100669168 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1029592123 7:101514262-101514284 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1029632489 7:101761707-101761729 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1030039453 7:105436755-105436777 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1030283956 7:107806114-107806136 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1030662700 7:112238756-112238778 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1030853915 7:114526401-114526423 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1031098446 7:117448707-117448729 CAGGAGTCAGGGCCTGGAATGGG - Intergenic
1031260033 7:119506975-119506997 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
1031729268 7:125277611-125277633 CAGGAGGCCGAGGCTGCAGTCGG + Intergenic
1031809471 7:126347712-126347734 CAGGAGCTAGAGGATGGACTGGG + Intergenic
1031892425 7:127310230-127310252 CAGGAGGCAGAGCCTGCAGTGGG + Intergenic
1031905712 7:127457984-127458006 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
1031930972 7:127685685-127685707 AAGGAGCCACTGACTGCACTTGG + Intronic
1032125647 7:129190484-129190506 CAGGAGCCAGGAGCAGAACTGGG + Intronic
1032146105 7:129382524-129382546 CAGGAGACAGAGGTTGCAGTGGG + Intronic
1032155878 7:129467381-129467403 CAGGATCAAGGGGATGCAGTTGG - Exonic
1032203042 7:129836804-129836826 CGGGAGGCAGAGGCTGCAGTGGG + Intronic
1032717143 7:134519071-134519093 CAGGAGGCAGTGGTTCCACTGGG - Intergenic
1032730710 7:134640069-134640091 AAGGTTCCAGGGGCTGCACTAGG - Intergenic
1032780503 7:135161873-135161895 CAGAAGCCACGGGCAGAACTGGG + Intronic
1032794095 7:135263729-135263751 CAGGAGCCATGGGCTAGAGTGGG - Intergenic
1033063304 7:138128617-138128639 CAGGAGCAAGGGAGTGCAGTGGG + Intergenic
1033317280 7:140307956-140307978 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1033379744 7:140803956-140803978 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1033413835 7:141145217-141145239 CAGGAGCCAGGGACTGACCGAGG - Intronic
1033475556 7:141688752-141688774 AAGGTGCCAGGGGCTACCCTAGG + Intronic
1033877643 7:145842373-145842395 CAGGAGCCAAGGCCTGCAATCGG + Intergenic
1034364642 7:150535971-150535993 CTGGAGCCTGGGGCTGCAAAGGG - Intergenic
1034416050 7:150964758-150964780 CAGGAGGCTGGGGCTCCAGTCGG + Intronic
1034505993 7:151491661-151491683 CAGGAGGCAGAGGCTGCAGTGGG + Intronic
1034516507 7:151584821-151584843 CAGGAACTGGGGGCTGCAGTGGG + Intronic
1034540789 7:151756649-151756671 CTGGAACCAGGAGCTGCAGTTGG - Intronic
1034587340 7:152106345-152106367 CACGAGCCAGTGGCTCCACAGGG - Intronic
1034654905 7:152721765-152721787 CAGGAGGCGGGGGTTGCAGTGGG - Intergenic
1035681779 8:1493739-1493761 CAGGAGCCAGCCGCTGCCCAGGG - Intergenic
1035770443 8:2142827-2142849 CAGGAGGCAGAGGTTGCAATGGG - Intronic
1036240408 8:7075919-7075941 CAGGAGGCAGAGGTTGCAATGGG - Intergenic
1036241963 8:7089070-7089092 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1036254579 8:7195089-7195111 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1036259879 8:7231027-7231049 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1036306737 8:7608495-7608517 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1036311922 8:7689596-7689618 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1036357587 8:8056483-8056505 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1036362914 8:8092399-8092421 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
1036431970 8:8700029-8700051 CAGGAACCAGAGGTTGCAGTGGG + Intergenic
1036487336 8:9191395-9191417 CAGGGTCCAGGGGATGCAGTGGG - Intergenic
1036808467 8:11851261-11851283 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1036895648 8:12632783-12632805 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1036900916 8:12668448-12668470 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1037162717 8:15792687-15792709 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1037590912 8:20311295-20311317 CTGGGGCAAGGGGCTGCCCTGGG + Intergenic
1039051951 8:33503053-33503075 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1039235488 8:35497993-35498015 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1039534219 8:38293474-38293496 CAGCAGGCAGAGGCTGCAGTGGG + Intronic
