ID: 985551279

View in Genome Browser
Species Human (GRCh38)
Location 5:534805-534827
Sequence ACTCAGGTCAGCACCCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551277_985551279 -6 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data
985551272_985551279 14 Left 985551272 5:534768-534790 CCAGACTCCTGCGAGAAAACCCA No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data
985551271_985551279 26 Left 985551271 5:534756-534778 CCAGCTGCTTGTCCAGACTCCTG No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data
985551276_985551279 -5 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data
985551274_985551279 7 Left 985551274 5:534775-534797 CCTGCGAGAAAACCCAGAGCGGA No data
Right 985551279 5:534805-534827 ACTCAGGTCAGCACCCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551279 Original CRISPR ACTCAGGTCAGCACCCCCAT AGG Intergenic
No off target data available for this crispr