ID: 985548942

View in Genome Browser
Species Human (GRCh38)
Location 5:523767-523789
Sequence CCCCGGGGCCGGGTTTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985548942_985548955 12 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548955 5:523802-523824 CGAGCAGCCTGCAGTCTGCGGGG No data
985548942_985548960 28 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548960 5:523818-523840 TGCGGGGCTCGGAGCGGAGGCGG 0: 1
1: 0
2: 6
3: 40
4: 351
985548942_985548959 25 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548959 5:523815-523837 GTCTGCGGGGCTCGGAGCGGAGG 0: 1
1: 0
2: 0
3: 22
4: 271
985548942_985548961 29 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548961 5:523819-523841 GCGGGGCTCGGAGCGGAGGCGGG 0: 1
1: 0
2: 10
3: 83
4: 601
985548942_985548954 11 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548954 5:523801-523823 GCGAGCAGCCTGCAGTCTGCGGG 0: 1
1: 0
2: 1
3: 21
4: 204
985548942_985548958 22 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548958 5:523812-523834 GCAGTCTGCGGGGCTCGGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 169
985548942_985548962 30 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548962 5:523820-523842 CGGGGCTCGGAGCGGAGGCGGGG 0: 1
1: 0
2: 6
3: 52
4: 459
985548942_985548953 10 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548953 5:523800-523822 CGCGAGCAGCCTGCAGTCTGCGG No data
985548942_985548956 17 Left 985548942 5:523767-523789 CCGAAGGAAACCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 985548956 5:523807-523829 AGCCTGCAGTCTGCGGGGCTCGG 0: 1
1: 0
2: 18
3: 42
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985548942 Original CRISPR CCCCGGGGCCGGGTTTCCTT CGG (reversed) Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
903813033 1:26045550-26045572 CCCCGGGGCGGGGCTGCCTGGGG + Intronic
907406791 1:54258670-54258692 CCCAGGCGACGGGTTTCCTGGGG + Intronic
913609518 1:120496468-120496490 CCCCAGAGCCCTGTTTCCTTAGG + Intergenic
914204301 1:145514048-145514070 CCCCAGAGCCCTGTTTCCTTGGG - Intergenic
914483425 1:148087236-148087258 CCCCAGAGCCCTGTTTCCTTAGG - Intergenic
914581673 1:149025376-149025398 CCCCAGAGCCCTGTTTCCTTAGG - Intronic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
1063592567 10:7408211-7408233 TCCCGGGGCCGGCTTTCCCATGG - Intronic
1072716783 10:97757530-97757552 CCCCCAGGCCCAGTTTCCTTGGG + Intronic
1073951470 10:108814130-108814152 CCATGGGGCAGGGATTCCTTGGG + Intergenic
1076866219 10:133167684-133167706 GCCCGGACCCGGGTTTCCTGTGG + Intronic
1083966717 11:66048026-66048048 CCACTGGGCTGGGTTTCCATCGG + Intronic
1086322494 11:85664932-85664954 CCCTGGGGCCTGGGATCCTTGGG - Exonic
1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG + Exonic
1094500900 12:31020128-31020150 CCCTGTGGTCGGGTTTCTTTTGG - Intergenic
1096611960 12:52807933-52807955 CCCCTGGTCCAGCTTTCCTTGGG + Intronic
1101606192 12:106248533-106248555 TCCCGGGGCCAGGGCTCCTTGGG - Intronic
1102310745 12:111842561-111842583 CCCCGGCGCCGGCTCTGCTTCGG - Intronic
1107969506 13:45627779-45627801 CCCCAGGGCAGTGCTTCCTTTGG + Intergenic
1123123856 14:105930472-105930494 GCCCTGGGCTGTGTTTCCTTGGG + Intronic
1129027209 15:72588246-72588268 GCCCATGGCCGGGTTTTCTTTGG - Exonic
1129921472 15:79322666-79322688 ACCCAGGGCCTGGTTTCCTCAGG - Exonic
1132847067 16:2005575-2005597 CCCCTGGCACGGGTTTCCTCTGG - Intronic
1134261541 16:12654987-12655009 CCCCAGGGCCTCTTTTCCTTAGG - Intergenic
1138187670 16:54988757-54988779 CCCCTGGCCCAAGTTTCCTTTGG + Intergenic
1141509920 16:84505361-84505383 CCCCGGGACCAGGTTTCGGTGGG - Intronic
1141644914 16:85362110-85362132 CCCTGGGGCTGGGATTCCTCTGG + Intergenic
1142374974 16:89701997-89702019 CCCCGCGGCCGGGTCGCCTGGGG - Intergenic
1142474301 17:180519-180541 CCGCGGGGCCGCTTGTCCTTTGG - Intronic
1144787047 17:17837709-17837731 CCCTGGGGCCAGTCTTCCTTGGG - Intergenic
1144967799 17:19089026-19089048 CCCCCGGGCCGGGCTCCCTATGG - Intergenic
1144980117 17:19163037-19163059 CCCCCGGGCCGGGCTCCCTATGG + Intergenic
1144988105 17:19215195-19215217 CCCCCGGGCCGGGCTCCCTATGG - Intergenic
1148157244 17:45431367-45431389 CCCCGGGTCCGGGCCACCTTAGG - Intronic
1148563846 17:48621602-48621624 GCCCTGGGGCGGGTCTCCTTTGG + Exonic
1149603484 17:57908451-57908473 CCCAGGGGCACGGTTTCCTGAGG + Intronic