1040086757 8:43350823-43350845 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1040414934 8:47187636-47187658 TAGGGGCCCTGGGCTGCACTGGG + Intergenic
1040676556 8:49757502-49757524 CAAAAGCCTGGGGCTGGACTCGG - Intergenic
1041019946 8:53628459-53628481 CAGGAGGGAGGGGCAGCTCTGGG - Intergenic
1041061372 8:54037830-54037852 CAGGAGTTCGAGGCTGCACTGGG + Intergenic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1041606939 8:59792915-59792937 CAGGAGCCAAGGCCTGGAATCGG - Intergenic
1041615991 8:59907364-59907386 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
1042162584 8:65912332-65912354 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
1042533678 8:69838598-69838620 CAGGAGGTAGAGGCTGCAGTAGG + Intergenic
1042549546 8:69982097-69982119 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1042980321 8:74519193-74519215 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
1043414469 8:80033385-80033407 GAGGAGCCATGGGCTGGAGTGGG - Intronic
1043537459 8:81221794-81221816 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1043750648 8:83929481-83929503 CAGGAGCCTAGGCCTGGACTTGG + Intergenic
1044071608 8:87767643-87767665 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1044096952 8:88078602-88078624 CAGGAGGCGGAGGCTGCAGTGGG + Intronic
1044671826 8:94689719-94689741 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1045811910 8:106231680-106231702 CAGGGGGCTGGGGCTGCCCTTGG - Intergenic
1046054311 8:109060883-109060905 CAGGAGGCGGGGGTTGCAGTGGG + Intergenic
1046757754 8:117989254-117989276 CAGGAGCCAGGTGAGGCAGTGGG - Intronic
1046964104 8:120143555-120143577 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1047504615 8:125469311-125469333 CAGAAGCCAGGAGCTGCACTGGG - Intergenic
1047734723 8:127755117-127755139 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1047901060 8:129422902-129422924 CAGGAGCTAGGGCCTGGAATAGG - Intergenic
1048029870 8:130621194-130621216 CAGGAGCCAAGGCCTGGAATTGG + Intergenic
1048238105 8:132712507-132712529 CAGGAGCCAGGGGGAGCACAAGG - Intronic
1048331721 8:133475257-133475279 CAGGAGCCAGGAGCGGGCCTGGG + Intronic
1048490835 8:134892314-134892336 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1048802538 8:138207289-138207311 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1048931624 8:139319838-139319860 CAGGTGGGAGAGGCTGCACTAGG + Intergenic
1049084837 8:140470577-140470599 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1049106793 8:140619051-140619073 AAGGAGCCAGCAGCTGCTCTCGG - Intronic
1049200566 8:141338301-141338323 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1049260422 8:141636082-141636104 CAGGAGGTAGAGGCTGCACAAGG + Intergenic
1049277649 8:141727914-141727936 CAGGCGGGAGGGGCTGGACTTGG + Intergenic
1049368916 8:142254243-142254265 CAGGAGTCAGAGGCTGCAACTGG + Intronic
1049411104 8:142474374-142474396 CCGTAGCCAGGAGCAGCACTTGG + Intronic
1049510621 8:143025031-143025053 CAGGAGCTGAGGGCTGCACTGGG + Intergenic
1049594576 8:143477507-143477529 CTGGAGGCCGGGGCTGCACTGGG - Intronic
1049795602 8:144496049-144496071 CAGGAGGCGGGGCCTGCCCTTGG + Intronic
1050751222 9:8940354-8940376 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1050869436 9:10548583-10548605 CAGGAGCCAGGGACACCACATGG - Intronic
1052011916 9:23420713-23420735 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1052026960 9:23584133-23584155 CAGGAGGCAGAGGTTGCAGTCGG + Intergenic
1052094031 9:24362765-24362787 CAGGAGGCAGGGCCTGGAGTTGG - Intergenic
1053362635 9:37500256-37500278 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1053579857 9:39393299-39393321 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1053674806 9:40412994-40413016 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1053844370 9:42221377-42221399 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1053924598 9:43039343-43039365 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1054101444 9:60952108-60952130 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1054122818 9:61227471-61227493 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1054385910 9:64553061-64553083 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1054509814 9:65963299-65963321 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1054584906 9:66954772-66954794 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1055508412 9:76971044-76971066 CATGAGGTAGGGACTGCACTGGG - Intergenic
