ID: 985551277

View in Genome Browser
Species Human (GRCh38)
Location 5:534788-534810
Sequence CTGAGTCCTCACTTCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551277_985551292 18 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551292 5:534829-534851 AGGGGGACCCGGGGTGGACGCGG No data
985551277_985551282 0 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551282 5:534811-534833 GTCAGCACCCCCATAGGAAGGGG No data
985551277_985551296 27 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG No data
985551277_985551279 -6 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data
985551277_985551295 26 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551277_985551281 -1 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551281 5:534810-534832 GGTCAGCACCCCCATAGGAAGGG No data
985551277_985551283 1 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551283 5:534812-534834 TCAGCACCCCCATAGGAAGGGGG No data
985551277_985551287 8 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551287 5:534819-534841 CCCCATAGGAAGGGGGACCCGGG No data
985551277_985551291 12 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551291 5:534823-534845 ATAGGAAGGGGGACCCGGGGTGG No data
985551277_985551289 9 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551289 5:534820-534842 CCCATAGGAAGGGGGACCCGGGG No data
985551277_985551280 -2 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data
985551277_985551285 7 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551285 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551277 Original CRISPR CTGAGTCCTCACTTCCGCTC TGG (reversed) Intergenic
No off target data available for this crispr