1150790504 17:68197837-68197859 CCCCTGGTCCGGGTCACCTTAGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152357034 17:79812504-79812526 CGCTGGGGCCTGGGTTCCTTTGG + Intergenic
1152610767 17:81314115-81314137 CCCCGGGCCTGGGTTCCCTCTGG - Intronic
1155054843 18:22173497-22173519 CCTAGGGGCCAGGATTCCTTAGG + Intronic
1161114326 19:2488383-2488405 CCCCGGAGCCGGGGTGCATTGGG + Intergenic
1161316449 19:3619714-3619736 CCCTGGTGACGGGTTCCCTTGGG - Intronic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1168692885 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG + Exonic
925910525 2:8570792-8570814 CCCCGGGGCCTGGGAACCTTGGG + Intergenic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
1169068530 20:2707830-2707852 CCCTGGGGCAGGGTCTCCCTGGG + Intronic
1173034682 20:39397103-39397125 CCAGGAGGCTGGGTTTCCTTGGG + Intergenic
1175412197 20:58777712-58777734 CCCCCAGGCTGGCTTTCCTTTGG - Intergenic
1175952310 20:62590087-62590109 CCCAGGGGCCAGCTTTGCTTTGG - Intergenic
1176076557 20:63250952-63250974 CCCCGGGCCCAGGTGTCTTTTGG - Intronic
1176205778 20:63887393-63887415 CCCTGGGGTCGAGTTTCCTTCGG + Intronic
1176943905 21:14955788-14955810 CCACGGACCCGGATTTCCTTGGG + Intergenic
1178883259 21:36465088-36465110 CCTCTGGTCCTGGTTTCCTTGGG - Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180151481 21:45950476-45950498 CTCCGGGGCGGGGTGGCCTTGGG + Intergenic
1181009738 22:20033185-20033207 CCCAGGGGCTGGCTTTCCTCTGG + Intronic
1181442186 22:22942314-22942336 CCCCGGGGCCGGGTAGACTGGGG - Intergenic
1182294995 22:29307244-29307266 CCCCGGGGCTGTGTGACCTTGGG + Intronic
1183650906 22:39152757-39152779 CCCCGGGGGCGGGGTTCCGATGG - Intergenic
1185226941 22:49658546-49658568 CCCCGGGGCCACGTTCCCTCTGG + Intergenic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
950430013 3:12945185-12945207 CCCCGGGGCAGGGTATCTTTGGG + Intronic
955971935 3:64445206-64445228 CCGCGGGGCCGGCTTACCTGGGG + Intronic
962891719 3:139678015-139678037 GGCCAGGGCCGGGTCTCCTTAGG - Intronic
966928277 3:184659543-184659565 CCTCGGGTCTGGGTTTCATTTGG + Intronic
967269306 3:187719840-187719862 CCCTGGGGCCAGCTTCCCTTAGG + Intronic
968884721 4:3321650-3321672 CCCCAGGGCAGGGTTTTCTGTGG + Intronic
968977000 4:3827341-3827363 CTCCTGGGCCGTGTGTCCTTAGG + Intergenic
973258798 4:48140162-48140184 CCCTGGGCCTGAGTTTCCTTAGG + Intronic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986449414 5:7850581-7850603 CCTGGGGGCGGGGTTACCTTAGG - Intronic
997654535 5:135545396-135545418 CACAGGGGCCTGGTTTCCCTGGG - Intergenic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
1002297604 5:178240140-178240162 AGCAGGGGCCGGGTTTCCTCAGG + Intronic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1004395774 6:15245558-15245580 CCCCGGGGCCGGGCGTCCTGGGG + Intergenic
1015910048 6:138161349-138161371 TCTCTGGGCCTGGTTTCCTTGGG + Intergenic
1017817737 6:158027662-158027684 CCCAGGGGAGGGGCTTCCTTGGG - Intronic
1017914175 6:158819079-158819101 CCCAGGCTCCGCGTTTCCTTCGG + Intronic
1018186973 6:161273831-161273853 CTCCTGGGCTGGATTTCCTTAGG - Intronic
1019161985 6:170075188-170075210 CTCCCGGGCCGCGTTTCCATGGG - Intergenic
1023908498 7:44538322-44538344 CACCTGGGCCGGGTGTCCTGGGG - Intronic
1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG + Intronic
1036999907 8:13705664-13705686 CCCCAGGTCCAGGTTTCCCTGGG + Intergenic
1044520474 8:93193698-93193720 CCCCCGGGCAGGGTTATCTTTGG + Intergenic
1049618376 8:143586542-143586564 CCCCCGGGCCGGGTCTGCTCAGG - Intronic
1049637065 8:143694765-143694787 CCCCGGCGCCGGGCATCCTGGGG + Exonic
1056468696 9:86884361-86884383 CCCAGAGGCCAGCTTTCCTTAGG + Intergenic
1056874571 9:90315804-90315826 CCCTGGAGTCGGCTTTCCTTAGG + Intergenic
1060886785 9:127160279-127160301 CCTTGGGGCCGGGTGTCCTGTGG + Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061065694 9:128276229-128276251 GGGCGGGGCCGGCTTTCCTTGGG + Exonic
1061779985 9:132989716-132989738 CCCCGGGGCCTCATTTCCTCCGG + Intronic
1061868287 9:133506577-133506599 CCCTGGGGCTGTGTGTCCTTGGG - Intergenic
1062047529 9:134431410-134431432 CCCCAGGGCCTGGTGTCCCTGGG - Intronic
1185456304 X:312558-312580 CCCAGGAGACGGGTTTCCTGTGG - Intronic
1188860089 X:35245029-35245051 CCCCGGGCCCAGCTTTGCTTCGG + Intergenic
1192035234 X:67555802-67555824 CCCCGTGGCAGGATTTCCCTGGG + Intronic
1200179248 X:154140484-154140506 CCCAGGGGCCCTCTTTCCTTGGG + Intergenic