1055785708 9:79866775-79866797 CAGAACCCAGGTGTTGCACTAGG + Intergenic
1055969039 9:81893354-81893376 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1056553460 9:87670581-87670603 CAGGTGCCAGGTGCTGCAGGTGG - Intronic
1056632657 9:88306480-88306502 CAGGACACAGGGGCTGCTCCAGG + Intergenic
1056746413 9:89307457-89307479 CAGGAGGCAGAGGCTGCAGTGGG + Intergenic
1056785716 9:89591322-89591344 CAGGGGGCAGGGGCTGCATTGGG + Intergenic
1057317675 9:93980127-93980149 ATGGAGGCAGGGACTGCACTTGG + Intergenic
1057908431 9:98999942-98999964 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1057993720 9:99799769-99799791 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1058018016 9:100058147-100058169 CAGGAGTTTGAGGCTGCACTGGG - Intronic
1058407227 9:104690554-104690576 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1058820958 9:108728860-108728882 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1059212290 9:112524806-112524828 CAGGATTCCAGGGCTGCACTAGG - Intronic
1059501284 9:114756390-114756412 CAGGATCCAGAGGCTGAACAAGG + Intergenic
1060127622 9:121064994-121065016 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1060186035 9:121564733-121564755 CAGCAGCCACTGGCTGCTCTGGG + Intergenic
1060224776 9:121784081-121784103 CAGGTGACAGTGGCTGCTCTGGG + Exonic
1060438389 9:123616001-123616023 CAGGAGACAGAGGTTGCAGTGGG - Intronic
1060440463 9:123633700-123633722 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1060815376 9:126632462-126632484 CAGGAGCCTGTGGCTGTGCTCGG + Intronic
1060827690 9:126696032-126696054 CAGGGGGCAGGGGCTGTGCTGGG - Intronic
1060872034 9:127050423-127050445 CAGGACCCAGAGGCTGCCCCTGG + Intronic
1060924405 9:127445962-127445984 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1061020472 9:128011139-128011161 CAGGAGGCAGGGGCTGGGCTGGG + Intergenic
1061355970 9:130105325-130105347 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1061601829 9:131675317-131675339 CAAGAGCCAGGGGCTGGGCGAGG + Intronic
1061603539 9:131689610-131689632 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1061643340 9:131977643-131977665 CAATAGCCTGGGGCTGCTCTTGG + Intronic
1061692619 9:132345943-132345965 CAGGAGGTAGAGGCTGCAGTGGG + Intronic
1061826146 9:133259495-133259517 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1062181424 9:135193193-135193215 AAGGAGCCGGGGGCAGCACTGGG - Intergenic
1062571518 9:137188013-137188035 GAGGGGCCACGGGCTACACTCGG - Exonic
1062699194 9:137890292-137890314 AAGGAGCCCAGGGCTGCCCTTGG + Intronic
1062707829 9:137954962-137954984 CAGGAGGCTGGGGCTGGGCTGGG + Intronic
1185538584 X:883899-883921 CAGGTGCCCGTGGCTGCACTGGG - Intergenic
1185553721 X:1003918-1003940 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1185612967 X:1403009-1403031 GAGGAGACAGAGGCTGCATTTGG - Intergenic
1185612981 X:1403063-1403085 GAGGAGACAGAGGCTGCATTTGG - Intergenic
1185638422 X:1572073-1572095 CAGGAGGCAGAGGTTGCAGTAGG - Intergenic
1185644161 X:1605304-1605326 CAGGAGGCGGAGGTTGCACTGGG - Intergenic
1185685371 X:1924293-1924315 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1185702503 X:2241832-2241854 CAGGAGGCAGAGGTTGCACTGGG + Intronic
1185707095 X:2275915-2275937 CGGGAGGCAGAGGCTGCAGTGGG - Intronic
1187129363 X:16487485-16487507 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1187363430 X:18648313-18648335 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1188191962 X:27182601-27182623 CAGGAGCCAAGGTCTGGAATTGG - Intergenic
1188192021 X:27182911-27182933 CAGGAGCCAGGTCCTGGAGTTGG - Intergenic
1188256509 X:27967551-27967573 CAGGAGCCAGAGGAGGCAATGGG - Intergenic
1188366495 X:29322338-29322360 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1188668335 X:32852240-32852262 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1189314938 X:40048482-40048504 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1189466960 X:41284781-41284803 CAGGAGCCGGGTGTTGCACTGGG - Intergenic
1189593802 X:42543313-42543335 CAGGAGCTAGGGCCTGAAATGGG - Intergenic
1189747092 X:44180359-44180381 GAGGAGCCAGGGGCTTTCCTTGG - Intronic
1189910917 X:45809897-45809919 CAGGAGCCTGGTGCTGCTCAGGG - Intergenic
1189994751 X:46627733-46627755 CAGGGGCCAAGGGAGGCACTTGG + Intronic
1190046327 X:47113989-47114011 CAGGAGCCAGGGCCTGGGCACGG - Intergenic
1190171015 X:48111791-48111813 CAGGAGGCAGAGGCTGTAGTGGG - Intergenic
1190530352 X:51368605-51368627 CAGGAGCTAGGGTCTGCAATGGG - Intergenic
1191821809 X:65318491-65318513 CAGGAGACAGAGGTTGCAGTGGG - Intergenic
1191848918 X:65571188-65571210 CAGAAGCCAGGAGCTGGCCTAGG + Intergenic
1192001736 X:67158781-67158803 CAGGAGCTAGGGCCTGGAATAGG - Intergenic
1192304483 X:69944469-69944491 CAGGAGCCAGGGCCTGGAATGGG + Intronic
1192447549 X:71222320-71222342 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1192539213 X:71954179-71954201 CATGAGCCAGGAGCTACACTAGG + Intergenic
1192554001 X:72076005-72076027 CAGGAGGCAGAGGCTGCAGTGGG - Intergenic
1192863705 X:75107553-75107575 CAGGAGCTAGGGCCTGGAATAGG - Intronic
1193067605 X:77275906-77275928 CATGAGCCAGGGGCTCTACTTGG - Intergenic
1193078622 X:77382502-77382524 CAGGAGCTAGGGTCTGCAAATGG - Intergenic
1193293742 X:79809258-79809280 CAGGAGCCAGGGCCTAGACTTGG + Intergenic
1193463430 X:81817746-81817768 CAGGAGCCAGGGCCTGGAGTTGG + Intergenic
1193787756 X:85781279-85781301 CATGTGCCAAGGGCTGGACTAGG + Intergenic
1193936685 X:87631583-87631605 CAGGAGGCGGAGGCTGCAGTGGG - Intronic
1194257497 X:91652625-91652647 CAGGAGCCTAGGCCTGGACTTGG + Intergenic
1194326557 X:92525555-92525577 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1194398220 X:93412321-93412343 CAAGAGCCAGGGTCTGGATTTGG - Intergenic
1194415502 X:93606603-93606625 CAAGAGCCAAGGCCTGGACTTGG - Intergenic
1194667189 X:96688406-96688428 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1194696726 X:97061738-97061760 CAGGAGGCAGAGGTTGCAGTAGG + Intronic
1195046166 X:101056489-101056511 CAGGAGGCAGAGGTTGCAGTAGG + Intergenic
1195199308 X:102532642-102532664 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
1195290087 X:103423984-103424006 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1195312293 X:103643465-103643487 CAGGAGCCTAGGTCTGGACTTGG - Intergenic
1195595514 X:106683852-106683874 CAGGAGCCAAGGGCTGGGATTGG - Intergenic
1196096797 X:111808946-111808968 CAAGAGCCAGGGCCTGGAATGGG + Intronic
1197075701 X:122350360-122350382 CAGGAGCTAGGGCCTGGAATGGG - Intergenic
1197206179 X:123792520-123792542 CAGGAATCAGAGGCTGCAGTGGG + Intergenic
1197509883 X:127358015-127358037 CAGGAGTCAGAGGTTGCAGTGGG - Intergenic
1197623577 X:128779329-128779351 CAGGAGCTAGGGCCTAGACTGGG + Intergenic
1197670625 X:129273288-129273310 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1197737219 X:129860184-129860206 CAGGAGGCGGAGGCTGCAATGGG + Intergenic
1197753299 X:129980096-129980118 CTGGAGCCAGGGGCTGGCCGAGG + Intergenic
1198195353 X:134355410-134355432 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1198239452 X:134768760-134768782 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1198255732 X:134922860-134922882 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1198257762 X:134939915-134939937 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1198697286 X:139355245-139355267 CAGGAGCTAGGGCCTGGAATGGG + Intergenic
1198794086 X:140377355-140377377 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1198879962 X:141269728-141269750 TAGGAGCCAGGCACTGCTCTAGG + Intergenic
1198938954 X:141931745-141931767 CAGGAGCTAGGGCCTGGAATAGG + Intergenic
1199129831 X:144171719-144171741 CAGGGGCCAGGGGCCTCACGTGG - Intergenic
1199428010 X:147725891-147725913 CAGGAGGCAGAGGTTGCAGTGGG - Intergenic
1199457328 X:148043866-148043888 CAGTAGCCAGGGCCTGGAGTTGG + Intergenic
1199706094 X:150426671-150426693 CAAGAGCCAAGGACTGCTCTGGG + Intronic
1199755915 X:150864990-150865012 CAGGAGGCAGAGGCTGCATTTGG + Intronic
1200080114 X:153572093-153572115 CAAGGGCCAGGACCTGCACTGGG + Intronic
1200576155 Y:4891571-4891593 CAGGAGCCTAGGCCTGGACTTGG + Intergenic
1200624527 Y:5494971-5494993 CAGGAGGCAGAGGTTGCAGTAGG + Intronic
1200635272 Y:5644758-5644780 CAGGAGGCAGAGGTTGCAGTGGG + Intronic
1201323919 Y:12733403-12733425 CAGGAGGCAGAGGTTGCAGTGGG - Intronic
1201551433 Y:15220792-15220814 CAGGAGGCAGAGGTTGCAGTGGG + Intergenic
1202336632 Y:23818656-23818678 CAGGAGACATAGGTTGCACTGGG - Intergenic
1202534133 Y:25851415-25851437 CAGGAGACATAGGTTGCACTGGG + Intergenic
1202599779 Y:26581494-26581516 CAGGAGCCAAGAGCCCCACTAGG + Intergenic